BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067043.2.1
(834 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU809624.1|BU809624 UL60PA08 Populus leaf cDNA library P... 42 0.033
gb|BU809625.1|BU809625 UL60PA09 Populus leaf cDNA library P... 42 0.033
gb|BU809626.1|BU809626 UL60PA10 Populus leaf cDNA library P... 42 0.033
gb|DN490529.1|DN490529 UL60PA09.3pR Populus cold stressed l... 42 0.033
gb|DN500515.1|DN500515 UL60PA09.5pR Populus cold stressed l... 42 0.033
>gb|BU809624.1|BU809624 UL60PA08 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 335
Score = 42.1 bits (21), Expect = 0.033
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 123 ccttttgcttcattggtcacc 143
|||||||||||||||||||||
Sbjct: 143 ccttttgcttcattggtcacc 163
>gb|BU809625.1|BU809625 UL60PA09 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 390
Score = 42.1 bits (21), Expect = 0.033
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 123 ccttttgcttcattggtcacc 143
|||||||||||||||||||||
Sbjct: 143 ccttttgcttcattggtcacc 163
>gb|BU809626.1|BU809626 UL60PA10 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 330
Score = 42.1 bits (21), Expect = 0.033
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 123 ccttttgcttcattggtcacc 143
|||||||||||||||||||||
Sbjct: 142 ccttttgcttcattggtcacc 162
>gb|DN490529.1|DN490529 UL60PA09.3pR Populus cold stressed leaves cDNA library Populus
tremula x Populus tremuloides cDNA clone UL60PA09 3',
mRNA sequence
Length = 564
Score = 42.1 bits (21), Expect = 0.033
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 123 ccttttgcttcattggtcacc 143
|||||||||||||||||||||
Sbjct: 421 ccttttgcttcattggtcacc 401
>gb|DN500515.1|DN500515 UL60PA09.5pR Populus cold stressed leaves cDNA library Populus
tremula x Populus tremuloides cDNA clone UL60PA09 5',
mRNA sequence
Length = 570
Score = 42.1 bits (21), Expect = 0.033
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 123 ccttttgcttcattggtcacc 143
|||||||||||||||||||||
Sbjct: 144 ccttttgcttcattggtcacc 164
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 110,556
Number of Sequences: 369679
Number of extensions: 110556
Number of successful extensions: 32339
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32334
Number of HSP's gapped (non-prelim): 5
length of query: 834
length of database: 203,408,664
effective HSP length: 19
effective length of query: 815
effective length of database: 196,384,763
effective search space: 160053581845
effective search space used: 160053581845
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)