BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521569.2.1
(887 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW056602.1|AW056602 ST53C10 Pine TriplEx shoot tip libra... 52 4e-005
gb|BF220484.1|BF220484 NXCI_147_B05_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BF221274.1|BF221274 NXCI_156_G07_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|CF393839.1|CF393839 RTDS2_1_A05.g1_A021 Drought-stressed... 52 4e-005
gb|CF476510.1|CF476510 RTWW3_1_A12.g1_A022 Well-watered lob... 52 4e-005
gb|CF477415.1|CF477415 RTWW3_7_G07.g1_A022 Well-watered lob... 52 4e-005
gb|CF672241.1|CF672241 RTCNT1_62_G02.b1_A029 Root control P... 52 4e-005
gb|CF672326.1|CF672326 RTCNT1_62_G02.g1_A029 Root control P... 52 4e-005
gb|CO165410.1|CO165410 FLD1_54_H04.b1_A029 Root flooded Pin... 52 4e-005
gb|CO165491.1|CO165491 FLD1_54_H04.g1_A029 Root flooded Pin... 52 4e-005
gb|CO166187.1|CO166187 FLD1_60_A12.b1_A029 Root flooded Pin... 52 4e-005
gb|CO368668.1|CO368668 RTK1_42_C01.b1_A029 Roots minus pota... 52 4e-005
gb|CO368744.1|CO368744 RTK1_42_C01.g1_A029 Roots minus pota... 52 4e-005
gb|CV034557.1|CV034557 RTNACL1_10_A06.b1_A029 Roots plus ad... 52 4e-005
gb|CV034621.1|CV034621 RTNACL1_10_A06.g1_A029 Roots plus ad... 52 4e-005
gb|CX648234.1|CX648234 COLD1_27_H06.b1_A029 Root cold Pinus... 52 4e-005
gb|CX648317.1|CX648317 COLD1_27_H06.g1_A029 Root cold Pinus... 52 4e-005
gb|DR056287.1|DR056287 RTCA1_29_F12.b1_A029 Roots minus cal... 52 4e-005
gb|DR056364.1|DR056364 RTCA1_29_F12.g1_A029 Roots minus cal... 52 4e-005
gb|DR387675.1|DR387675 RTHG1_23_H11.b1_A029 Roots plus adde... 52 4e-005
gb|DR742450.1|DR742450 RTCU1_4_D01.b1_A029 Roots plus added... 52 4e-005
>gb|AW056602.1|AW056602 ST53C10 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST53C10, mRNA sequence
Length = 408
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 298 gaaggagctattgccatggcaaccctctggacagatgc 261
>gb|BF220484.1|BF220484 NXCI_147_B05_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_147_B05 5' similar to Arabidopsis
thaliana sequence At1g52150 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 462
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 177 gaaggagctattgccatggcaaccctctggacagatgc 140
>gb|BF221274.1|BF221274 NXCI_156_G07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_156_G07 5' similar to Arabidopsis
thaliana sequence At1g52150 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 528
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 177 gaaggagctattgccatggcaaccctctggacagatgc 140
>gb|CF393839.1|CF393839 RTDS2_1_A05.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_1_A05_A021 5', mRNA sequence
Length = 806
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 630 gaaggagctattgccatggcaaccctctggacagatgc 593
>gb|CF476510.1|CF476510 RTWW3_1_A12.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_1_A12_A022 5', mRNA sequence
Length = 468
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 340 gaaggagctattgccatggcaaccctctggacagatgc 303
>gb|CF477415.1|CF477415 RTWW3_7_G07.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_7_G07_A022 5', mRNA sequence
Length = 752
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 275 gaaggagctattgccatggcaaccctctggacagatgc 238
>gb|CF672241.1|CF672241 RTCNT1_62_G02.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_62_G02_A029 3', mRNA sequence
Length = 784
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 87 gaaggagctattgccatggcaaccctctggacagatgc 50
>gb|CF672326.1|CF672326 RTCNT1_62_G02.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_62_G02_A029 5', mRNA sequence
Length = 787
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 386 gaaggagctattgccatggcaaccctctggacagatgc 349
>gb|CO165410.1|CO165410 FLD1_54_H04.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_54_H04_A029 3', mRNA sequence
Length = 840
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 164 gaaggagctattgccatggcaaccctctggacagatgc 201
>gb|CO165491.1|CO165491 FLD1_54_H04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_54_H04_A029 5', mRNA sequence
Length = 815
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 619 gaaggagctattgccatggcaaccctctggacagatgc 656
>gb|CO166187.1|CO166187 FLD1_60_A12.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_60_A12_A029 3', mRNA sequence
Length = 751
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 54 gaaggagctattgccatggcaaccctctggacagatgc 17
>gb|CO368668.1|CO368668 RTK1_42_C01.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_42_C01_A029 3', mRNA sequence
Length = 784
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 87 gaaggagctattgccatggcaaccctctggacagatgc 50
>gb|CO368744.1|CO368744 RTK1_42_C01.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_42_C01_A029 5', mRNA sequence
Length = 758
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 80 gaaggagctattgccatggcaaccctctgaacagatgc 43
>gb|CV034557.1|CV034557 RTNACL1_10_A06.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_10_A06_A029 3', mRNA sequence
Length = 813
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 118 gaaggagctattgccatggcaaccctctggacagatgc 81
>gb|CV034621.1|CV034621 RTNACL1_10_A06.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_10_A06_A029 5', mRNA sequence
Length = 731
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 94 gaaggagctattgccatggcaaccctctggacagatgc 57
>gb|CX648234.1|CX648234 COLD1_27_H06.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_27_H06_A029 3', mRNA sequence
Length = 802
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 507 gaaggagctattgccatggcaaccctctggacagatgc 544
>gb|CX648317.1|CX648317 COLD1_27_H06.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_27_H06_A029 5', mRNA sequence
Length = 809
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 675 gaaggagctattgccatggcaaccctctggacagatgc 712
>gb|DR056287.1|DR056287 RTCA1_29_F12.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_29_F12_A029 3', mRNA sequence
Length = 782
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 86 gaaggagctattgccatggcaaccctctggacagatgc 49
>gb|DR056364.1|DR056364 RTCA1_29_F12.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_29_F12_A029 5', mRNA sequence
Length = 638
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 219 gaaggagctattgccatggcaaccctctggacagatgc 182
>gb|DR387675.1|DR387675 RTHG1_23_H11.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_23_H11_A029 3', mRNA sequence
Length = 760
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 64 gaaggagctattgccatggcaaccctctggacagatgc 27
>gb|DR742450.1|DR742450 RTCU1_4_D01.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_4_D01_A029 3', mRNA sequence
Length = 702
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 694 gaaggagctattgccatggctaccctctgcaccgatgc 731
|||||||||||||||||||| |||||||| || |||||
Sbjct: 614 gaaggagctattgccatggcaaccctctggacagatgc 651
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 73,742
Number of Sequences: 355925
Number of extensions: 73742
Number of successful extensions: 20391
Number of sequences better than 0.5: 21
Number of HSP's better than 0.5 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20338
Number of HSP's gapped (non-prelim): 53
length of query: 887
length of database: 217,277,237
effective HSP length: 19
effective length of query: 868
effective length of database: 210,514,662
effective search space: 182726726616
effective search space used: 182726726616
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)