BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3173057.2.1
(1264 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE943299.1|BE943299 EST422878 MGHG Medicago truncatula c... 50 5e-004
gb|BI269436.1|BI269436 NF015G03IR1F1023 Irradiated Medicago... 50 5e-004
gb|CA920658.1|CA920658 EST638376 MTUS Medicago truncatula c... 50 5e-004
gb|CX539437.1|CX539437 s13dNF70H11GS092_462134 Germinating ... 50 5e-004
gb|CX540377.1|CX540377 s13dNF74D11GS093_464028 Germinating ... 50 5e-004
>gb|BE943299.1|BE943299 EST422878 MGHG Medicago truncatula cDNA clone pMGHG-15I8, mRNA
sequence
Length = 540
Score = 50.1 bits (25), Expect = 5e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
|||||||||| ||||| || || ||||||||||||||||||| ||||||||
Sbjct: 399 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 347
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 294 acatcttcatatccatcaatgctcactaccttggcatttttcct 251
>gb|BI269436.1|BI269436 NF015G03IR1F1023 Irradiated Medicago truncatula cDNA clone
NF015G03IR 5', mRNA sequence
Length = 362
Score = 50.1 bits (25), Expect = 5e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
|||||||||| ||||| || || ||||||||||||||||||| ||||||||
Sbjct: 174 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 122
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 69 acatcttcatatccatcaatgctcactaccttggcatttttcct 26
>gb|CA920658.1|CA920658 EST638376 MTUS Medicago truncatula cDNA clone MTUS-30G8, mRNA
sequence
Length = 538
Score = 50.1 bits (25), Expect = 5e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
|||||||||| ||||| || || ||||||||||||||||||| ||||||||
Sbjct: 474 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 526
>gb|CX539437.1|CX539437 s13dNF70H11GS092_462134 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 493
Score = 50.1 bits (25), Expect = 5e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
|||||||||| ||||| || || ||||||||||||||||||| ||||||||
Sbjct: 425 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 373
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 320 acatcttcatatccatcaatgctcactaccttggcatttttcct 277
>gb|CX540377.1|CX540377 s13dNF74D11GS093_464028 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 511
Score = 50.1 bits (25), Expect = 5e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
|||||||||| ||||| || || ||||||||||||||||||| ||||||||
Sbjct: 113 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 61
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 150,577
Number of Sequences: 392609
Number of extensions: 150577
Number of successful extensions: 10477
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10469
Number of HSP's gapped (non-prelim): 8
length of query: 1264
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1244
effective length of database: 433,880,813
effective search space: 539747731372
effective search space used: 539747731372
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)