BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115208.2.3
(672 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR500439.1| mth2-177B20RM1 BAC end, cultivar Jemalong A... 46 0.004
gb|AC146567.10| Medicago truncatula clone mth2-99p24, compl... 46 0.004
gb|CX538744.1|CX538744 s13dNF0AA03GS017_460742 Germinating ... 42 0.059
>emb|CR500439.1| mth2-177B20RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 759
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 59 ttccgcaccttcatcgagatcgtcttcgagaaccc 93
|||||||||||| | |||||| |||||||||||||
Sbjct: 114 ttccgcaccttcgttgagatcatcttcgagaaccc 148
>gb|AC146567.10| Medicago truncatula clone mth2-99p24, complete sequence
Length = 141672
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 59 ttccgcaccttcatcgagatcgtcttcgagaaccc 93
|||||||||||| | |||||| |||||||||||||
Sbjct: 25716 ttccgcaccttcgttgagatcatcttcgagaaccc 25750
>gb|CX538744.1|CX538744 s13dNF0AA03GS017_460742 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 408
Score = 42.1 bits (21), Expect = 0.059
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 59 ttccgcaccttcatcgagatcgtcttcgagaaccccg 95
||||| |||||||| || ||| |||||||||||||||
Sbjct: 330 ttccgtaccttcattgaaatcatcttcgagaaccccg 366
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 131,169
Number of Sequences: 392609
Number of extensions: 131169
Number of successful extensions: 10788
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10780
Number of HSP's gapped (non-prelim): 8
length of query: 672
length of database: 441,732,993
effective HSP length: 19
effective length of query: 653
effective length of database: 434,273,422
effective search space: 283580544566
effective search space used: 283580544566
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)