BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2622915.2.1
(584 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW698672.1|AW698672 R103 non-glandular-haired subtracted... 34 0.10
gb|CO512959.1|CO512959 s13dSG86H0300028_121844 Glandular tr... 34 0.10
gb|CO513469.1|CO513469 s13dSG10F0200015_130102 Glandular tr... 34 0.10
gb|CO516824.1|CO516824 s13dSG98B0900075_446976 Glandular tr... 34 0.10
gb|CO514711.1|CO514711 s13dSG55C0100006_328082 Glandular tr... 32 0.41
>gb|AW698672.1|AW698672 R103 non-glandular-haired subtracted cDNA library Medicago sativa
cDNA, mRNA sequence
Length = 251
Score = 34.2 bits (17), Expect = 0.10
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 261 attcttcttcttcactt 277
|||||||||||||||||
Sbjct: 156 attcttcttcttcactt 140
>gb|CO512959.1|CO512959 s13dSG86H0300028_121844 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 570
Score = 34.2 bits (17), Expect = 0.10
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 113 aaacacagagaaatcaacatc 133
||||||||||||| |||||||
Sbjct: 75 aaacacagagaaagcaacatc 95
>gb|CO513469.1|CO513469 s13dSG10F0200015_130102 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 583
Score = 34.2 bits (17), Expect = 0.10
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 258 cagattcttcttcttca 274
|||||||||||||||||
Sbjct: 90 cagattcttcttcttca 106
>gb|CO516824.1|CO516824 s13dSG98B0900075_446976 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 462
Score = 34.2 bits (17), Expect = 0.10
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 258 cagattcttcttcttca 274
|||||||||||||||||
Sbjct: 94 cagattcttcttcttca 110
>gb|CO514711.1|CO514711 s13dSG55C0100006_328082 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 449
Score = 32.2 bits (16), Expect = 0.41
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 258 cagattcttcttcttc 273
||||||||||||||||
Sbjct: 90 cagattcttcttcttc 105
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1584
Number of Sequences: 7669
Number of extensions: 1584
Number of successful extensions: 590
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 584
Number of HSP's gapped (non-prelim): 6
length of query: 584
length of database: 3,745,706
effective HSP length: 16
effective length of query: 568
effective length of database: 3,623,002
effective search space: 2057865136
effective search space used: 2057865136
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)