BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.065K11F020919.3.1
(383 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815248.1|CN815248 HRO4507_E09_J17ZS5 Lib AA071E1X Aven... 32 0.34
gb|CN816724.1|CN816724 HRO4524_A09_B18ZS5 Lib AA071E1X Aven... 32 0.34
gb|CN817782.1|CN817782 HRO4461_B09_D17ZS5 Lib AA070E1X Aven... 32 0.34
>gb|CN815248.1|CN815248 HRO4507_E09_J17ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4507_E09_J17, mRNA sequence
Length = 591
Score = 32.2 bits (16), Expect = 0.34
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 279 tattgtatagtacctgtgta 298
|||| |||||||||||||||
Sbjct: 380 tattatatagtacctgtgta 399
>gb|CN816724.1|CN816724 HRO4524_A09_B18ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4524_A09_B18, mRNA sequence
Length = 490
Score = 32.2 bits (16), Expect = 0.34
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 279 tattgtatagtacctgtgta 298
|||| |||||||||||||||
Sbjct: 279 tattatatagtacctgtgta 298
>gb|CN817782.1|CN817782 HRO4461_B09_D17ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4461_B09_D17, mRNA sequence
Length = 676
Score = 32.2 bits (16), Expect = 0.34
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 279 tattgtatagtacctgtgta 298
|||| |||||||||||||||
Sbjct: 484 tattatatagtacctgtgta 503
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 724
Number of Sequences: 8143
Number of extensions: 724
Number of successful extensions: 159
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 156
Number of HSP's gapped (non-prelim): 3
length of query: 383
length of database: 4,702,463
effective HSP length: 15
effective length of query: 368
effective length of database: 4,580,318
effective search space: 1685557024
effective search space used: 1685557024
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)