BLASTN 2.2.6 [Apr-09-2003]
BLASTN 2.2.6 [Apr-09-2003]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCL35a05.yg.2.1
         (567 letters)

Database: mais_NCBI.fasta 
           836,351 sequences; 669,372,029 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|92087123|gb|AC185291.1| Zea mays chromosome UNK clone CH201-4...    38   1.2  
gi|32938926|gb|CF043745.1|CF043745 QCJ20e12.yg QCJ Zea mays cDNA...    36   4.6  
gi|74238425|gb|DT646339.1|DT646339 ZM_BFb0106M14.f ZM_BFb Zea ma...    36   4.6  
gi|78092180|gb|DV520554.1|DV520554 ZM_BFb0205H14.f ZM_BFb Zea ma...    36   4.6  
gi|91176472|gb|AC184834.1| Zea mays chromosome UNK clone ZMMBBb-...    36   4.6  
gi|89257773|gb|AC177882.2| Zea mays chromosome UNK clone CH201-2...    36   4.6  

>gi|92087123|gb|AC185291.1| Zea mays chromosome UNK clone CH201-478E19;
              ZMMBBc0478E19, *** SEQUENCING IN PROGRESS ***, 21 unordered
              pieces
          Length = 174485

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     ccatcagtccataagtttt 40
              |||||||||||||||||||
Sbjct: 144871 ccatcagtccataagtttt 144889


>gi|32938926|gb|CF043745.1|CF043745 QCJ20e12.yg QCJ Zea mays cDNA
           clone QCJ20e12, mRNA sequence
          Length = 417

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 192 atgttcctccatccactg 209
           ||||||||||||||||||
Sbjct: 241 atgttcctccatccactg 258


>gi|74238425|gb|DT646339.1|DT646339 ZM_BFb0106M14.f ZM_BFb Zea mays
           cDNA 3', mRNA sequence
          Length = 653

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 192 atgttcctccatccactg 209
           ||||||||||||||||||
Sbjct: 264 atgttcctccatccactg 281


>gi|78092180|gb|DV520554.1|DV520554 ZM_BFb0205H14.f ZM_BFb Zea mays
           cDNA 3', mRNA sequence
          Length = 718

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 192 atgttcctccatccactg 209
           ||||||||||||||||||
Sbjct: 93  atgttcctccatccactg 110


>gi|91176472|gb|AC184834.1| Zea mays chromosome UNK clone ZMMBBb-578J3;
             ZMMBBb0578J03, *** SEQUENCING IN PROGRESS ***, 12
             unordered pieces
          Length = 119906

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                               
Query: 348   acaacaagatcattcagaacatcatcaagatgat 381
             ||||||||||| | ||||||||| || |||||||
Sbjct: 31679 acaacaagatcgtccagaacatcctcgagatgat 31712


>gi|89257773|gb|AC177882.2| Zea mays chromosome UNK clone CH201-213M6;
              ZMMBBc0213M06, *** SEQUENCING IN PROGRESS ***, 10 unordered
              pieces
          Length = 206823

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 134    accagtgaggcgaccagg 151
              ||||||||||||||||||
Sbjct: 105406 accagtgaggcgaccagg 105389


  Database: mais_NCBI.fasta
    Posted date:  Apr 26, 2006 11:51 AM
  Number of letters in database: 669,372,029
  Number of sequences in database:  836,351
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,963
Number of Sequences: 836351
Number of extensions: 130963
Number of successful extensions: 10921
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10901
Number of HSP's gapped (non-prelim): 20
length of query: 567
length of database: 669,372,029
effective HSP length: 19
effective length of query: 548
effective length of database: 653,481,360
effective search space: 358107785280
effective search space used: 358107785280
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)