BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= QCH10g11.yg.2.1 (632 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|91982820|gb|AC185276.1| Zea mays chromosome UNK clone CH201-3... 46 0.005 gi|24763681|gb|CA398852.1|CA398852 EL01N0311A12.g Endosperm_3 Ze... 44 0.021 gi|56691579|gb|CX129482.1|CX129482 QAO2f02.yg QAO Zea mays cDNA ... 44 0.021 gi|61236824|gb|DN586547.1|DN586547 EST6538 Zea mays embryo sac c... 44 0.021 gi|18659825|gb|BM500541.1|BM500541 PAC000000000632 Pioneer AF-1 ... 40 0.33 gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence 40 0.33 gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence 40 0.33 gi|31909195|gb|CD650797.1|CD650797 3529_1_129_1_H12.y_2 3529 - 2... 38 1.3 gi|32862685|gb|CF002367.1|CF002367 QBH11b04.xg QBH Zea mays cDNA... 38 1.3 gi|32862900|gb|CF002582.1|CF002582 QBH12h09.xg QBH Zea mays cDNA... 38 1.3 gi|32912739|gb|CF017551.1|CF017551 QBM25f09.xg QBM Zea mays cDNA... 38 1.3 gi|58029445|gb|CX724872.1|CX724872 EST5012 Zea mays embryo sac c... 38 1.3 gi|60339086|gb|DN206059.1|DN206059 MEST827_C09.T7-1 UGA-ZmSAM-XZ... 38 1.3 gi|60341367|gb|DN208340.1|DN208340 MEST868_F04.T7-1 UGA-ZmSAM-XZ... 38 1.3 gi|60355035|gb|DN222008.1|DN222008 MEST1122_B12.T7-1 UGA-ZmSAM-X... 38 1.3 gi|61119727|gb|DN560688.1|DN560688 ME8-B06-T3-96-R1 E7PCR Zea ma... 38 1.3 gi|61236778|gb|DN586511.1|DN586511 EST6502 Zea mays embryo sac c... 38 1.3 gi|67013747|gb|CO442496.1|CO442496 MZCCL10044D03.g Maize Endospe... 38 1.3 gi|67016359|gb|CO445108.1|CO445108 MZCCL10080D11.g Maize Endospe... 38 1.3 gi|67016465|gb|CO445214.1|CO445214 MZCCL10081G09.g Maize Endospe... 38 1.3 gi|71316791|gb|DR795082.1|DR795082 ZM_BFb0016B03.r ZM_BFb Zea ma... 38 1.3 gi|76291003|gb|DV030571.1|DV030571 ZM_BFb0153H24.r ZM_BFb Zea ma... 38 1.3 gi|76929411|gb|DV172004.1|DV172004 ZM_BFb0173C07.r ZM_BFb Zea ma... 38 1.3 gi|78081267|gb|DV509679.1|DV509679 ZM_BFb0188O21.r ZM_BFb Zea ma... 38 1.3 gi|78105032|gb|DV523450.1|DV523450 ZM_BFb0209K19.r ZM_BFb Zea ma... 38 1.3 gi|78108719|gb|DV527137.1|DV527137 ZM_BFb0215A19.r ZM_BFb Zea ma... 38 1.3 gi|89251187|gb|DY622973.1|DY622973 ZM_BFb0293C03.r ZM_BFb Zea ma... 38 1.3 gi|93017240|gb|EB642760.1|EB642760 ZM_BFb0333E19.r ZM_BFb Zea ma... 38 1.3 gi|21208998|gb|AY105920.1| Zea mays PCO073266 mRNA sequence 38 1.3 gi|21208998|gb|AY105920.1| Zea mays PCO073266 mRNA sequence 38 1.3 gi|88687866|gb|AC182833.1| Zea mays chromosome UNK clone CH201-1... 38 1.3 gi|92900561|gb|AC185458.1| Zea mays chromosome UNK clone CH201-3... 36 5.2 gi|92110158|gb|AC185296.1| Zea mays chromosome UNK clone ZMMBBb-... 36 5.2 gi|91206518|gb|AC184866.1| Zea mays chromosome UNK clone CH201-1... 36 5.2 gi|88900609|gb|AC183318.1| Zea mays chromosome UNK clone CH201-2... 36 5.2 gi|58082401|gb|AC155542.2| Zea mays strain B73 clone ZMMBBc0151N... 36 5.2 >gi|91982820|gb|AC185276.1| Zea mays chromosome UNK clone CH201-322M15; ZMMBBc0322M15, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 163620 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 88 atcaaaaacatctgggtggccataatg 114 |||||||| |||||||||||||||||| Sbjct: 100840 atcaaaaatatctgggtggccataatg 100866 >gi|24763681|gb|CA398852.1|CA398852 EL01N0311A12.g Endosperm_3 Zea mays cDNA, mRNA sequence Length = 798 Score = 44.1 bits (22), Expect = 0.021 Identities = 75/92 (81%), Gaps = 3/92 (3%) Strand = Plus / Minus Query: 86 cgatcaaaaacatctgggtggccataatgcattctgactttaagtggatcagccagaaca 145 |||||||||||||| || || ||||| ||||||| ||||| | | | ||| |||||| Sbjct: 290 cgatcaaaaacatcaggatgtccatagtgcattcgaactttga---ggtaagcaagaaca 234 Query: 146 cgctgccccagagtgacaaaacttgtctcctg 177 || ||||||| ||| |||||||| |||||||| Sbjct: 233 cgttgccccaaagtaacaaaactagtctcctg 202 >gi|56691579|gb|CX129482.1|CX129482 QAO2f02.yg QAO Zea mays cDNA clone QAO2f02, mRNA sequence Length = 514 Score = 44.1 bits (22), Expect = 0.021 Identities = 75/92 (81%), Gaps = 3/92 (3%) Strand = Plus / Plus Query: 86 cgatcaaaaacatctgggtggccataatgcattctgactttaagtggatcagccagaaca 145 |||||||||||||| || || ||||| ||||||| ||||| | | | ||| |||||| Sbjct: 226 cgatcaaaaacatcaggatgtccatagtgcattcgaactttga---ggtaagcaagaaca 282 Query: 146 cgctgccccagagtgacaaaacttgtctcctg 177 || ||||||| ||| |||||||| |||||||| Sbjct: 283 cgttgccccaaagtaacaaaactagtctcctg 314 Score = 36.2 bits (18), Expect = 5.2 Identities = 42/50 (84%) Strand = Plus / Plus Query: 305 gcttcttcaaagtagttgtcttggttcatatcaatagtttgaactgcatc 354 ||||| || |||||||| || || |||||||| || || ||||||||||| Sbjct: 451 gcttcctccaagtagttatcctgattcatatcgatcgtctgaactgcatc 500 >gi|61236824|gb|DN586547.1|DN586547 EST6538 Zea mays embryo sac cDNA library Zea mays cDNA clone ES14453 5' similar to beta 1,3 glucan synthase, mRNA sequence Length = 471 Score = 44.1 bits (22), Expect = 0.021 Identities = 75/92 (81%), Gaps = 3/92 (3%) Strand = Plus / Minus Query: 86 cgatcaaaaacatctgggtggccataatgcattctgactttaagtggatcagccagaaca 145 |||||||||||||| || || ||||| ||||||| ||||| | | | ||| |||||| Sbjct: 234 cgatcaaaaacatcaggatgtccatagtgcattcgaactttga---ggtaagcaagaaca 178 Query: 146 cgctgccccagagtgacaaaacttgtctcctg 177 || ||||||| ||| |||||||| |||||||| Sbjct: 177 cgttgccccaaagtaacaaaactagtctcctg 146 >gi|18659825|gb|BM500541.1|BM500541 PAC000000000632 Pioneer AF-1 array Zea mays cDNA, mRNA sequence Length = 413 Score = 40.1 bits (20), Expect = 0.33 Identities = 38/44 (86%) Strand = Plus / Minus Query: 161 acaaaacttgtctcctgggcagacatgaaccaagcaagagaaga 204 ||||||||||| || ||| ||||||||||| ||||||||||| Sbjct: 236 acaaaacttgtttcttggtttgacatgaaccatgcaagagaaga 193 >gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence Length = 2352 Score = 40.1 bits (20), Expect = 0.33 Identities = 38/44 (86%) Strand = Plus / Minus Query: 161 acaaaacttgtctcctgggcagacatgaaccaagcaagagaaga 204 ||||||||||| || ||| ||||||||||| ||||||||||| Sbjct: 450 acaaaacttgtttcttggtttgacatgaaccatgcaagagaaga 407 >gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence Length = 2352 Score = 40.1 bits (20), Expect = 0.33 Identities = 38/44 (86%) Strand = Plus / Minus Query: 161 acaaaacttgtctcctgggcagacatgaaccaagcaagagaaga 204 ||||||||||| || ||| ||||||||||| ||||||||||| Sbjct: 450 acaaaacttgtttcttggtttgacatgaaccatgcaagagaaga 407 >gi|31909195|gb|CD650797.1|CD650797 3529_1_129_1_H12.y_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 675 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 313 gcttgcgaattccataata 331 >gi|32862685|gb|CF002367.1|CF002367 QBH11b04.xg QBH Zea mays cDNA clone QBH11b04, mRNA sequence Length = 587 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 354 tgcctttcatcaacataag 336 >gi|32862900|gb|CF002582.1|CF002582 QBH12h09.xg QBH Zea mays cDNA clone QBH12h09, mRNA sequence Length = 579 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 296 gcttgcgaattccataata 314 >gi|32912739|gb|CF017551.1|CF017551 QBM25f09.xg QBM Zea mays cDNA clone QBM25f09, mRNA sequence Length = 615 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 393 gcttgcgaattccataata 411 >gi|58029445|gb|CX724872.1|CX724872 EST5012 Zea mays embryo sac cDNA library Zea mays cDNA clone ES10248 5', mRNA sequence Length = 709 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 318 gcttgcgaattccataata 336 >gi|60339086|gb|DN206059.1|DN206059 MEST827_C09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 618 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 65 tgcctttcatcaacataag 47 >gi|60341367|gb|DN208340.1|DN208340 MEST868_F04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 729 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 58 tgcctttcatcaacataag 40 >gi|60355035|gb|DN222008.1|DN222008 MEST1122_B12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 674 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 495 tgcctttcatcaacataag 513 >gi|61119727|gb|DN560688.1|DN560688 ME8-B06-T3-96-R1 E7PCR Zea mays cDNA clone E7PCRME806B, mRNA sequence Length = 685 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 294 gcttgcgaattccataata 312 >gi|61236778|gb|DN586511.1|DN586511 EST6502 Zea mays embryo sac cDNA library Zea mays cDNA clone ES14392 5', mRNA sequence Length = 680 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 321 gcttgcgaattccataata 339 >gi|67013747|gb|CO442496.1|CO442496 MZCCL10044D03.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 914 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 151 tgcctttcatcaacataag 133 >gi|67016359|gb|CO445108.1|CO445108 MZCCL10080D11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 802 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 532 tgcctttcatcaacataag 514 >gi|67016465|gb|CO445214.1|CO445214 MZCCL10081G09.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 851 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 515 tgcctttcatcaacataag 533 ||||||||||||||||||| Sbjct: 638 tgcctttcatcaacataag 620 >gi|71316791|gb|DR795082.1|DR795082 ZM_BFb0016B03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 454 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 328 gcttgcgaattccataata 346 >gi|76291003|gb|DV030571.1|DV030571 ZM_BFb0153H24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 700 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 330 gcttgcgaattccataata 348 >gi|76929411|gb|DV172004.1|DV172004 ZM_BFb0173C07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 781 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 330 gcttgcgaattccataata 348 >gi|78081267|gb|DV509679.1|DV509679 ZM_BFb0188O21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 276 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 227 gcttgcgaattccataata 245 >gi|78105032|gb|DV523450.1|DV523450 ZM_BFb0209K19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 893 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 283 gcttgcgaattccataata 301 >gi|78108719|gb|DV527137.1|DV527137 ZM_BFb0215A19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 798 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 276 gcttgcgaattccataata 294 >gi|89251187|gb|DY622973.1|DY622973 ZM_BFb0293C03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 674 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 283 gcttgcgaattccataata 301 >gi|93017240|gb|EB642760.1|EB642760 ZM_BFb0333E19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 499 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 321 gcttgcgaattccataata 339 >gi|21208998|gb|AY105920.1| Zea mays PCO073266 mRNA sequence Length = 1079 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 336 gcttgcgaattccataata 354 >gi|21208998|gb|AY105920.1| Zea mays PCO073266 mRNA sequence Length = 1079 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gcttgcgaattccataata 267 ||||||||||||||||||| Sbjct: 336 gcttgcgaattccataata 354 >gi|88687866|gb|AC182833.1| Zea mays chromosome UNK clone CH201-175A10, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 174451 Score = 38.2 bits (19), Expect = 1.3 Identities = 25/27 (92%) Strand = Plus / Minus Query: 88 atcaaaaacatctgggtggccataatg 114 |||||||||||| || ||||||||||| Sbjct: 126136 atcaaaaacatcaggatggccataatg 126110 >gi|92900561|gb|AC185458.1| Zea mays chromosome UNK clone CH201-308N15; ZMMBBc0308N15, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 158866 Score = 36.2 bits (18), Expect = 5.2 Identities = 18/18 (100%) Strand = Plus / Minus Query: 185 atgaaccaagcaagagaa 202 |||||||||||||||||| Sbjct: 6510 atgaaccaagcaagagaa 6493 >gi|92110158|gb|AC185296.1| Zea mays chromosome UNK clone ZMMBBb-316I23; ZMMBBb0316I23, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 197508 Score = 36.2 bits (18), Expect = 5.2 Identities = 24/26 (92%) Strand = Plus / Plus Query: 14 gcaaaaatgtcctcactaatgttgat 39 ||||||||||||| ||| |||||||| Sbjct: 128510 gcaaaaatgtcctaacttatgttgat 128535 >gi|91206518|gb|AC184866.1| Zea mays chromosome UNK clone CH201-168F15; ZMMBBc0168F15, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 180041 Score = 36.2 bits (18), Expect = 5.2 Identities = 21/22 (95%) Strand = Plus / Plus Query: 242 attttaggcttgcgaattccat 263 ||||||||||||||||| |||| Sbjct: 142746 attttaggcttgcgaatgccat 142767 >gi|88900609|gb|AC183318.1| Zea mays chromosome UNK clone CH201-231A16; ZMMBBc0231A16, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 171636 Score = 36.2 bits (18), Expect = 5.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 242 attttaggcttgcgaattccat 263 ||||||||||||||||| |||| Sbjct: 105071 attttaggcttgcgaatgccat 105050 >gi|58082401|gb|AC155542.2| Zea mays strain B73 clone ZMMBBc0151N07, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 186455 Score = 36.2 bits (18), Expect = 5.2 Identities = 18/18 (100%) Strand = Plus / Plus Query: 302 agagcttcttcaaagtag 319 |||||||||||||||||| Sbjct: 157296 agagcttcttcaaagtag 157313 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 195,391 Number of Sequences: 836351 Number of extensions: 195391 Number of successful extensions: 14175 Number of sequences better than 10.0: 36 Number of HSP's better than 10.0 without gapping: 36 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 14097 Number of HSP's gapped (non-prelim): 78 length of query: 632 length of database: 669,372,029 effective HSP length: 19 effective length of query: 613 effective length of database: 653,481,360 effective search space: 400584073680 effective search space used: 400584073680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)