BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 8635788.2.1 (753 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|14243080|gb|BG840766.2|BG840766 MEST11-F03.T3 ISUM4-TN Zea ma... 1405 0.0 gi|14242866|gb|BG840260.2|BG840260 MEST11-F03.T7-1 ISUM4-TN Zea ... 1207 0.0 gi|14244277|gb|BG842287.2|BG842287 MEST29-B05.T3 ISUM4-TN Zea ma... 959 0.0 gi|89758056|gb|DY687398.1|DY687398 ZM_BFb0279A07.r ZM_BFb Zea ma... 70 4e-10 gi|37374787|gb|CF623781.1|CF623781 zmrws05_0A10-012-c11.s0 zmrws... 52 1e-04 gi|37396491|gb|CF635536.1|CF635536 zmrww00_0A20-011-f05.s0 zmrww... 52 1e-04 gi|37399378|gb|CF637016.1|CF637016 zmrww00_0B10-015-c07.s0 zmrww... 52 1e-04 gi|37401722|gb|CF638228.1|CF638228 zmrww00_0B20-015-c01.s0 zmrww... 52 1e-04 gi|44901602|gb|CK828147.1|CK828147 zmrww00_0A21-014-e05.s0 zmrww... 52 1e-04 gi|67015800|gb|CO444549.1|CO444549 MZCCL10073A08.g Maize Endospe... 52 1e-04 gi|78074397|gb|DV502831.1|DV502831 ZM_BFb0174N07.f ZM_BFb Zea ma... 52 1e-04 gi|78074398|gb|DV502832.1|DV502832 ZM_BFb0174N07.r ZM_BFb Zea ma... 52 1e-04 gi|67011906|gb|CO440655.1|CO440655 MZCCL10026G09.g Maize Endospe... 46 0.006 gi|78124683|gb|DV543067.1|DV543067 ZM_BFb0238K21.r ZM_BFb Zea ma... 46 0.006 gi|71427415|gb|DR808465.1|DR808465 ZM_BFb0035D16.f ZM_BFb Zea ma... 44 0.025 gi|71433861|gb|DR814911.1|DR814911 ZM_BFb0044M17.f ZM_BFb Zea ma... 44 0.025 gi|71433862|gb|DR814912.1|DR814912 ZM_BFb0044M17.r ZM_BFb Zea ma... 44 0.025 gi|76020619|gb|DT947789.1|DT947789 ZM_BFb0136E02.f ZM_BFb Zea ma... 44 0.025 gi|78080722|gb|DV509134.1|DV509134 ZM_BFb0188A21.r ZM_BFb Zea ma... 44 0.025 gi|78118143|gb|DV536530.1|DV536530 ZM_BFb0229B05.f ZM_BFb Zea ma... 44 0.025 gi|78118144|gb|DV536531.1|DV536531 ZM_BFb0229B05.r ZM_BFb Zea ma... 44 0.025 gi|5268949|gb|AI770913.1|AI770913 606063B10.x1 606 - Ear tissue ... 42 0.10 gi|22818805|gb|BU498895.1|BU498895 946170F05.y1 946 - tassel pri... 42 0.10 gi|26559753|gb|CA831988.1|CA831988 1117026E03.y1 1117 - Unigene ... 42 0.10 gi|31355019|gb|CD439376.1|CD439376 EL01N0524B04.b Endosperm_5 Ze... 42 0.10 gi|37422279|gb|CF648845.1|CF648845 3530_1_60_1_B02.x_1 3530 - Fu... 42 0.10 gi|37424875|gb|CF650171.1|CF650171 3530_1_82_1_F05.x_1 3530 - Fu... 42 0.10 gi|50327309|gb|CO522435.1|CO522435 3530_1_148_1_A02.y_1 3530 - F... 42 0.10 gi|67025383|gb|CO454132.1|CO454132 MZCCL10200G10.g Maize Endospe... 42 0.10 gi|71311753|gb|DR792319.1|DR792319 ZM_BFb0012C03.f ZM_BFb Zea ma... 42 0.10 gi|71326658|gb|DR799987.1|DR799987 ZM_BFb0023C22.r ZM_BFb Zea ma... 42 0.10 gi|71439577|gb|DR820627.1|DR820627 ZM_BFb0059D22.f ZM_BFb Zea ma... 42 0.10 gi|71439578|gb|DR820628.1|DR820628 ZM_BFb0059D22.r ZM_BFb Zea ma... 42 0.10 gi|74234597|gb|DT642511.1|DT642511 ZM_BFb0101A21.r ZM_BFb Zea ma... 42 0.10 gi|74240362|gb|DT648276.1|DT648276 ZM_BFb0109K22.r ZM_BFb Zea ma... 42 0.10 gi|76011842|gb|DT939012.1|DT939012 ZM_BFb0120L10.r ZM_BFb Zea ma... 42 0.10 gi|76287865|gb|DV027433.1|DV027433 ZM_BFb0148O02.r ZM_BFb Zea ma... 42 0.10 gi|78075131|gb|DV503565.1|DV503565 ZM_BFb0180A15.r ZM_BFb Zea ma... 42 0.10 gi|78083374|gb|DV511767.1|DV511767 ZM_BFb0192B24.r ZM_BFb Zea ma... 42 0.10 gi|78091769|gb|DV520143.1|DV520143 ZM_BFb0204O07.r ZM_BFb Zea ma... 42 0.10 gi|78104837|gb|DV523255.1|DV523255 ZM_BFb0209G08.r ZM_BFb Zea ma... 42 0.10 gi|78108580|gb|DV526998.1|DV526998 ZM_BFb0214N14.r ZM_BFb Zea ma... 42 0.10 gi|78112066|gb|DV530462.1|DV530462 ZM_BFb0220E03.r ZM_BFb Zea ma... 42 0.10 gi|87156267|gb|DY401056.1|DY401056 V-946-7B-E03.Gal4-R UGV-Reseq... 42 0.10 gi|88750025|gb|DY534166.1|DY534166 ZM_BFb0265E07.r ZM_BFb Zea ma... 42 0.10 gi|89250714|gb|DY622500.1|DY622500 ZM_BFb0289I24.r ZM_BFb Zea ma... 42 0.10 gi|91872539|gb|EB402496.1|EB402496 ZM_BFb0309F13.r ZM_BFb Zea ma... 42 0.10 gi|91878643|gb|EB408600.1|EB408600 ZM_BFb0321I21.r ZM_BFb Zea ma... 42 0.10 gi|93016088|gb|EB641608.1|EB641608 ZM_BFb0331F09.r ZM_BFb Zea ma... 42 0.10 gi|54653542|gb|BT018761.1| Zea mays clone EL01N0524B04.d mRNA se... 42 0.10 gi|54653542|gb|BT018761.1| Zea mays clone EL01N0524B04.d mRNA se... 42 0.10 gi|6742349|gb|AW313164.1|AW313164 707040D03.x2 707 - Mixed adult... 40 0.40 gi|6826987|gb|AW330630.1|AW330630 707040D03.x5 707 - Mixed adult... 40 0.40 gi|16746016|gb|BM032446.1|BM032446 952006F06.x2 952 - BMS tissue... 40 0.40 gi|16746117|gb|BM032547.1|BM032547 952006F06.x3 952 - BMS tissue... 40 0.40 gi|18384824|gb|BM418023.1|BM418023 952006F06.x5 952 - BMS tissue... 40 0.40 gi|18384825|gb|BM418024.1|BM418024 952006F06.x7 952 - BMS tissue... 40 0.40 gi|18384827|gb|BM418026.1|BM418026 952006F06.x9 952 - BMS tissue... 40 0.40 gi|18385307|gb|BM418506.1|BM418506 952006F06.y1 952 - BMS tissue... 40 0.40 gi|29130412|gb|CB381116.1|CB381116 3529_1_52_1_A02.y_1 3529 - 2 ... 40 0.40 gi|29130913|gb|CB381617.1|CB381617 3529_1_52_1_A02.x_1 3529 - 2 ... 40 0.40 gi|31355189|gb|CD439546.1|CD439546 EL01N0526B09.b Endosperm_5 Ze... 40 0.40 gi|31355578|gb|CD439935.1|CD439935 EL01N0530H04.b Endosperm_5 Ze... 40 0.40 gi|32798723|gb|CD950959.1|CD950959 SAT_235 GeneTag2 Zea mays cDN... 40 0.40 gi|44900432|gb|CK826977.1|CK826977 zmrsub1_0A20-007-d02.s3 zmrsu... 40 0.40 gi|50328642|gb|CO523768.1|CO523768 3530_1_157_1_B05.y_1 3530 - F... 40 0.40 gi|50331136|gb|CO526262.1|CO526262 3530_1_174_1_G01.y_1 3530 - F... 40 0.40 gi|50337563|gb|CO532689.1|CO532689 3530_1_215_1_B05.y_1 3530 - F... 40 0.40 gi|67010509|gb|CO439258.1|CO439258 MZCCL10004D02.g Maize Endospe... 40 0.40 gi|67015368|gb|CO444117.1|CO444117 MZCCL10068C06.g Maize Endospe... 40 0.40 gi|67016534|gb|CO445283.1|CO445283 MZCCL10082F04.g Maize Endospe... 40 0.40 gi|67021194|gb|CO449943.1|CO449943 MZCCL10142E01.g Maize Endospe... 40 0.40 gi|67021591|gb|CO450340.1|CO450340 MZCCL10147F07.g Maize Endospe... 40 0.40 gi|67024020|gb|CO452769.1|CO452769 MZCCL10185C11.g Maize Endospe... 40 0.40 gi|71417268|gb|DR803994.1|DR803994 ZM_BFb0028O06.r ZM_BFb Zea ma... 40 0.40 gi|71421391|gb|DR805404.1|DR805404 ZM_BFb0030O06.r ZM_BFb Zea ma... 40 0.40 gi|71421484|gb|DR805454.1|DR805454 ZM_BFb0030P10.r ZM_BFb Zea ma... 40 0.40 gi|71431668|gb|DR812718.1|DR812718 ZM_BFb0041I14.f ZM_BFb Zea ma... 40 0.40 gi|71431669|gb|DR812719.1|DR812719 ZM_BFb0041I14.r ZM_BFb Zea ma... 40 0.40 gi|71440672|gb|DR821722.1|DR821722 ZM_BFb0061E04.r ZM_BFb Zea ma... 40 0.40 gi|71447237|gb|DR828287.1|DR828287 ZM_BFb0072M04.r ZM_BFb Zea ma... 40 0.40 gi|71448663|gb|DR829713.1|DR829713 ZM_BFb0076F03.r ZM_BFb Zea ma... 40 0.40 gi|71426397|gb|DR807447.1|DR807447 ZM_BFb0033L22.r ZM_BFb Zea ma... 40 0.40 gi|71766237|gb|DR964174.1|DR964174 ZM_BFb0083H22.r ZM_BFb Zea ma... 40 0.40 gi|71767434|gb|DR965371.1|DR965371 ZM_BFb0085E09.r ZM_BFb Zea ma... 40 0.40 gi|71774400|gb|DR972278.1|DR972278 ZM_BFb0095G01.r ZM_BFb Zea ma... 40 0.40 gi|74234274|gb|DT642188.1|DT642188 ZM_BFb0100J12.r ZM_BFb Zea ma... 40 0.40 gi|74243179|gb|DT651093.1|DT651093 ZM_BFb0114P22.r ZM_BFb Zea ma... 40 0.40 gi|74243781|gb|DT651695.1|DT651695 ZM_BFb0115P01.r ZM_BFb Zea ma... 40 0.40 gi|76012172|gb|DT939342.1|DT939342 ZM_BFb0121G13.r ZM_BFb Zea ma... 40 0.40 gi|76283725|gb|DV023293.1|DV023293 ZM_BFb0142O02.r ZM_BFb Zea ma... 40 0.40 gi|76925934|gb|DV170656.1|DV170656 ZM_BFb0170F19.r ZM_BFb Zea ma... 40 0.40 gi|76936436|gb|DV174726.1|DV174726 ZM_BFb0178L19.r ZM_BFb Zea ma... 40 0.40 gi|78084788|gb|DV513181.1|DV513181 ZM_BFb0194D10.r ZM_BFb Zea ma... 40 0.40 gi|78105494|gb|DV523912.1|DV523912 ZM_BFb0210F18.r ZM_BFb Zea ma... 40 0.40 gi|78112650|gb|DV531044.1|DV531044 ZM_BFb0221A20.r ZM_BFb Zea ma... 40 0.40 gi|78113245|gb|DV531639.1|DV531639 ZM_BFb0221N22.r ZM_BFb Zea ma... 40 0.40 gi|78124479|gb|DV542863.1|DV542863 ZM_BFb0238E20.r ZM_BFb Zea ma... 40 0.40 gi|89251945|gb|DY623731.1|DY623731 ZM_BFb0295F19.r ZM_BFb Zea ma... 40 0.40 gi|89759087|gb|DY688019.1|DY688019 ZM_BFb0280O21.r ZM_BFb Zea ma... 40 0.40 gi|91051446|gb|EB161864.1|EB161864 ZM_BFb0301G23.r ZM_BFb Zea ma... 40 0.40 gi|91055427|gb|EB165845.1|EB165845 ZM_BFb0341N22.r ZM_BFb Zea ma... 40 0.40 gi|93012945|gb|EB638465.1|EB638465 ZM_BFb0325K11.r ZM_BFb Zea ma... 40 0.40 gi|93013260|gb|EB638780.1|EB638780 ZM_BFb0326D01.r ZM_BFb Zea ma... 40 0.40 gi|54651280|gb|BT016499.1| Zea mays clone Contig332 mRNA sequence 40 0.40 gi|21210593|gb|AY107515.1| Zea mays PCO145505 mRNA sequence 40 0.40 gi|54651280|gb|BT016499.1| Zea mays clone Contig332 mRNA sequence 40 0.40 gi|21210593|gb|AY107515.1| Zea mays PCO145505 mRNA sequence 40 0.40 gi|90186366|gb|AC183892.1| Zea mays chromosome UNK clone CH201-3... 40 0.40 gi|89257792|gb|AC177918.2| Zea mays chromosome UNK clone CH201-1... 40 0.40 gi|4804017|gb|AI665883.1|AI665883 606003B10.x1 606 - Ear tissue ... 38 1.6 gi|5525289|gb|AI861128.1|AI861128 603012E08.x1 603 - stressed ro... 38 1.6 gi|7227554|gb|AW566195.1|AW566195 660063D03.y1 660 - Mixed stage... 38 1.6 gi|12971496|gb|BG267511.1|BG267511 1000126G01.x1 1000 - Unigene ... 38 1.6 gi|13126579|gb|BG317149.1|BG317149 947025H01.y1 947 - 2 week sho... 38 1.6 gi|13150526|gb|BG320848.1|BG320848 Zm04_09c01_R Zm04_AAFC_ECORC_... 38 1.6 gi|14208199|gb|BG841877.1|BG841877 MEST33-F05.T3 ISUM3-TL Zea ma... 38 1.6 gi|14244645|gb|BG842583.2|BG842583 MEST33-F05.T7-1 ISUM3-TL Zea ... 38 1.6 gi|16746015|gb|BM032445.1|BM032445 952006F05.x2 952 - BMS tissue... 38 1.6 gi|17932512|gb|BM269472.1|BM269472 MEST410-A08.univ ISUM5-RN Zea... 38 1.6 gi|18166699|gb|BM336538.1|BM336538 MEST195-D06.T3 ISUM5-RN Zea m... 38 1.6 gi|18168884|gb|BM338724.1|BM338724 MEST231-C10.T3 ISUM5-RN Zea m... 38 1.6 gi|18171227|gb|BM341067.1|BM341067 MEST329-H02.T3 ISUM5-RN Zea m... 38 1.6 gi|18173744|gb|BM349132.1|BM349132 MEST308-H05.T3 ISUM5-RN Zea m... 38 1.6 gi|18175684|gb|BM350907.1|BM350907 MEST270-E04.T3 ISUM5-RN Zea m... 38 1.6 gi|18179735|gb|BM380945.1|BM380945 MEST527-E12.univ ISUM6 Zea ma... 38 1.6 gi|18384822|gb|BM418021.1|BM418021 952006F05.x7 952 - BMS tissue... 38 1.6 gi|18384823|gb|BM418022.1|BM418022 952006F05.x8 952 - BMS tissue... 38 1.6 gi|18964839|gb|BM661240.1|BM661240 952046A12.y1 952 - BMS tissue... 38 1.6 gi|22490336|gb|BU050259.1|BU050259 1111026A09.y1 1111 - Unigene ... 38 1.6 gi|24767873|gb|CA403008.1|CA403008 EL01N0445F03.g Endosperm_4 Ze... 38 1.6 gi|24768846|gb|CA403975.1|CA403975 EL01N0510B02.g Endosperm_4 Ze... 38 1.6 gi|24769547|gb|CA404676.1|CA404676 EL01N0522A08.g Endosperm_4 Ze... 38 1.6 gi|31350757|gb|CD435114.1|CD435114 EL01N0354E11.b Endosperm_3 Ze... 38 1.6 gi|31352058|gb|CD436415.1|CD436415 EL01N0354E11.g Endosperm_3 Ze... 38 1.6 gi|31354800|gb|CD439157.1|CD439157 EL01N0521F03.b Endosperm_5 Ze... 38 1.6 gi|31357974|gb|CD442331.1|CD442331 EL01N0408A12.b Endosperm_4 Ze... 38 1.6 gi|32801475|gb|CD953711.1|CD953711 SBK_29 GeneTag2 Zea mays cDNA... 38 1.6 gi|32824056|gb|CD963778.1|CD963778 SDX_64 GeneTag2 Zea mays cDNA... 38 1.6 gi|33466730|gb|CF243779.1|CF243779 3530_1_23_1_H04.y_1 3530 - Fu... 38 1.6 gi|37375921|gb|CF624445.1|CF624445 zmrws05_0A20-003-g07.s0 zmrws... 38 1.6 gi|37424010|gb|CF649735.1|CF649735 3530_1_75_1_D12.x_2 3530 - Fu... 38 1.6 gi|50322365|gb|CO517491.1|CO517491 3530_1_113_1_G02.x_1 3530 - F... 38 1.6 gi|50322366|gb|CO517492.1|CO517492 3530_1_113_1_G02.y_1 3530 - F... 38 1.6 gi|50322502|gb|CO517628.1|CO517628 3530_1_114_1_F03.y_1 3530 - F... 38 1.6 gi|50327759|gb|CO522885.1|CO522885 3530_1_151_1_C01.x_1 3530 - F... 38 1.6 gi|50330140|gb|CO525266.1|CO525266 3530_1_167_1_D09.y_1 3530 - F... 38 1.6 gi|50331770|gb|CO526896.1|CO526896 3530_1_178_1_H09.x_1 3530 - F... 38 1.6 gi|50334685|gb|CO529811.1|CO529811 3530_1_197_1_D04.x_1 3530 - F... 38 1.6 gi|50335192|gb|CO530318.1|CO530318 3530_1_19_1_H04.y_1 3530 - Fu... 38 1.6 gi|60339823|gb|DN206796.1|DN206796 MEST839_A07.T7-1 UGA-ZmSAM-XZ... 38 1.6 gi|67014354|gb|CO443103.1|CO443103 MZCCL10059H12.g Maize Endospe... 38 1.6 gi|67041353|gb|CO467608.1|CO467608 MZCCL20043G10.g Maize Endospe... 38 1.6 gi|71301525|gb|DR786805.1|DR786805 ZM_BFb0003O18.f ZM_BFb Zea ma... 38 1.6 gi|71304400|gb|DR788313.1|DR788313 ZM_BFb0006E10.f ZM_BFb Zea ma... 38 1.6 gi|71312225|gb|DR792634.1|DR792634 ZM_BFb0012J01.r ZM_BFb Zea ma... 38 1.6 gi|71324156|gb|DR798782.1|DR798782 ZM_BFb0021H07.f ZM_BFb Zea ma... 38 1.6 gi|71325689|gb|DR799529.1|DR799529 ZM_BFb0022I07.f ZM_BFb Zea ma... 38 1.6 gi|71327168|gb|DR800224.1|DR800224 ZM_BFb0023I08.f ZM_BFb Zea ma... 38 1.6 gi|71427029|gb|DR808079.1|DR808079 ZM_BFb0034K08.r ZM_BFb Zea ma... 38 1.6 gi|71429126|gb|DR810176.1|DR810176 ZM_BFb0037L16.f ZM_BFb Zea ma... 38 1.6 gi|71429326|gb|DR810376.1|DR810376 ZM_BFb0038A11.f ZM_BFb Zea ma... 38 1.6 gi|71430084|gb|DR811134.1|DR811134 ZM_BFb0039D12.f ZM_BFb Zea ma... 38 1.6 gi|71431292|gb|DR812342.1|DR812342 ZM_BFb0041A05.f ZM_BFb Zea ma... 38 1.6 gi|71432513|gb|DR813563.1|DR813563 ZM_BFb0042M19.r ZM_BFb Zea ma... 38 1.6 gi|71432619|gb|DR813669.1|DR813669 ZM_BFb0042P08.f ZM_BFb Zea ma... 38 1.6 gi|71438047|gb|DR819097.1|DR819097 ZM_BFb0055A09.r ZM_BFb Zea ma... 38 1.6 gi|71438310|gb|DR819360.1|DR819360 ZM_BFb0055L23.r ZM_BFb Zea ma... 38 1.6 gi|71439007|gb|DR820057.1|DR820057 ZM_BFb0057L22.r ZM_BFb Zea ma... 38 1.6 gi|71440703|gb|DR821753.1|DR821753 ZM_BFb0061F18.r ZM_BFb Zea ma... 38 1.6 gi|71441346|gb|DR822396.1|DR822396 ZM_BFb0062J16.r ZM_BFb Zea ma... 38 1.6 gi|71445707|gb|DR826757.1|DR826757 ZM_BFb0069K14.r ZM_BFb Zea ma... 38 1.6 gi|71447332|gb|DR828382.1|DR828382 ZM_BFb0073A17.r ZM_BFb Zea ma... 38 1.6 gi|71448552|gb|DR829602.1|DR829602 ZM_BFb0076A06.r ZM_BFb Zea ma... 38 1.6 gi|71450060|gb|DR831110.1|DR831110 ZM_BFb0079J08.f ZM_BFb Zea ma... 38 1.6 gi|71450338|gb|DR831388.1|DR831388 ZM_BFb0079P14.f ZM_BFb Zea ma... 38 1.6 gi|71757721|gb|DR955658.1|DR955658 ZM_BFb0049O02.f ZM_BFb Zea ma... 38 1.6 gi|71761256|gb|DR959193.1|DR959193 ZM_BFb0065L19.f ZM_BFb Zea ma... 38 1.6 gi|71762858|gb|DR960795.1|DR960795 ZM_BFb0076A06.f ZM_BFb Zea ma... 38 1.6 gi|71766352|gb|DR964289.1|DR964289 ZM_BFb0083K14.f ZM_BFb Zea ma... 38 1.6 gi|71770511|gb|DR968448.1|DR968448 ZM_BFb0089M06.r ZM_BFb Zea ma... 38 1.6 gi|71774474|gb|DR972352.1|DR972352 ZM_BFb0095H16.f ZM_BFb Zea ma... 38 1.6 gi|71774475|gb|DR972353.1|DR972353 ZM_BFb0095H16.r ZM_BFb Zea ma... 38 1.6 gi|71775479|gb|DR973357.1|DR973357 ZM_BFb0096P03.r ZM_BFb Zea ma... 38 1.6 gi|74231972|gb|DT639886.1|DT639886 ZM_BFb0097D10.f ZM_BFb Zea ma... 38 1.6 gi|74232376|gb|DT640290.1|DT640290 ZM_BFb0097N01.r ZM_BFb Zea ma... 38 1.6 gi|74233194|gb|DT641108.1|DT641108 ZM_BFb0099A11.f ZM_BFb Zea ma... 38 1.6 gi|74234072|gb|DT641986.1|DT641986 ZM_BFb0100E24.r ZM_BFb Zea ma... 38 1.6 gi|74241903|gb|DT649817.1|DT649817 ZM_BFb0112M12.f ZM_BFb Zea ma... 38 1.6 gi|74243069|gb|DT650983.1|DT650983 ZM_BFb0114N03.r ZM_BFb Zea ma... 38 1.6 gi|74245040|gb|DT652954.1|DT652954 ZM_BFb0119K04.r ZM_BFb Zea ma... 38 1.6 gi|74245859|gb|DT653773.1|DT653773 ZM_BFb0125L13.f ZM_BFb Zea ma... 38 1.6 gi|76010873|gb|DT938043.1|DT938043 ZM_BFb0117M13.f ZM_BFb Zea ma... 38 1.6 gi|76014369|gb|DT941539.1|DT941539 ZM_BFb0125J10.f ZM_BFb Zea ma... 38 1.6 gi|76014503|gb|DT941673.1|DT941673 ZM_BFb0126C01.r ZM_BFb Zea ma... 38 1.6 gi|76020450|gb|DT947620.1|DT947620 ZM_BFb0135O13.r ZM_BFb Zea ma... 38 1.6 gi|76280643|gb|DV020211.1|DV020211 ZM_BFb0138H07.f ZM_BFb Zea ma... 38 1.6 gi|76281073|gb|DV020641.1|DV020641 ZM_BFb0139A23.f ZM_BFb Zea ma... 38 1.6 gi|76282607|gb|DV022175.1|DV022175 ZM_BFb0141D20.r ZM_BFb Zea ma... 38 1.6 gi|76287428|gb|DV026996.1|DV026996 ZM_BFb0148E05.f ZM_BFb Zea ma... 38 1.6 gi|76287639|gb|DV027207.1|DV027207 ZM_BFb0148J03.f ZM_BFb Zea ma... 38 1.6 gi|76287765|gb|DV027333.1|DV027333 ZM_BFb0148L22.f ZM_BFb Zea ma... 38 1.6 gi|76292712|gb|DV032280.1|DV032280 ZM_BFb0156A03.f ZM_BFb Zea ma... 38 1.6 gi|76914257|gb|DV165458.1|DV165458 ZM_BFb0162G15.r ZM_BFb Zea ma... 38 1.6 gi|76929320|gb|DV171958.1|DV171958 ZM_BFb0173A12.r ZM_BFb Zea ma... 38 1.6 gi|76935232|gb|DV174250.1|DV174250 ZM_BFb0177M05.r ZM_BFb Zea ma... 38 1.6 gi|76936175|gb|DV174619.1|DV174619 ZM_BFb0178I03.f ZM_BFb Zea ma... 38 1.6 gi|78023847|gb|DV492234.1|DV492234 1000081-G05.T7-1 UGI-Reseq Ze... 38 1.6 gi|78074107|gb|DV502541.1|DV502541 ZM_BFb0174G18.f ZM_BFb Zea ma... 38 1.6 gi|78081604|gb|DV510016.1|DV510016 ZM_BFb0189G23.r ZM_BFb Zea ma... 38 1.6 gi|78085967|gb|DV514360.1|DV514360 ZM_BFb0196F09.f ZM_BFb Zea ma... 38 1.6 gi|78092997|gb|DV521371.1|DV521371 ZM_BFb0206K10.r ZM_BFb Zea ma... 38 1.6 gi|78103671|gb|DV522099.1|DV522099 ZM_BFb0207K23.f ZM_BFb Zea ma... 38 1.6 gi|78103672|gb|DV522100.1|DV522100 ZM_BFb0207K23.r ZM_BFb Zea ma... 38 1.6 gi|78105100|gb|DV523518.1|DV523518 ZM_BFb0209M09.r ZM_BFb Zea ma... 38 1.6 gi|78105142|gb|DV523560.1|DV523560 ZM_BFb0209N08.f ZM_BFb Zea ma... 38 1.6 gi|78105846|gb|DV524264.1|DV524264 ZM_BFb0210O05.f ZM_BFb Zea ma... 38 1.6 gi|78107700|gb|DV526118.1|DV526118 ZM_BFb0213J15.r ZM_BFb Zea ma... 38 1.6 gi|78110078|gb|DV528493.1|DV528493 ZM_BFb0217A01.f ZM_BFb Zea ma... 38 1.6 gi|78110090|gb|DV528505.1|DV528505 ZM_BFb0217A07.f ZM_BFb Zea ma... 38 1.6 gi|78110620|gb|DV529028.1|DV529028 ZM_BFb0217L22.r ZM_BFb Zea ma... 38 1.6 gi|78119359|gb|DV537743.1|DV537743 ZM_BFb0230N03.f ZM_BFb Zea ma... 38 1.6 gi|78123393|gb|DV541777.1|DV541777 ZM_BFb0236K19.f ZM_BFb Zea ma... 38 1.6 gi|86466288|gb|DY232659.1|DY232659 ZM_BFb0241O12.r ZM_BFb Zea ma... 38 1.6 gi|86472645|gb|DY239015.1|DY239015 ZM_BFb0257E02.r ZM_BFb Zea ma... 38 1.6 gi|86474499|gb|DY240869.1|DY240869 ZM_BFb0260O04.f ZM_BFb Zea ma... 38 1.6 gi|86475190|gb|DY241560.1|DY241560 ZM_BFb0262B07.r ZM_BFb Zea ma... 38 1.6 gi|88753112|gb|DY537253.1|DY537253 ZM_BFb0271L07.r ZM_BFb Zea ma... 38 1.6 gi|89246985|gb|DY618771.1|DY618771 ZM_BFb0274N03.f ZM_BFb Zea ma... 38 1.6 gi|89248077|gb|DY619863.1|DY619863 ZM_BFb0278B17.r ZM_BFb Zea ma... 38 1.6 gi|89248228|gb|DY620014.1|DY620014 ZM_BFb0278F18.r ZM_BFb Zea ma... 38 1.6 gi|89251308|gb|DY623094.1|DY623094 ZM_BFb0293H18.r ZM_BFb Zea ma... 38 1.6 gi|89252458|gb|DY624244.1|DY624244 ZM_BFb0302G06.f ZM_BFb Zea ma... 38 1.6 gi|91050413|gb|EB160831.1|EB160831 ZM_BFb0298P14.f ZM_BFb Zea ma... 38 1.6 gi|91055009|gb|EB165427.1|EB165427 ZM_BFb0341E12.f ZM_BFb Zea ma... 38 1.6 gi|91055010|gb|EB165428.1|EB165428 ZM_BFb0341E12.r ZM_BFb Zea ma... 38 1.6 gi|91056834|gb|EB167252.1|EB167252 ZM_BFb0377O12.r ZM_BFb Zea ma... 38 1.6 gi|91869390|gb|EB400362.1|EB400362 ZM_BFb0305H05.r ZM_BFb Zea ma... 38 1.6 gi|91871005|gb|EB401193.1|EB401193 ZM_BFb0307B11.r ZM_BFb Zea ma... 38 1.6 gi|93012355|gb|EB637875.1|EB637875 ZM_BFb0324G14.r ZM_BFb Zea ma... 38 1.6 gi|93013330|gb|EB638850.1|EB638850 ZM_BFb0326E18.f ZM_BFb Zea ma... 38 1.6 gi|54651177|gb|BT016396.1| Zea mays clone Contig229 mRNA sequence 38 1.6 gi|54653233|gb|BT018452.1| Zea mays clone EL01N0408A12.d mRNA se... 38 1.6 gi|21209301|gb|AY106223.1| Zea mays PCO114759 mRNA sequence 38 1.6 gi|21212188|gb|AY108895.1| Zea mays PCO149879 mRNA sequence 38 1.6 gi|1491773|emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteina... 38 1.6 gi|1491773|emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteina... 38 1.6 gi|45587226|gb|BV117853.1| PZA00815 CML247 Zea mays CML247 Zea m... 38 1.6 gi|54653233|gb|BT018452.1| Zea mays clone EL01N0408A12.d mRNA se... 38 1.6 gi|54651177|gb|BT016396.1| Zea mays clone Contig229 mRNA sequence 38 1.6 gi|21212188|gb|AY108895.1| Zea mays PCO149879 mRNA sequence 38 1.6 gi|21209301|gb|AY106223.1| Zea mays PCO114759 mRNA sequence 38 1.6 gi|27529464|emb|AJ494982.1|ZMA494982 Zea mays partial see1 gene ... 38 1.6 gi|89257804|gb|AC177942.2| Zea mays chromosome UNK clone CH201-1... 38 1.6 gi|85861432|gb|AC177922.1| Zea mays chromosome UNK clone CH201-1... 38 1.6 gi|85861429|gb|AC177919.1| Zea mays chromosome UNK clone CH201-1... 38 1.6 gi|85861427|gb|AC177917.1| Zea mays chromosome UNK clone CH201-1... 38 1.6 gi|440640|gb|T14661.1|T14661 05c04a07-f21 membrane-free polysome... 36 6.2 gi|4314940|gb|AI444741.2|AI444741 486015H01.x5 486 - leaf primor... 36 6.2 gi|4730537|gb|AI649703.1|AI649703 496008C03.x1 496 - stressed sh... 36 6.2 gi|4753363|gb|AI657268.1|AI657268 486092G08.y1 486 - leaf primor... 36 6.2 gi|5525300|gb|AI861139.1|AI861139 603012F12.x1 603 - stressed ro... 36 6.2 gi|5525398|gb|AI861291.1|AI861291 603018E12.x1 603 - stressed ro... 36 6.2 gi|5525593|gb|AI861486.1|AI861486 614014E11.x1 614 - root cDNA l... 36 6.2 gi|5566737|gb|AI881603.1|AI881603 606068H05.y1 606 - Ear tissue ... 36 6.2 gi|5757306|gb|AI964593.1|AI964593 496014E05.x1 496 - stressed sh... 36 6.2 gi|5777316|gb|AI974935.1|AI974935 496030G12.x1 496 - stressed sh... 36 6.2 gi|5791118|gb|AI977910.1|AI977910 496035E08.x1 496 - stressed sh... 36 6.2 gi|5791376|gb|AI978168.1|AI978168 614041A04.x2 614 - root cDNA l... 36 6.2 gi|5816263|gb|AI987179.1|AI987179 660001B11.x1 660 - Mixed stage... 36 6.2 gi|6859907|gb|AW355901.1|AW355901 707015F11.x1 707 - Mixed adult... 36 6.2 gi|7262322|gb|AW585265.1|AW585265 707093G01.x3 707 - Mixed adult... 36 6.2 gi|7844615|gb|AW787837.1|AW787837 945004D10.X1 945 - Mixed adult... 36 6.2 gi|8368139|gb|BE051084.1|BE051084 za71h12.b50 Maize Glume cDNAs ... 36 6.2 gi|8368140|gb|BE051085.1|BE051085 za71h12.g51 Maize Glume cDNAs ... 36 6.2 gi|9794289|gb|BE552597.1|BE552597 946082A12.y1 946 - tassel prim... 36 6.2 gi|9794633|gb|BE552941.1|BE552941 946087F07.y1 946 - tassel prim... 36 6.2 gi|12967900|gb|BG264847.1|BG264847 947023C09.x1 947 - 2 week sho... 36 6.2 gi|12968446|gb|BG265392.1|BG265392 1000023C03.x1 1000 - Unigene ... 36 6.2 gi|13126000|gb|BG316675.1|BG316675 947022C07.y1 947 - 2 week sho... 36 6.2 gi|13149834|gb|BG320156.1|BG320156 Zm03_05e11_A Zm03_AAFC_ECORC_... 36 6.2 gi|13177956|gb|BG349214.1|BG349214 947029F08.y1 947 - 2 week sho... 36 6.2 gi|13198318|gb|BG354261.1|BG354261 947033F07.y1 947 - 2 week sho... 36 6.2 gi|13198741|gb|BG354543.1|BG354543 947038F10.y1 947 - 2 week sho... 36 6.2 gi|13237055|gb|BG355069.1|BG355069 947040D05.y1 947 - 2 week sho... 36 6.2 gi|13237204|gb|BG355218.1|BG355218 947040D05.y2 947 - 2 week sho... 36 6.2 gi|13381615|gb|BG458395.1|BG458395 947045D04.x2 947 - 2 week sho... 36 6.2 gi|13515987|gb|BG518263.1|BG518263 947069D08.x2 947 - 2 week sho... 36 6.2 gi|13558455|gb|BG549811.1|BG549811 947075F11.y1 947 - 2 week sho... 36 6.2 gi|13558877|gb|BG550232.1|BG550232 947038F10.x1 947 - 2 week sho... 36 6.2 gi|14203259|gb|BG836936.1|BG836936 Zm08_09a01_A Zm08_AAFC_ECORC_... 36 6.2 gi|14242643|gb|BG840423.2|BG840423 MEST12-F08.T7-1 ISUM4-TN Zea ... 36 6.2 gi|14243188|gb|BG840858.2|BG840858 MEST12-F08.T3 ISUM4-TN Zea ma... 36 6.2 gi|14700926|gb|BI233344.1|BI233344 949009D08.x2 949 - Juvenile l... 36 6.2 gi|14701439|gb|BI233857.1|BI233857 949037A02.y2 949 - Juvenile l... 36 6.2 gi|15057235|gb|BI361207.1|BI361207 949057E01.x2 949 - Juvenile l... 36 6.2 gi|15100358|gb|BI396149.1|BI396149 949044H03.y1 949 - Juvenile l... 36 6.2 gi|15177511|gb|BI398450.1|BI398450 949055E01.y1 949 - Juvenile l... 36 6.2 gi|15208743|gb|BI430627.1|BI430627 949057G03.y1 949 - Juvenile l... 36 6.2 gi|15208771|gb|BI430655.1|BI430655 949058B02.y1 949 - Juvenile l... 36 6.2 gi|15208864|gb|BI430748.1|BI430748 949060E04.y1 949 - Juvenile l... 36 6.2 gi|15426650|gb|BI542472.1|BI542472 949020A12.y1 949 - Juvenile l... 36 6.2 gi|15545740|gb|BI643534.1|BI643534 949079D01.x1 949 - Juvenile l... 36 6.2 gi|15632483|gb|BI679576.1|BI679576 949003G04.y1 949 - Juvenile l... 36 6.2 gi|15632614|gb|BI679707.1|BI679707 949078B03.y2 949 - Juvenile l... 36 6.2 gi|16378395|gb|BI992426.1|BI992426 1020061H09.x2 1020 - Unigene ... 36 6.2 gi|16920155|gb|BM074527.1|BM074527 MEST58-D10.T3 ISUM4-TN Zea ma... 36 6.2 gi|16925051|gb|BM078119.1|BM078119 MEST115-C11.T3 ISUM4-TN Zea m... 36 6.2 gi|16925405|gb|BM078473.1|BM078473 MEST120-B06.T3 ISUM4-TN Zea m... 36 6.2 gi|18163740|gb|BM333579.1|BM333579 MEST157-G12.T3 ISUM5-RN Zea m... 36 6.2 gi|18164799|gb|BM334638.1|BM334638 MEST140-A04.T3 ISUM5-RN Zea m... 36 6.2 gi|18165309|gb|BM335148.1|BM335148 MEST146-C12.T3 ISUM5-RN Zea m... 36 6.2 gi|18171377|gb|BM341217.1|BM341217 MEST332-A05.T3 ISUM5-RN Zea m... 36 6.2 gi|18178178|gb|BM379388.1|BM379388 MEST504-H08.univ ISUM6 Zea ma... 36 6.2 gi|18178733|gb|BM379943.1|BM379943 MEST512-G08.univ ISUM6 Zea ma... 36 6.2 gi|18179309|gb|BM380519.1|BM380519 MEST521-A11.univ ISUM6 Zea ma... 36 6.2 gi|18180271|gb|BM381481.1|BM381481 MEST535-D03.univ ISUM6 Zea ma... 36 6.2 gi|18180370|gb|BM381580.1|BM381580 MEST536-H10.univ ISUM6 Zea ma... 36 6.2 gi|18660998|gb|BM501158.1|BM501158 PAC000000001171 Pioneer AF-1 ... 36 6.2 gi|19057638|gb|BM736305.1|BM736305 952057F11.x3 952 - BMS tissue... 36 6.2 gi|19436764|gb|BM953174.1|BM953174 952057F11.x2 952 - BMS tissue... 36 6.2 gi|21620903|gb|BQ618909.1|BQ618909 RNOSEQ1C03_T3.ab1 Salt stress... 36 6.2 gi|21621086|gb|BQ619092.1|BQ619092 RNOSEQ3F07_SK.ab1 Salt stress... 36 6.2 gi|21621221|gb|BQ619227.1|BQ619227 RNOSEQ5B12_SK.ab1 Salt stress... 36 6.2 gi|21621301|gb|BQ619307.1|BQ619307 RNOSEQ6B09_SK.ab1 Salt stress... 36 6.2 gi|21621319|gb|BQ619325.1|BQ619325 RNOSEQ6D09_SK.ab1 Salt stress... 36 6.2 gi|21891611|gb|BQ744824.1|BQ744824 946111E09.y1 946 - tassel pri... 36 6.2 gi|21987729|gb|BQ779257.1|BQ779257 946118A12.y1 946 - tassel pri... 36 6.2 gi|22715170|gb|BU197615.1|BU197615 946162F03.y1 946 - tassel pri... 36 6.2 gi|23357492|gb|BU645141.1|BU645141 946127B09.y2 946 - tassel pri... 36 6.2 gi|24769808|gb|CA404937.1|CA404937 EL01N0526B09.g Endosperm_4 Ze... 36 6.2 gi|26557833|gb|CA830068.1|CA830068 1117001G11.y1 1117 - Unigene ... 36 6.2 gi|26558218|gb|CA830453.1|CA830453 1117007A08.y1 1117 - Unigene ... 36 6.2 gi|26559344|gb|CA831579.1|CA831579 1117021C06.y1 1117 - Unigene ... 36 6.2 gi|27753892|gb|BM378084.1|BM378084 p0038.crvaf68 p0038 Zea mays ... 36 6.2 gi|28931315|gb|CB334676.1|CB334676 3529_1_40_1_B01.y_1 3529 - 2 ... 36 6.2 gi|30088075|gb|CB886280.1|CB886280 3529_1_93_1_G10.x_1 3529 - 2 ... 36 6.2 gi|29945024|gb|CB815430.1|CB815430 3529_1_73_1_D02.x_1 3529 - 2 ... 36 6.2 gi|29945080|gb|CB815459.1|CB815459 3529_1_73_1_E09.y_1 3529 - 2 ... 36 6.2 gi|31352153|gb|CD436510.1|CD436510 EL01N0358A10.g Endosperm_3 Ze... 36 6.2 gi|31355849|gb|CD440206.1|CD440206 EL01N0552A10.b Endosperm_5 Ze... 36 6.2 gi|31356109|gb|CD440466.1|CD440466 EL01N0555B02.b Endosperm_5 Ze... 36 6.2 gi|31356734|gb|CD441091.1|CD441091 EL01N0552A10.g Endosperm_5 Ze... 36 6.2 gi|31359436|gb|CD443793.1|CD443793 EL01N0431C03.b Endosperm_4 Ze... 36 6.2 gi|32830903|gb|CD970581.1|CD970581 QAD19g02.sg QAD Zea mays cDNA... 36 6.2 gi|32850122|gb|CD989803.1|CD989803 QAU2h12.yg QAU Zea mays cDNA ... 36 6.2 gi|32851822|gb|CD991503.1|CD991503 QBA103e03.pg QBA Zea mays cDN... 36 6.2 gi|32851823|gb|CD991504.1|CD991504 QBA103e03.xg QBA Zea mays cDN... 36 6.2 gi|32851881|gb|CD991562.1|CD991562 QBA103h10.pg QBA Zea mays cDN... 36 6.2 gi|32852128|gb|CD991809.1|CD991809 QBA105g03.xg QBA Zea mays cDN... 36 6.2 gi|32852179|gb|CD991860.1|CD991860 QBA106c09.pg QBA Zea mays cDN... 36 6.2 gi|32852540|gb|CD992221.1|CD992221 QBA110d07.pg QBA Zea mays cDN... 36 6.2 gi|32852541|gb|CD992222.1|CD992222 QBA110d07.xg QBA Zea mays cDN... 36 6.2 gi|32852612|gb|CD992293.1|CD992293 QBA111a07.pg QBA Zea mays cDN... 36 6.2 gi|32852613|gb|CD992294.1|CD992294 QBA111a07.xg QBA Zea mays cDN... 36 6.2 gi|32858128|gb|CD997809.1|CD997809 QBE4a02.xg QBE Zea mays cDNA ... 36 6.2 gi|32859003|gb|CD998684.1|CD998684 QBF15b03.xg QBF Zea mays cDNA... 36 6.2 gi|32859176|gb|CD998857.1|CD998857 QBF2b07.pg QBF Zea mays cDNA ... 36 6.2 gi|32859177|gb|CD998858.1|CD998858 QBF2b07.xg QBF Zea mays cDNA ... 36 6.2 gi|32859432|gb|CD999113.1|CD999113 QBF4a02.xg QBF Zea mays cDNA ... 36 6.2 gi|32862798|gb|CF002480.1|CF002480 QBH12b01.xg QBH Zea mays cDNA... 36 6.2 gi|32863610|gb|CF003292.1|CF003292 QBH1a03.xg QBH Zea mays cDNA ... 36 6.2 gi|32916073|gb|CF020885.1|CF020885 QBO1a10.xg QBO Zea mays cDNA ... 36 6.2 gi|32923745|gb|CF028557.1|CF028557 QCC12a05.yg QCC Zea mays cDNA... 36 6.2 gi|32924288|gb|CF029100.1|CF029100 QCC4c10.yg QCC Zea mays cDNA ... 36 6.2 gi|32929031|gb|CF033843.1|CF033843 QCF20h03.yg QCF Zea mays cDNA... 36 6.2 gi|32936489|gb|CF041308.1|CF041308 QCI24e08.yg QCI Zea mays cDNA... 36 6.2 gi|33467305|gb|CF244354.1|CF244354 3530_1_1_1_A09.y_1 3530 - Ful... 36 6.2 gi|37375187|gb|CF624016.1|CF624016 zmrws05_0A10-014-h10.s1 zmrws... 36 6.2 gi|37384478|gb|CF629315.1|CF629315 zmrws48_0A10-015-h01.s4 zmrws... 36 6.2 gi|37397079|gb|CF635834.1|CF635834 zmrww00_0B10-001-a11.s2 zmrww... 36 6.2 gi|37398150|gb|CF636384.1|CF636384 zmrww00_0B10-008-b07.s3 zmrww... 36 6.2 gi|37399303|gb|CF636978.1|CF636978 zmrww00_0B10-014-h03.s0 zmrww... 36 6.2 gi|40335206|gb|CK369276.1|CK369276 zmrws055_0B21-006-f11.s0 zmrw... 36 6.2 gi|40335344|gb|CK369414.1|CK369414 zmrws485_0A10-004-c09.s0 zmrw... 36 6.2 gi|44900620|gb|CK827165.1|CK827165 zmrsub1_0B10-006-e12.s4 zmrsu... 36 6.2 gi|45847739|gb|CN071682.1|CN071682 1021017C08.x5 1021 - Unigene ... 36 6.2 gi|45848156|gb|CN072099.1|CN072099 1021025G06.x1 1021 - Unigene ... 36 6.2 gi|47962039|gb|CN844748.1|CN844748 EST2698 Zea mays embryo sac c... 36 6.2 gi|50332276|gb|CO527402.1|CO527402 3530_1_181_1_D04.y_1 3530 - F... 36 6.2 gi|50333845|gb|CO528971.1|CO528971 3530_1_191_1_D02.y_1 3530 - F... 36 6.2 gi|50336052|gb|CO531178.1|CO531178 3530_1_205_1_F11.y_1 3530 - F... 36 6.2 gi|50337675|gb|CO532801.1|CO532801 3530_1_215_1_G12.y_1 3530 - F... 36 6.2 gi|56382616|gb|CV985285.1|CV985285 EST4822 Zea mays embryo sac c... 36 6.2 gi|60337718|gb|DN204691.1|DN204691 MEST808_B03.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60337957|gb|DN204930.1|DN204930 MEST811_B08.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60338163|gb|DN205136.1|DN205136 MEST814_C09.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60339420|gb|DN206393.1|DN206393 MEST833_F06.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60341407|gb|DN208380.1|DN208380 MEST868_F10.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60341507|gb|DN208480.1|DN208480 MEST869_G12.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60342723|gb|DN209696.1|DN209696 MEST874_B07.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60345007|gb|DN211980.1|DN211980 MEST932_B04.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60346280|gb|DN213253.1|DN213253 MEST962_F09.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60347839|gb|DN214812.1|DN214812 MEST890_F10.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60348261|gb|DN215234.1|DN215234 MEST909_F03.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60348286|gb|DN215259.1|DN215259 MEST913_A07.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60348468|gb|DN215441.1|DN215441 MEST948_F10.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60348517|gb|DN215490.1|DN215490 MEST964_E06.T7-1 UGA-ZmSAM-XZ... 36 6.2 gi|60349237|gb|DN216210.1|DN216210 MEST1030_D06.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60352708|gb|DN219681.1|DN219681 MEST1085_B04.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60355794|gb|DN222767.1|DN222767 MEST1132_B10.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60356863|gb|DN223836.1|DN223836 MEST1148_B09.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60358478|gb|DN225451.1|DN225451 MEST1174_B12.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60359628|gb|DN226601.1|DN226601 MEST1191_H01.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60394733|gb|DN227603.1|DN227603 MEST1208_G01.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60395048|gb|DN227917.1|DN227917 MEST1212_F06.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60395414|gb|DN228284.1|DN228284 MEST1217_G06.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60398530|gb|DN231346.1|DN231346 MEST1013_A06.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60398719|gb|DN231535.1|DN231535 MEST1057_A07.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60398863|gb|DN231679.1|DN231679 MEST1034_A08.T7-1 UGA-ZmSAM-X... 36 6.2 gi|60400694|gb|DN233501.1|DN233501 MEST1052_C06.T7-1 UGA-ZmSAM-X... 36 6.2 gi|62550259|gb|DN830679.1|DN830679 EST6892 Zea mays embryo sac c... 36 6.2 gi|67011729|gb|CO440478.1|CO440478 MZCCL10023B01.g Maize Endospe... 36 6.2 gi|67012115|gb|CO440864.1|CO440864 MZCCS10003H11.g Maize Endospe... 36 6.2 gi|67013620|gb|CO442369.1|CO442369 MZCCL10042F06.g Maize Endospe... 36 6.2 gi|67016033|gb|CO444782.1|CO444782 MZCCL10076B07.g Maize Endospe... 36 6.2 gi|67016276|gb|CO445025.1|CO445025 MZCCL10079D05.g Maize Endospe... 36 6.2 gi|67018129|gb|CO446878.1|CO446878 MZCCL10109G02.g Maize Endospe... 36 6.2 gi|67022501|gb|CO451250.1|CO451250 MZCCL10162D12.g Maize Endospe... 36 6.2 gi|67023323|gb|CO452072.1|CO452072 MZCCL10172C08.g Maize Endospe... 36 6.2 gi|67027760|gb|CO456509.1|CO456509 MZCCS15012B09.g Maize Endospe... 36 6.2 gi|67028013|gb|CO456762.1|CO456762 MZCCS20007E08.g Maize Endospe... 36 6.2 gi|67028361|gb|CO457110.1|CO457110 MZCCS20009B12.g Maize Endospe... 36 6.2 gi|67029062|gb|CO457811.1|CO457811 MZCCS20011G05.g Maize Endospe... 36 6.2 gi|67029172|gb|CO457921.1|CO457921 MZCCS15014B09.g Maize Endospe... 36 6.2 gi|67030080|gb|CO458829.1|CO458829 MZCCS20016D08.g Maize Endospe... 36 6.2 gi|67032452|gb|CO461201.1|CO461201 MZCCS20023G08.g Maize Endospe... 36 6.2 gi|67033287|gb|CO462036.1|CO462036 MZCCS20028D03.g Maize Endospe... 36 6.2 gi|67033893|gb|CO462642.1|CO462642 MZCCS15028D08.g Maize Endospe... 36 6.2 gi|67034055|gb|CO462804.1|CO462804 MZCCL20031D07.g Maize Endospe... 36 6.2 gi|67034502|gb|CO463052.1|CO463052 MZCCS20029D02.g Maize Endospe... 36 6.2 gi|67038462|gb|CO464782.1|CO464782 MZCCS15040A03.g Maize Endospe... 36 6.2 gi|67038842|gb|CO465097.1|CO465097 MZCCS15035H05.g Maize Endospe... 36 6.2 gi|67039932|gb|CO466187.1|CO466187 MZCCS20036E05.g Maize Endospe... 36 6.2 gi|67040386|gb|CO466641.1|CO466641 MZCCS20042G04.g Maize Endospe... 36 6.2 gi|67041708|gb|CO467963.1|CO467963 MZCCL20049D07.g Maize Endospe... 36 6.2 gi|71301242|gb|DR786658.1|DR786658 ZM_BFb0003L12.f ZM_BFb Zea ma... 36 6.2 gi|71305281|gb|DR788774.1|DR788774 ZM_BFb0006P02.f ZM_BFb Zea ma... 36 6.2 gi|71305283|gb|DR788775.1|DR788775 ZM_BFb0006P02.r ZM_BFb Zea ma... 36 6.2 gi|71309878|gb|DR791223.1|DR791223 ZM_BFb0010J13.r ZM_BFb Zea ma... 36 6.2 gi|71311683|gb|DR792255.1|DR792255 ZM_BFb0012A16.r ZM_BFb Zea ma... 36 6.2 gi|71312288|gb|DR792667.1|DR792667 ZM_BFb0012J18.f ZM_BFb Zea ma... 36 6.2 gi|71319462|gb|DR796475.1|DR796475 ZM_BFb0018C04.r ZM_BFb Zea ma... 36 6.2 gi|71319605|gb|DR796560.1|DR796560 ZM_BFb0018E04.r ZM_BFb Zea ma... 36 6.2 gi|71330465|gb|DR801992.1|DR801992 ZM_BFb0026B04.f ZM_BFb Zea ma... 36 6.2 gi|71419106|gb|DR804648.1|DR804648 ZM_BFb0029N03.r ZM_BFb Zea ma... 36 6.2 gi|71420886|gb|DR805223.1|DR805223 ZM_BFb0030J23.r ZM_BFb Zea ma... 36 6.2 gi|71426918|gb|DR807968.1|DR807968 ZM_BFb0034H20.r ZM_BFb Zea ma... 36 6.2 gi|71429141|gb|DR810191.1|DR810191 ZM_BFb0037L24.r ZM_BFb Zea ma... 36 6.2 gi|71430455|gb|DR811505.1|DR811505 ZM_BFb0039L20.r ZM_BFb Zea ma... 36 6.2 gi|71433765|gb|DR814815.1|DR814815 ZM_BFb0044K11.r ZM_BFb Zea ma... 36 6.2 gi|71435880|gb|DR816930.1|DR816930 ZM_BFb0050A07.r ZM_BFb Zea ma... 36 6.2 gi|71436869|gb|DR817919.1|DR817919 ZM_BFb0052A05.r ZM_BFb Zea ma... 36 6.2 gi|71437201|gb|DR818251.1|DR818251 ZM_BFb0052O24.r ZM_BFb Zea ma... 36 6.2 gi|71437214|gb|DR818264.1|DR818264 ZM_BFb0052P13.r ZM_BFb Zea ma... 36 6.2 gi|71443542|gb|DR824592.1|DR824592 ZM_BFb0066I08.r ZM_BFb Zea ma... 36 6.2 gi|71443930|gb|DR824980.1|DR824980 ZM_BFb0067B01.r ZM_BFb Zea ma... 36 6.2 gi|71444025|gb|DR825075.1|DR825075 ZM_BFb0067D13.r ZM_BFb Zea ma... 36 6.2 gi|71445190|gb|DR826240.1|DR826240 ZM_BFb0068O20.r ZM_BFb Zea ma... 36 6.2 gi|71446374|gb|DR827424.1|DR827424 ZM_BFb0070K09.r ZM_BFb Zea ma... 36 6.2 gi|71447660|gb|DR828710.1|DR828710 ZM_BFb0073O23.r ZM_BFb Zea ma... 36 6.2 gi|71447990|gb|DR829040.1|DR829040 ZM_BFb0074J15.r ZM_BFb Zea ma... 36 6.2 gi|71448780|gb|DR829830.1|DR829830 ZM_BFb0076K03.r ZM_BFb Zea ma... 36 6.2 gi|71449098|gb|DR830148.1|DR830148 ZM_BFb0077I01.r ZM_BFb Zea ma... 36 6.2 gi|71761933|gb|DR959870.1|DR959870 ZM_BFb0072L21.f ZM_BFb Zea ma... 36 6.2 gi|71762328|gb|DR960265.1|DR960265 ZM_BFb0073O23.f ZM_BFb Zea ma... 36 6.2 gi|71762728|gb|DR960665.1|DR960665 ZM_BFb0075K10.f ZM_BFb Zea ma... 36 6.2 gi|71763384|gb|DR961321.1|DR961321 ZM_BFb0077I01.f ZM_BFb Zea ma... 36 6.2 gi|71766794|gb|DR964731.1|DR964731 ZM_BFb0084F13.r ZM_BFb Zea ma... 36 6.2 gi|71767599|gb|DR965536.1|DR965536 ZM_BFb0085H24.r ZM_BFb Zea ma... 36 6.2 gi|74236321|gb|DT644235.1|DT644235 ZM_BFb0103J17.r ZM_BFb Zea ma... 36 6.2 gi|74241106|gb|DT649020.1|DT649020 ZM_BFb0111C13.r ZM_BFb Zea ma... 36 6.2 gi|74244927|gb|DT652841.1|DT652841 ZM_BFb0119H12.r ZM_BFb Zea ma... 36 6.2 gi|76011897|gb|DT939067.1|DT939067 ZM_BFb0120M15.r ZM_BFb Zea ma... 36 6.2 gi|76017391|gb|DT944561.1|DT944561 ZM_BFb0131G13.r ZM_BFb Zea ma... 36 6.2 gi|76018085|gb|DT945255.1|DT945255 ZM_BFb0132G07.f ZM_BFb Zea ma... 36 6.2 gi|76018086|gb|DT945256.1|DT945256 ZM_BFb0132G07.r ZM_BFb Zea ma... 36 6.2 gi|76018284|gb|DT945454.1|DT945454 ZM_BFb0132K24.r ZM_BFb Zea ma... 36 6.2 gi|76281553|gb|DV021121.1|DV021121 ZM_BFb0139M02.f ZM_BFb Zea ma... 36 6.2 gi|76281554|gb|DV021122.1|DV021122 ZM_BFb0139M02.r ZM_BFb Zea ma... 36 6.2 gi|76286231|gb|DV025799.1|DV025799 ZM_BFb0146I22.f ZM_BFb Zea ma... 36 6.2 gi|76286232|gb|DV025800.1|DV025800 ZM_BFb0146I22.r ZM_BFb Zea ma... 36 6.2 gi|76293390|gb|DV032958.1|DV032958 ZM_BFb0156P04.r ZM_BFb Zea ma... 36 6.2 gi|76294082|gb|DV033650.1|DV033650 ZM_BFb0157P19.r ZM_BFb Zea ma... 36 6.2 gi|76911778|gb|DV164427.1|DV164427 ZM_BFb0160O06.f ZM_BFb Zea ma... 36 6.2 gi|76914521|gb|DV165563.1|DV165563 ZM_BFb0162J06.r ZM_BFb Zea ma... 36 6.2 gi|76927170|gb|DV171163.1|DV171163 ZM_BFb0171F09.r ZM_BFb Zea ma... 36 6.2 gi|78022121|gb|DV490508.1|DV490508 1000023-C03.T7-1 UGI-Reseq Ze... 36 6.2 gi|78022849|gb|DV491236.1|DV491236 1000233-G08.T7-1 UGI-Reseq Ze... 36 6.2 gi|78076331|gb|DV504765.1|DV504765 ZM_BFb0181M16.r ZM_BFb Zea ma... 36 6.2 gi|78077408|gb|DV505842.1|DV505842 ZM_BFb0183F06.r ZM_BFb Zea ma... 36 6.2 gi|78084553|gb|DV512946.1|DV512946 ZM_BFb0193N14.r ZM_BFb Zea ma... 36 6.2 gi|78085330|gb|DV513723.1|DV513723 ZM_BFb0195B03.r ZM_BFb Zea ma... 36 6.2 gi|78091253|gb|DV519627.1|DV519627 ZM_BFb0204C04.f ZM_BFb Zea ma... 36 6.2 gi|78104996|gb|DV523414.1|DV523414 ZM_BFb0209J24.f ZM_BFb Zea ma... 36 6.2 gi|78112568|gb|DV530962.1|DV530962 ZM_BFb0220P01.f ZM_BFb Zea ma... 36 6.2 gi|78113111|gb|DV531505.1|DV531505 ZM_BFb0221K22.r ZM_BFb Zea ma... 36 6.2 gi|78115259|gb|DV533647.1|DV533647 ZM_BFb0224N08.f ZM_BFb Zea ma... 36 6.2 gi|78117136|gb|DV535523.1|DV535523 ZM_BFb0227K02.f ZM_BFb Zea ma... 36 6.2 gi|78120933|gb|DV539317.1|DV539317 ZM_BFb0233B18.r ZM_BFb Zea ma... 36 6.2 >gi|14243080|gb|BG840766.2|BG840766 MEST11-F03.T3 ISUM4-TN Zea mays cDNA clone MEST11-F03 3', mRNA sequence Length = 720 Score = 1405 bits (709), Expect = 0.0 Identities = 717/720 (99%) Strand = Plus / Minus Query: 34 caacgtactaactagcccaccagggcgtcacgcctcgccgccgcccttctcctcgccgtc 93 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 720 caacgtactaactagcccaccagggcgtcacgcctcgcggccgcccttctcctcgcggtc 661 Query: 94 gtcgccctgctgacgtccgtggcgccgctggcgtgcggccaggcagcgtcggcgccgtcc 153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 660 gtcgccctgctgacgtccgtggcgccgctggcgtgcggccaggcagcgtcggcgccgtcc 601 Query: 154 ccagcccccgcgccgcccaagaccatcacggcgatcctgagcaaggccgggcagttcacc 213 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 600 ccagccnccgcgccgcccaagaccatcacggcgatcctgagcaaggccgggcagttcacc 541 Query: 214 aagttcctccagctgctgcagtcgacgcgggaggcggagcagatcaccaaccagctcaag 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 540 aagttcctccagctgctgcagtcgacgcgggaggcggagcagatcaccaaccagctcaag 481 Query: 274 ggcaagccgtccaacggcgggctcacggtgttcgcgccgcccgacagcgccttctccgcg 333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 480 ggcaagccgtccaacggcgggctcacggtgttcgcgccgcccgacagcgccttctccgcg 421 Query: 334 ctccccgccggcacgctcaactccctctccgaccagcagaagacgtcgctggtgcagttc 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 420 ctccccgccggcacgctcaactccctctccgaccagcagaagacgtcgctggtgcagttc 361 Query: 394 cacgtcgtgtccgcggcgctccccgccgcgcagctcgagaccgtcagcaacccgctgcgg 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 360 cacgtcgtgtccgcggcgctccccgccgcgcagctcgagaccgtcagcaacccgctgcgg 301 Query: 454 acgcaggctggcgacaccggcaggggcaagtacccgctcaacctcaccgcggacggctcc 513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 300 acgcaggctggcgacaccggcaggggcaagtacccgctcaacctcaccgcggacggctcc 241 Query: 514 agcgtcaacgtctccacgggggtcgtcaacgccacgctcgacgccacgccgctttacgcc 573 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 240 agcgtcaacgtctccacgggggtcgtcaacgccacgctcgacgccacgccgctttacgcc 181 Query: 574 ggggacaggctcgtcgtctaccaggtcagcaaggtgctgctgccgtgggcgctctacggc 633 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 180 ggggacaggctcgtcgtctaccaggtcagcaaggtgctgctgccgtgggcgctctacggc 121 Query: 634 ccgccggtccccgcgccggccccttccccggcggagagcaagaagaagaagaaggccacg 693 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120 ccgccggtccccgcgccggccccttccccggcggagagcaagaagaagaagaaggccacg 61 Query: 694 ccggatgctgtggcggatgcgccggcggctgagactgcggcggggacgacgacggcgtcg 753 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 60 ccggatgctgtggcggatgcgccggcggctgagactgcggcggggacgacgacggcgtcg 1 >gi|14242866|gb|BG840260.2|BG840260 MEST11-F03.T7-1 ISUM4-TN Zea mays cDNA clone MEST11-F03 5', mRNA sequence Length = 617 Score = 1207 bits (609), Expect = 0.0 Identities = 615/617 (99%) Strand = Plus / Plus Query: 1 ggatcgacctagtacatagatacaacaagtcaacaacgtactaactagcccaccagggcg 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1 ggatcgacctagtacatagatacaacaagtcaacaacgtactaactagcccaccatggcg 60 Query: 61 tcacgcctcgccgccgcccttctcctcgccgtcgtcgccctgctgacgtccgtggcgccg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tcacgcctcgccgccgcccttctcctcgccgtcgtcgccctgctgacgtccgtggcgccg 120 Query: 121 ctggcgtgcggccaggcagcgtcggcgccgtccccagcccccgcgccgcccaagaccatc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 ctggcgtgcggccaggcagcgtcggcgccgtccccagcccccgcgccgcccaagaccatc 180 Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttcctccagctgctgcagtcgacg 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 acggcgatcctgagcaaggccgggcagttcaccaagttcctccagctgctgcagtcgacg 240 Query: 241 cgggaggcggagcagatcaccaaccagctcaagggcaagccgtccaacggcgggctcacg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 cgggaggcggagcagatcaccaaccagctcaagggcaagccgtccaacggcgggctcacg 300 Query: 301 gtgttcgcgccgcccgacagcgccttctccgcgctccccgccggcacgctcaactccctc 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 gtgttcgcgccgcccgacagcgccttctccgcgctccccgccggcacgctcaactccctc 360 Query: 361 tccgaccagcagaagacgtcgctggtgcagttccacgtcgtgtccgcggcgctccccgcc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 tccgaccagcagaagacgtcgctggtgcagttccacgtcgtgtccgcggcgctccccgcc 420 Query: 421 gcgcagctcgagaccgtcagcaacccgctgcggacgcaggctggcgacaccggcaggggc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 gcgcagctcgagaccgtcagcaacccgctgcggacgcaggctggcgacaccggcaggggc 480 Query: 481 aagtacccgctcaacctcaccgcggacggctccagcgtcaacgtctccacgggggtcgtc 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 481 aagtacccgctcaacctcaccgcggacggctccagcgtcaacgtctccacgggggtcgtc 540 Query: 541 aacgccacgctcgacgccacgccgctttacgccggggacaggctcgtcgtctaccaggtc 600 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 541 aacgccacgctcgacgccacgccgttttacgccggggacaggctcgtcgtctaccaggtc 600 Query: 601 agcaaggtgctgctgcc 617 ||||||||||||||||| Sbjct: 601 agcaaggtgctgctgcc 617 >gi|14244277|gb|BG842287.2|BG842287 MEST29-B05.T3 ISUM4-TN Zea mays cDNA clone MEST29-B05 3', mRNA sequence Length = 492 Score = 959 bits (484), Expect = 0.0 Identities = 490/492 (99%) Strand = Plus / Minus Query: 252 gcagatcaccaaccagctcaagggcaagccgtccaacggcgggctcacggtgttcgcgcc 311 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 492 gcagatcaccaaccagctcaaggccaagccgtccaacggcgggctcacggtgttcgcgcc 433 Query: 312 gcccgacagcgccttctccgcgctccccgccggcacgctcaactccctctccgaccagca 371 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 432 gcccgacagcgccttctccgcgctccccgccggcacgctcaactccctctccgaccagca 373 Query: 372 gaagacgtcgctggtgcagttccacgtcgtgtccgcggcgctccccgccgcgcagctcga 431 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 372 gaagacgtcgctggtgcagttccacgtcgtgtccgcggcgctccccgccgcgcagctcga 313 Query: 432 gaccgtcagcaacccgctgcggacgcaggctggcgacaccggcaggggcaagtacccgct 491 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 312 gaccgtcagcaacccgctgcggacgcaggctggcgacaccggcaggggcaagtacccgct 253 Query: 492 caacctcaccgcggacggctccagcgtcaacgtctccacgggggtcgtcaacgccacgct 551 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 252 caacctcaccgcggacggctccagcgtcaacgtctccacgggggtcgtcaacgccacgct 193 Query: 552 cgacgccacgccgctttacgccggggacaggctcgtcgtctaccaggtcagcaaggtgct 611 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 192 agacgccacgccgctttacgccggggacaggctcgtcgtctaccaggtcagcaaggtgct 133 Query: 612 gctgccgtgggcgctctacggcccgccggtccccgcgccggccccttccccggcggagag 671 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132 gctgccgtgggcgctctacggcccgccggtccccgcgccggccccttccccggcggagag 73 Query: 672 caagaagaagaagaaggccacgccggatgctgtggcggatgcgccggcggctgagactgc 731 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 72 caagaagaagaagaaggccacgccggatgctgtggcggatgcgccggcggctgagactgc 13 Query: 732 ggcggggacgac 743 |||||||||||| Sbjct: 12 ggcggggacgac 1 >gi|89758056|gb|DY687398.1|DY687398 ZM_BFb0279A07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 830 Score = 69.9 bits (35), Expect = 4e-10 Identities = 98/119 (82%) Strand = Plus / Plus Query: 343 ggcacgctcaactccctctccgaccagcagaagacgtcgctggtgcagttccacgtcgtg 402 |||||||||||||| || || |||||| | |||| |||||||||||| |||||| ||| Sbjct: 364 ggcacgctcaactcgctgtcggaccaggacaagaacgcgctggtgcagtaccacgtggtg 423 Query: 403 tccgcggcgctccccgccgcgcagctcgagaccgtcagcaacccgctgcggacgcaggc 461 ||||| || ||||| ||||| |||| ||||||||||||||||| || |||||||| Sbjct: 424 tccgccgccatccccatgtcgcagttcgacaccgtcagcaacccgctccgcacgcaggc 482 Score = 60.0 bits (30), Expect = 4e-07 Identities = 36/38 (94%) Strand = Plus / Plus Query: 577 gacaggctcgtcgtctaccaggtcagcaaggtgctgct 614 ||||| ||||||||||||||||||| |||||||||||| Sbjct: 598 gacagcctcgtcgtctaccaggtcaacaaggtgctgct 635 >gi|37374787|gb|CF623781.1|CF623781 zmrws05_0A10-012-c11.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 677 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 447 cacggtgttcgcgcccaccgacagcgccttctcc 414 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 366 gtcgctggtgcagtaccacgtc 345 >gi|37396491|gb|CF635536.1|CF635536 zmrww00_0A20-011-f05.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 502 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 447 cacggtgttcgcgcccaccgacagcgccttctcc 414 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 366 gtcgctggtgcagtaccacgtc 345 >gi|37399378|gb|CF637016.1|CF637016 zmrww00_0B10-015-c07.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 730 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 444 cacggtgttcgcgcccaccgacagcgccttctcc 411 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 363 gtcgctggtgcagtaccacgtc 342 >gi|37401722|gb|CF638228.1|CF638228 zmrww00_0B20-015-c01.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 801 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 444 cacggtgttcgcgcccaccgacagcgccttctcc 411 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 363 gtcgctggtgcagtaccacgtc 342 >gi|44901602|gb|CK828147.1|CK828147 zmrww00_0A21-014-e05.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 760 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 404 cacggtgttcgcgcccaccgacagcgccttctcc 371 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 323 gtcgctggtgcagtaccacgtc 302 >gi|67015800|gb|CO444549.1|CO444549 MZCCL10073A08.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 835 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Plus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 370 cacggtgttcgcgcccaccgacagcgccttctcc 403 Score = 36.2 bits (18), Expect = 6.2 Identities = 18/18 (100%) Strand = Plus / Plus Query: 299 cggtgttcgcgccgcccg 316 |||||||||||||||||| Sbjct: 714 cggtgttcgcgccgcccg 731 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Plus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 451 gtcgctggtgcagtaccacgtc 472 >gi|78074397|gb|DV502831.1|DV502831 ZM_BFb0174N07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 765 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 439 cacggtgttcgcgcccaccgacagcgccttctcc 406 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Minus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 358 gtcgctggtgcagtaccacgtc 337 >gi|78074398|gb|DV502832.1|DV502832 ZM_BFb0174N07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 748 Score = 52.0 bits (26), Expect = 1e-04 Identities = 32/34 (94%) Strand = Plus / Plus Query: 297 cacggtgttcgcgccgcccgacagcgccttctcc 330 ||||||||||||||| ||||||||||||||||| Sbjct: 327 cacggtgttcgcgcccaccgacagcgccttctcc 360 Score = 36.2 bits (18), Expect = 6.2 Identities = 21/22 (95%) Strand = Plus / Plus Query: 378 gtcgctggtgcagttccacgtc 399 |||||||||||||| ||||||| Sbjct: 408 gtcgctggtgcagtaccacgtc 429 >gi|67011906|gb|CO440655.1|CO440655 MZCCL10026G09.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 893 Score = 46.1 bits (23), Expect = 0.006 Identities = 29/31 (93%) Strand = Plus / Plus Query: 338 ccgccggcacgctcaactccctctccgacca 368 ||||||||||||||||| ||||| ||||||| Sbjct: 311 ccgccggcacgctcaacgccctcgccgacca 341 >gi|78124683|gb|DV543067.1|DV543067 ZM_BFb0238K21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 837 Score = 46.1 bits (23), Expect = 0.006 Identities = 35/39 (89%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 ||||||||||||| |||| |||||||||||||| |||| Sbjct: 34 acggcgatcctgaagaagggcgggcagttcaccatgttc 72 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 147 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 186 >gi|71427415|gb|DR808465.1|DR808465 ZM_BFb0035D16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 893 Score = 44.1 bits (22), Expect = 0.025 Identities = 22/22 (100%) Strand = Plus / Minus Query: 66 cctcgccgccgcccttctcctc 87 |||||||||||||||||||||| Sbjct: 167 cctcgccgccgcccttctcctc 146 >gi|71433861|gb|DR814911.1|DR814911 ZM_BFb0044M17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 639 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 541 ctcgccgccgcccttctcggcgccgtcgtc 512 >gi|71433862|gb|DR814912.1|DR814912 ZM_BFb0044M17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 845 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 698 ctcgccgccgcccttctcggcgccgtcgtc 727 >gi|76020619|gb|DT947789.1|DT947789 ZM_BFb0136E02.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 806 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 541 ctcgccgccgcccttctcggcgccgtcgtc 512 >gi|78080722|gb|DV509134.1|DV509134 ZM_BFb0188A21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 769 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 698 ctcgccgccgcccttctcggcgccgtcgtc 727 >gi|78118143|gb|DV536530.1|DV536530 ZM_BFb0229B05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 918 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 541 ctcgccgccgcccttctcggcgccgtcgtc 512 >gi|78118144|gb|DV536531.1|DV536531 ZM_BFb0229B05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 858 Score = 44.1 bits (22), Expect = 0.025 Identities = 28/30 (93%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcctcgccgtcgtc 96 |||||||||||||||||| |||||||||| Sbjct: 736 ctcgccgccgcccttctcggcgccgtcgtc 765 >gi|5268949|gb|AI770913.1|AI770913 606063B10.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 532 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggcg 750 ||||||||||||||||||||| Sbjct: 403 gcggcggggacgacgacggcg 423 >gi|22818805|gb|BU498895.1|BU498895 946170F05.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 572 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 116 cgccgtccccagcccccgctccgcc 140 >gi|26559753|gb|CA831988.1|CA831988 1117026E03.y1 1117 - Unigene V from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 124 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 92 cgccgtccccagcccccgctccgcc 116 >gi|31355019|gb|CD439376.1|CD439376 EL01N0524B04.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 846 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 87 gcgccttctccgcgctccccg 107 >gi|37422279|gb|CF648845.1|CF648845 3530_1_60_1_B02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 496 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 152 gcgccttctccgcgctccccg 172 >gi|37424875|gb|CF650171.1|CF650171 3530_1_82_1_F05.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 521 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 139 gcgccttctccgcgctccccg 159 >gi|50327309|gb|CO522435.1|CO522435 3530_1_148_1_A02.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 732 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 106 cgccgtccccagcccccgctccgcc 130 >gi|67025383|gb|CO454132.1|CO454132 MZCCL10200G10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 872 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 70 cgccgtccccagcccccgctccgcc 94 >gi|71311753|gb|DR792319.1|DR792319 ZM_BFb0012C03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 942 Score = 42.1 bits (21), Expect = 0.10 Identities = 33/37 (89%) Strand = Plus / Plus Query: 291 cgggctcacggtgttcgcgccgcccgacagcgccttc 327 |||| ||||||||||||||||| ||||| ||||||| Sbjct: 448 cgggatcacggtgttcgcgccgaccgacgacgccttc 484 >gi|71326658|gb|DR799987.1|DR799987 ZM_BFb0023C22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 28 gcgccttctccgcgctccccg 48 >gi|71439577|gb|DR820627.1|DR820627 ZM_BFb0059D22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 258 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 49 cgccgtccccagcccccgctccgcc 73 >gi|71439578|gb|DR820628.1|DR820628 ZM_BFb0059D22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 240 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 175 cgccgtccccagcccccgctccgcc 199 >gi|74234597|gb|DT642511.1|DT642511 ZM_BFb0101A21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 636 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 152 gcgccttctccgcgctccccg 172 >gi|74240362|gb|DT648276.1|DT648276 ZM_BFb0109K22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 675 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 142 gcgccttctccgcgctccccg 162 >gi|76011842|gb|DT939012.1|DT939012 ZM_BFb0120L10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 766 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 101 cgccgtccccagcccccgctccgcc 125 >gi|76287865|gb|DV027433.1|DV027433 ZM_BFb0148O02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 859 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 101 cgccgtccccagcccccgctccgcc 125 >gi|78075131|gb|DV503565.1|DV503565 ZM_BFb0180A15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 831 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 132 cgccgtccccagcccccgctccgcc 156 >gi|78083374|gb|DV511767.1|DV511767 ZM_BFb0192B24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 327 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 91 cgccgtccccagcccccgctccgcc 115 >gi|78091769|gb|DV520143.1|DV520143 ZM_BFb0204O07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 888 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 56 gcgccttctccgcgctccccg 76 >gi|78104837|gb|DV523255.1|DV523255 ZM_BFb0209G08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 865 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 91 cgccgtccccagcccccgctccgcc 115 >gi|78108580|gb|DV526998.1|DV526998 ZM_BFb0214N14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 829 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 188 cgccgtccccagcccccgctccgcc 212 >gi|78112066|gb|DV530462.1|DV530462 ZM_BFb0220E03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 774 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 39 gcgccttctccgcgctccccg 59 >gi|87156267|gb|DY401056.1|DY401056 V-946-7B-E03.Gal4-R UGV-Reseq Zea mays cDNA, mRNA sequence Length = 594 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 156 cgccgtccccagcccccgctccgcc 180 >gi|88750025|gb|DY534166.1|DY534166 ZM_BFb0265E07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 547 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 102 cgccgtccccagcccccgctccgcc 126 >gi|89250714|gb|DY622500.1|DY622500 ZM_BFb0289I24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 334 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 93 gcgccttctccgcgctccccg 113 >gi|91872539|gb|EB402496.1|EB402496 ZM_BFb0309F13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 855 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 100 cgccgtccccagcccccgctccgcc 124 >gi|91878643|gb|EB408600.1|EB408600 ZM_BFb0321I21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 580 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 100 cgccgtccccagcccccgctccgcc 124 >gi|93016088|gb|EB641608.1|EB641608 ZM_BFb0331F09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 746 Score = 42.1 bits (21), Expect = 0.10 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 cgccgtccccagcccccgcgccgcc 170 ||||||||||||||||||| ||||| Sbjct: 92 cgccgtccccagcccccgctccgcc 116 >gi|54653542|gb|BT018761.1| Zea mays clone EL01N0524B04.d mRNA sequence Length = 1708 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 87 gcgccttctccgcgctccccg 107 >gi|54653542|gb|BT018761.1| Zea mays clone EL01N0524B04.d mRNA sequence Length = 1708 Score = 42.1 bits (21), Expect = 0.10 Identities = 21/21 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccccg 340 ||||||||||||||||||||| Sbjct: 87 gcgccttctccgcgctccccg 107 >gi|6742349|gb|AW313164.1|AW313164 707040D03.x2 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 617 Score = 40.1 bits (20), Expect = 0.40 Identities = 23/24 (95%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggcgtcg 753 |||||| ||||||||||||||||| Sbjct: 102 gcggcgtggacgacgacggcgtcg 125 >gi|6826987|gb|AW330630.1|AW330630 707040D03.x5 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 473 Score = 40.1 bits (20), Expect = 0.40 Identities = 23/24 (95%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggcgtcg 753 |||||| ||||||||||||||||| Sbjct: 107 gcggcgtggacgacgacggcgtcg 130 >gi|16746016|gb|BM032446.1|BM032446 952006F06.x2 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 266 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 47 ctcgccgccgcccttctcct 66 >gi|16746117|gb|BM032547.1|BM032547 952006F06.x3 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 249 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 31 ctcgccgccgcccttctcct 50 >gi|18384824|gb|BM418023.1|BM418023 952006F06.x5 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 271 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 52 ctcgccgccgcccttctcct 71 >gi|18384825|gb|BM418024.1|BM418024 952006F06.x7 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 226 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 6 ctcgccgccgcccttctcct 25 >gi|18384827|gb|BM418026.1|BM418026 952006F06.x9 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 269 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 49 ctcgccgccgcccttctcct 68 >gi|18385307|gb|BM418506.1|BM418506 952006F06.y1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 191 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 168 ctcgccgccgcccttctcct 149 >gi|29130412|gb|CB381116.1|CB381116 3529_1_52_1_A02.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 577 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 cgcagctcgagaccgtcagc 441 |||||||||||||||||||| Sbjct: 308 cgcagctcgagaccgtcagc 327 >gi|29130913|gb|CB381617.1|CB381617 3529_1_52_1_A02.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 313 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 cgcagctcgagaccgtcagc 441 |||||||||||||||||||| Sbjct: 260 cgcagctcgagaccgtcagc 241 >gi|31355189|gb|CD439546.1|CD439546 EL01N0526B09.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 634 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 203 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 242 >gi|31355578|gb|CD439935.1|CD439935 EL01N0530H04.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 848 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 327 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 366 >gi|32798723|gb|CD950959.1|CD950959 SAT_235 GeneTag2 Zea mays cDNA, mRNA sequence Length = 238 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggccac 692 |||||||||||||||||||| Sbjct: 168 aagaagaagaagaaggccac 149 >gi|44900432|gb|CK826977.1|CK826977 zmrsub1_0A20-007-d02.s3 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 846 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Minus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 770 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 731 >gi|50328642|gb|CO523768.1|CO523768 3530_1_157_1_B05.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 651 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 275 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 314 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 162 acggcgatcctggagaagggcgggcagttcaccatgttc 200 >gi|50331136|gb|CO526262.1|CO526262 3530_1_174_1_G01.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 749 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 315 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 354 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 202 acggcgatcctggagaagggcgggcagttcaccatgttc 240 >gi|50337563|gb|CO532689.1|CO532689 3530_1_215_1_B05.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 627 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 317 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 356 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 204 acggcgatcctggagaagggcgggcagttcaccatgttc 242 >gi|67010509|gb|CO439258.1|CO439258 MZCCL10004D02.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 861 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 355 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 394 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 242 acggcgatcctggagaagggcgggcagttcaccatgttc 280 >gi|67015368|gb|CO444117.1|CO444117 MZCCL10068C06.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 830 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 297 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 336 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 184 acggcgatcctggagaagggcgggcagttcaccatgttc 222 >gi|67016534|gb|CO445283.1|CO445283 MZCCL10082F04.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 896 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 287 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 326 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 174 acggcgatcctggagaagggcgggcagttcaccatgttc 212 >gi|67021194|gb|CO449943.1|CO449943 MZCCL10142E01.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 852 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 322 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 361 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 209 acggcgatcctggagaagggcgggcagttcaccatgttc 247 >gi|67021591|gb|CO450340.1|CO450340 MZCCL10147F07.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 924 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 315 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 354 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 202 acggcgatcctggagaagggcgggcagttcaccatgttc 240 >gi|67024020|gb|CO452769.1|CO452769 MZCCL10185C11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 755 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 355 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 394 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 242 acggcgatcctggagaagggcgggcagttcaccatgttc 280 >gi|71417268|gb|DR803994.1|DR803994 ZM_BFb0028O06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 770 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 313 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 352 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 200 acggcgatcctggagaagggcgggcagttcaccatgttc 238 >gi|71421391|gb|DR805404.1|DR805404 ZM_BFb0030O06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 698 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 288 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 327 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 175 acggcgatcctggagaagggcgggcagttcaccatgttc 213 >gi|71421484|gb|DR805454.1|DR805454 ZM_BFb0030P10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 788 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 572 ctcgccgccgcccttctcct 553 >gi|71431668|gb|DR812718.1|DR812718 ZM_BFb0041I14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 735 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Minus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 728 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 689 >gi|71431669|gb|DR812719.1|DR812719 ZM_BFb0041I14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 782 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 479 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 518 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 366 acggcgatcctggagaagggcgggcagttcaccatgttc 404 >gi|71440672|gb|DR821722.1|DR821722 ZM_BFb0061E04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 687 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 317 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 356 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 204 acggcgatcctggagaagggcgggcagttcaccatgttc 242 >gi|71447237|gb|DR828287.1|DR828287 ZM_BFb0072M04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 725 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctcgccgccgcccttctcct 86 |||||||||||||||||||| Sbjct: 572 ctcgccgccgcccttctcct 553 >gi|71448663|gb|DR829713.1|DR829713 ZM_BFb0076F03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 716 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 303 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 342 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 190 acggcgatcctggagaagggcgggcagttcaccatgttc 228 >gi|71426397|gb|DR807447.1|DR807447 ZM_BFb0033L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 866 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 317 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 356 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 204 acggcgatcctggagaagggcgggcagttcaccatgttc 242 >gi|71766237|gb|DR964174.1|DR964174 ZM_BFb0083H22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 804 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 197 acggcgatcctggagaagggcgggcagttcaccatgttc 235 >gi|71767434|gb|DR965371.1|DR965371 ZM_BFb0085E09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 784 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 441 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 480 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 328 acggcgatcctggagaagggcgggcagttcaccatgttc 366 >gi|71774400|gb|DR972278.1|DR972278 ZM_BFb0095G01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggc 749 |||||||||||||||||||| Sbjct: 220 gcggcggggacgacgacggc 239 >gi|74234274|gb|DT642188.1|DT642188 ZM_BFb0100J12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 750 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 197 acggcgatcctggagaagggcgggcagttcaccatgttc 235 >gi|74243179|gb|DT651093.1|DT651093 ZM_BFb0114P22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 697 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 197 acggcgatcctggagaagggcgggcagttcaccatgttc 235 >gi|74243781|gb|DT651695.1|DT651695 ZM_BFb0115P01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 680 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 113 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 152 Score = 36.2 bits (18), Expect = 6.2 Identities = 33/38 (86%) Strand = Plus / Plus Query: 182 cggcgatcctgagcaaggccgggcagttcaccaagttc 219 ||||||||||| |||| |||||||||||||| |||| Sbjct: 1 cggcgatcctggagaagggcgggcagttcaccatgttc 38 >gi|76012172|gb|DT939342.1|DT939342 ZM_BFb0121G13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 795 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 197 acggcgatcctggagaagggcgggcagttcaccatgttc 235 >gi|76283725|gb|DV023293.1|DV023293 ZM_BFb0142O02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 466 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 282 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 321 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 169 acggcgatcctggagaagggcgggcagttcaccatgttc 207 >gi|76925934|gb|DV170656.1|DV170656 ZM_BFb0170F19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 779 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggc 749 |||||||||||||||||||| Sbjct: 210 gcggcggggacgacgacggc 229 >gi|76936436|gb|DV174726.1|DV174726 ZM_BFb0178L19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 872 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggc 749 |||||||||||||||||||| Sbjct: 179 gcggcggggacgacgacggc 198 >gi|78084788|gb|DV513181.1|DV513181 ZM_BFb0194D10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 739 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 197 acggcgatcctggagaagggcgggcagttcaccatgttc 235 >gi|78105494|gb|DV523912.1|DV523912 ZM_BFb0210F18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 866 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 568 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 607 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 455 acggcgatcctggagaagggcgggcagttcaccatgttc 493 >gi|78112650|gb|DV531044.1|DV531044 ZM_BFb0221A20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 829 Score = 40.1 bits (20), Expect = 0.40 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 cgggctcacggtgttcgcgccgcccgac 318 |||| ||||||||||||||||| ||||| Sbjct: 794 cgggatcacggtgttcgcgccgaccgac 821 >gi|78113245|gb|DV531639.1|DV531639 ZM_BFb0221N22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 840 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 ggcagcgtcggcgccgtccc 154 |||||||||||||||||||| Sbjct: 244 ggcagcgtcggcgccgtccc 263 >gi|78124479|gb|DV542863.1|DV542863 ZM_BFb0238E20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 804 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 310 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 349 >gi|89251945|gb|DY623731.1|DY623731 ZM_BFb0295F19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 487 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 308 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 347 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 195 acggcgatcctggagaagggcgggcagttcaccatgttc 233 >gi|89759087|gb|DY688019.1|DY688019 ZM_BFb0280O21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 791 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 275 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 314 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 162 acggcgatcctggagaagggcgggcagttcaccatgttc 200 >gi|91051446|gb|EB161864.1|EB161864 ZM_BFb0301G23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 666 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 596 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 635 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 483 acggcgatcctggagaagggcgggcagttcaccatgttc 521 >gi|91055427|gb|EB165845.1|EB165845 ZM_BFb0341N22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 752 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 315 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 354 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 202 acggcgatcctggagaagggcgggcagttcaccatgttc 240 >gi|93012945|gb|EB638465.1|EB638465 ZM_BFb0325K11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 901 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 504 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 543 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 391 acggcgatcctggagaagggcgggcagttcaccatgttc 429 >gi|93013260|gb|EB638780.1|EB638780 ZM_BFb0326D01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 790 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 275 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 314 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 162 acggcgatcctggagaagggcgggcagttcaccatgttc 200 >gi|54651280|gb|BT016499.1| Zea mays clone Contig332 mRNA sequence Length = 1156 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 327 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 366 >gi|21210593|gb|AY107515.1| Zea mays PCO145505 mRNA sequence Length = 883 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 317 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 356 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 204 acggcgatcctggagaagggcgggcagttcaccatgttc 242 >gi|54651280|gb|BT016499.1| Zea mays clone Contig332 mRNA sequence Length = 1156 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 327 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 366 >gi|21210593|gb|AY107515.1| Zea mays PCO145505 mRNA sequence Length = 883 Score = 40.1 bits (20), Expect = 0.40 Identities = 35/40 (87%) Strand = Plus / Plus Query: 288 cggcgggctcacggtgttcgcgccgcccgacagcgccttc 327 ||||||| ||||||||||||||| |||||| ||||||| Sbjct: 317 cggcgggtacacggtgttcgcgcccaccgacaacgccttc 356 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 181 acggcgatcctgagcaaggccgggcagttcaccaagttc 219 |||||||||||| |||| |||||||||||||| |||| Sbjct: 204 acggcgatcctggagaagggcgggcagttcaccatgttc 242 >gi|90186366|gb|AC183892.1| Zea mays chromosome UNK clone CH201-390C23; ZMMBBc0390C23, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 162715 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 673 aagaagaagaagaaggccac 692 |||||||||||||||||||| Sbjct: 119655 aagaagaagaagaaggccac 119674 >gi|89257792|gb|AC177918.2| Zea mays chromosome UNK clone CH201-135J1; ZMMBBc0135J01, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 191023 Score = 40.1 bits (20), Expect = 0.40 Identities = 23/24 (95%) Strand = Plus / Plus Query: 730 gcggcggggacgacgacggcgtcg 753 |||||| ||||||||||||||||| Sbjct: 14373 gcggcgtggacgacgacggcgtcg 14396 >gi|4804017|gb|AI665883.1|AI665883 606003B10.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 586 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 409 gcgctccccgccgcgcagc 427 ||||||||||||||||||| Sbjct: 285 gcgctccccgccgcgcagc 267 >gi|5525289|gb|AI861128.1|AI861128 603012E08.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 567 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 459 caagaagaagaagaaggcc 441 >gi|7227554|gb|AW566195.1|AW566195 660063D03.y1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 597 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 376 acgccggcgacaggctcgtcgtc 398 >gi|12971496|gb|BG267511.1|BG267511 1000126G01.x1 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 298 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 258 caagaagaagaagaaggcc 240 >gi|13126579|gb|BG317149.1|BG317149 947025H01.y1 947 - 2 week shoot from Barkan lab Zea mays cDNA, mRNA sequence Length = 469 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 232 caagaagaagaagaaggcc 250 >gi|13150526|gb|BG320848.1|BG320848 Zm04_09c01_R Zm04_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm04_09c01, mRNA sequence Length = 779 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 76 tcctcgccgtcgtcgccct 94 >gi|14208199|gb|BG841877.1|BG841877 MEST33-F05.T3 ISUM3-TL Zea mays cDNA clone MEST33-F05 3', mRNA sequence Length = 675 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 411 ggcggggacgacgacggcg 393 >gi|14244645|gb|BG842583.2|BG842583 MEST33-F05.T7-1 ISUM3-TL Zea mays cDNA clone MEST33-F05 5', mRNA sequence Length = 657 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 286 ggcggggacgacgacggcg 304 >gi|16746015|gb|BM032445.1|BM032445 952006F05.x2 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 328 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 234 tcctcgccgtcgtcgccct 216 >gi|17932512|gb|BM269472.1|BM269472 MEST410-A08.univ ISUM5-RN Zea mays cDNA clone MEST410-A08 3', mRNA sequence Length = 674 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 410 ggcggggacgacgacggcg 392 >gi|18166699|gb|BM336538.1|BM336538 MEST195-D06.T3 ISUM5-RN Zea mays cDNA clone MEST195-D06 3', mRNA sequence Length = 423 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 411 ggcggggacgacgacggcg 393 >gi|18168884|gb|BM338724.1|BM338724 MEST231-C10.T3 ISUM5-RN Zea mays cDNA clone MEST231-C10 3', mRNA sequence Length = 680 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 408 ggcggggacgacgacggcg 390 >gi|18171227|gb|BM341067.1|BM341067 MEST329-H02.T3 ISUM5-RN Zea mays cDNA clone MEST329-H02 3', mRNA sequence Length = 587 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 535 ggcggggacgacgacggcg 517 >gi|18173744|gb|BM349132.1|BM349132 MEST308-H05.T3 ISUM5-RN Zea mays cDNA clone MEST308-H05 3', mRNA sequence Length = 637 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 452 ggcggggacgacgacggcg 434 >gi|18175684|gb|BM350907.1|BM350907 MEST270-E04.T3 ISUM5-RN Zea mays cDNA clone MEST270-E04 3', mRNA sequence Length = 600 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 457 ggcggggacgacgacggcg 439 >gi|18179735|gb|BM380945.1|BM380945 MEST527-E12.univ ISUM6 Zea mays cDNA clone MEST527-E12 3', mRNA sequence Length = 668 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 ggcggggacgacgacggcg 750 ||||||||||||||||||| Sbjct: 413 ggcggggacgacgacggcg 395 >gi|18384822|gb|BM418021.1|BM418021 952006F05.x7 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 256 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 162 tcctcgccgtcgtcgccct 144 >gi|18384823|gb|BM418022.1|BM418022 952006F05.x8 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 299 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 205 tcctcgccgtcgtcgccct 187 >gi|18964839|gb|BM661240.1|BM661240 952046A12.y1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 600 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 92 tcctcgccgtcgtcgccct 110 >gi|22490336|gb|BU050259.1|BU050259 1111026A09.y1 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 484 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 92 tcctcgccgtcgtcgccct 110 >gi|24767873|gb|CA403008.1|CA403008 EL01N0445F03.g Endosperm_4 Zea mays cDNA, mRNA sequence Length = 663 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 397 caagaagaagaagaaggcc 379 >gi|24768846|gb|CA403975.1|CA403975 EL01N0510B02.g Endosperm_4 Zea mays cDNA, mRNA sequence Length = 484 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 476 aagaagaagaagaaggcca 458 >gi|24769547|gb|CA404676.1|CA404676 EL01N0522A08.g Endosperm_4 Zea mays cDNA, mRNA sequence Length = 705 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 510 aagaagaagaagaaggcca 492 >gi|31350757|gb|CD435114.1|CD435114 EL01N0354E11.b Endosperm_3 Zea mays cDNA, mRNA sequence Length = 673 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 614 caagaagaagaagaaggcc 632 >gi|31352058|gb|CD436415.1|CD436415 EL01N0354E11.g Endosperm_3 Zea mays cDNA, mRNA sequence Length = 463 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 404 caagaagaagaagaaggcc 386 >gi|31354800|gb|CD439157.1|CD439157 EL01N0521F03.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 810 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 743 caagaagaagaagaaggcc 761 >gi|31357974|gb|CD442331.1|CD442331 EL01N0408A12.b Endosperm_4 Zea mays cDNA, mRNA sequence Length = 664 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 401 acgccggcgacaggctcgtcgtc 423 >gi|32801475|gb|CD953711.1|CD953711 SBK_29 GeneTag2 Zea mays cDNA, mRNA sequence Length = 378 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 136 acgccggcgacaggctcgtcgtc 158 >gi|32824056|gb|CD963778.1|CD963778 SDX_64 GeneTag2 Zea mays cDNA, mRNA sequence Length = 378 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 136 acgccggcgacaggctcgtcgtc 158 >gi|33466730|gb|CF243779.1|CF243779 3530_1_23_1_H04.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 621 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 381 acgccggcgacaggctcgtcgtc 403 >gi|37375921|gb|CF624445.1|CF624445 zmrws05_0A20-003-g07.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 712 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 87 caagaagaagaagaaggcc 69 >gi|37424010|gb|CF649735.1|CF649735 3530_1_75_1_D12.x_2 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 399 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 42 tcctcgccgtcgtcgccct 60 >gi|50322365|gb|CO517491.1|CO517491 3530_1_113_1_G02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 646 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 55 caagaagaagaagaaggcc 37 >gi|50322366|gb|CO517492.1|CO517492 3530_1_113_1_G02.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 791 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 739 caagaagaagaagaaggcc 757 >gi|50322502|gb|CO517628.1|CO517628 3530_1_114_1_F03.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 739 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 368 acgccggcgacaggctcgtcgtc 390 >gi|50327759|gb|CO522885.1|CO522885 3530_1_151_1_C01.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 808 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|50330140|gb|CO525266.1|CO525266 3530_1_167_1_D09.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 689 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 73 tcctcgccgtcgtcgccct 91 >gi|50331770|gb|CO526896.1|CO526896 3530_1_178_1_H09.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 764 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|50334685|gb|CO529811.1|CO529811 3530_1_197_1_D04.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 680 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 78 caagaagaagaagaaggcc 60 >gi|50335192|gb|CO530318.1|CO530318 3530_1_19_1_H04.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 621 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 381 acgccggcgacaggctcgtcgtc 403 >gi|60339823|gb|DN206796.1|DN206796 MEST839_A07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 695 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 51 acgccggcgacaggctcgtcgtc 73 >gi|67014354|gb|CO443103.1|CO443103 MZCCL10059H12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 575 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 497 caagaagaagaagaaggcc 515 >gi|67041353|gb|CO467608.1|CO467608 MZCCL20043G10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 835 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 228 acgccggcgacaggctcgtcgtc 250 >gi|71301525|gb|DR786805.1|DR786805 ZM_BFb0003O18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 808 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71304400|gb|DR788313.1|DR788313 ZM_BFb0006E10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 808 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71312225|gb|DR792634.1|DR792634 ZM_BFb0012J01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 773 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 80 tcctcgccgtcgtcgccct 98 >gi|71324156|gb|DR798782.1|DR798782 ZM_BFb0021H07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 752 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71325689|gb|DR799529.1|DR799529 ZM_BFb0022I07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 807 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71327168|gb|DR800224.1|DR800224 ZM_BFb0023I08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 894 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71427029|gb|DR808079.1|DR808079 ZM_BFb0034K08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 839 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 87 tcctcgccgtcgtcgccct 105 >gi|71429126|gb|DR810176.1|DR810176 ZM_BFb0037L16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 758 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71429326|gb|DR810376.1|DR810376 ZM_BFb0038A11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 833 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71430084|gb|DR811134.1|DR811134 ZM_BFb0039D12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 869 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71431292|gb|DR812342.1|DR812342 ZM_BFb0041A05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 807 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71432513|gb|DR813563.1|DR813563 ZM_BFb0042M19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 855 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 77 tcctcgccgtcgtcgccct 95 >gi|71432619|gb|DR813669.1|DR813669 ZM_BFb0042P08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 689 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 664 aagaagaagaagaaggcca 646 >gi|71438047|gb|DR819097.1|DR819097 ZM_BFb0055A09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 720 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 508 cgccgccgcccttctccttgccg 486 >gi|71438310|gb|DR819360.1|DR819360 ZM_BFb0055L23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 739 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 342 cgccgccgcccttctccttgccg 320 >gi|71439007|gb|DR820057.1|DR820057 ZM_BFb0057L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 790 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 90 tcctcgccgtcgtcgccct 108 >gi|71440703|gb|DR821753.1|DR821753 ZM_BFb0061F18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 516 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 77 tcctcgccgtcgtcgccct 95 >gi|71441346|gb|DR822396.1|DR822396 ZM_BFb0062J16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 705 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 394 acgccggcgacaggctcgtcgtc 416 >gi|71445707|gb|DR826757.1|DR826757 ZM_BFb0069K14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 823 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 79 tcctcgccgtcgtcgccct 97 >gi|71447332|gb|DR828382.1|DR828382 ZM_BFb0073A17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 825 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 498 aagaagaagaagaaggcca 516 >gi|71448552|gb|DR829602.1|DR829602 ZM_BFb0076A06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 746 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 725 caagaagaagaagaaggcc 743 >gi|71450060|gb|DR831110.1|DR831110 ZM_BFb0079J08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 820 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|71450338|gb|DR831388.1|DR831388 ZM_BFb0079P14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 809 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|71757721|gb|DR955658.1|DR955658 ZM_BFb0049O02.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 807 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 135 ggcagcgtcggcgccgtcc 153 ||||||||||||||||||| Sbjct: 258 ggcagcgtcggcgccgtcc 276 >gi|71761256|gb|DR959193.1|DR959193 ZM_BFb0065L19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 803 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|71762858|gb|DR960795.1|DR960795 ZM_BFb0076A06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 803 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|71766352|gb|DR964289.1|DR964289 ZM_BFb0083K14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 661 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|71770511|gb|DR968448.1|DR968448 ZM_BFb0089M06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 864 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 78 tcctcgccgtcgtcgccct 96 >gi|71774474|gb|DR972352.1|DR972352 ZM_BFb0095H16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 682 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 336 caagaagaagaagaaggcc 318 >gi|71774475|gb|DR972353.1|DR972353 ZM_BFb0095H16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 775 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 730 caagaagaagaagaaggcc 748 >gi|71775479|gb|DR973357.1|DR973357 ZM_BFb0096P03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 461 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 92 tcctcgccgtcgtcgccct 110 >gi|74231972|gb|DT639886.1|DT639886 ZM_BFb0097D10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 764 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|74232376|gb|DT640290.1|DT640290 ZM_BFb0097N01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 766 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 413 acgccggcgacaggctcgtcgtc 435 >gi|74233194|gb|DT641108.1|DT641108 ZM_BFb0099A11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 580 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggccacgc 694 |||||||||||||||| |||||| Sbjct: 484 caagaagaagaagaagaccacgc 462 >gi|74234072|gb|DT641986.1|DT641986 ZM_BFb0100E24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 775 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 668 agagcaagaagaagaagaa 686 ||||||||||||||||||| Sbjct: 192 agagcaagaagaagaagaa 210 >gi|74241903|gb|DT649817.1|DT649817 ZM_BFb0112M12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 769 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 764 aagaagaagaagaaggcca 746 >gi|74243069|gb|DT650983.1|DT650983 ZM_BFb0114N03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 600 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 389 acgccggcgacaggctcgtcgtc 411 >gi|74245040|gb|DT652954.1|DT652954 ZM_BFb0119K04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 764 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 388 acgccggcgacaggctcgtcgtc 410 >gi|74245859|gb|DT653773.1|DT653773 ZM_BFb0125L13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 802 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76010873|gb|DT938043.1|DT938043 ZM_BFb0117M13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 759 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 666 aagaagaagaagaaggcca 648 >gi|76014369|gb|DT941539.1|DT941539 ZM_BFb0125J10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 767 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76014503|gb|DT941673.1|DT941673 ZM_BFb0126C01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 749 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 393 acgccggcgacaggctcgtcgtc 415 >gi|76020450|gb|DT947620.1|DT947620 ZM_BFb0135O13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 636 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 381 acgccggcgacaggctcgtcgtc 403 >gi|76280643|gb|DV020211.1|DV020211 ZM_BFb0138H07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 795 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76281073|gb|DV020641.1|DV020641 ZM_BFb0139A23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 895 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76282607|gb|DV022175.1|DV022175 ZM_BFb0141D20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 717 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 353 acgccggcgacaggctcgtcgtc 375 >gi|76287428|gb|DV026996.1|DV026996 ZM_BFb0148E05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 763 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76287639|gb|DV027207.1|DV027207 ZM_BFb0148J03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 823 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76287765|gb|DV027333.1|DV027333 ZM_BFb0148L22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 812 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76292712|gb|DV032280.1|DV032280 ZM_BFb0156A03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 845 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|76914257|gb|DV165458.1|DV165458 ZM_BFb0162G15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 624 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 412 acgccggcgacaggctcgtcgtc 434 >gi|76929320|gb|DV171958.1|DV171958 ZM_BFb0173A12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 758 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 368 acgccggcgacaggctcgtcgtc 390 >gi|76935232|gb|DV174250.1|DV174250 ZM_BFb0177M05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 569 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 388 acgccggcgacaggctcgtcgtc 410 >gi|76936175|gb|DV174619.1|DV174619 ZM_BFb0178I03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 908 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|78023847|gb|DV492234.1|DV492234 1000081-G05.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 468 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 409 gcgctccccgccgcgcagc 427 ||||||||||||||||||| Sbjct: 285 gcgctccccgccgcgcagc 267 >gi|78074107|gb|DV502541.1|DV502541 ZM_BFb0174G18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 797 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 731 cgccgccgcccttctccttgccg 753 >gi|78081604|gb|DV510016.1|DV510016 ZM_BFb0189G23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 809 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 85 tcctcgccgtcgtcgccct 103 >gi|78085967|gb|DV514360.1|DV514360 ZM_BFb0196F09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 856 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|78092997|gb|DV521371.1|DV521371 ZM_BFb0206K10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 797 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 669 gagcaagaagaagaagaag 687 ||||||||||||||||||| Sbjct: 739 gagcaagaagaagaagaag 721 >gi|78103671|gb|DV522099.1|DV522099 ZM_BFb0207K23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 857 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|78103672|gb|DV522100.1|DV522100 ZM_BFb0207K23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 856 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 846 cgccgccgcccttctccttgccg 824 >gi|78105100|gb|DV523518.1|DV523518 ZM_BFb0209M09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 884 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 87 tcctcgccgtcgtcgccct 105 >gi|78105142|gb|DV523560.1|DV523560 ZM_BFb0209N08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 813 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|78105846|gb|DV524264.1|DV524264 ZM_BFb0210O05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 805 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|78107700|gb|DV526118.1|DV526118 ZM_BFb0213J15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 726 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 393 acgccggcgacaggctcgtcgtc 415 >gi|78110078|gb|DV528493.1|DV528493 ZM_BFb0217A01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 808 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|78110090|gb|DV528505.1|DV528505 ZM_BFb0217A07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 671 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 673 aagaagaagaagaaggcca 691 ||||||||||||||||||| Sbjct: 453 aagaagaagaagaaggcca 435 >gi|78110620|gb|DV529028.1|DV529028 ZM_BFb0217L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 826 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 80 tcctcgccgtcgtcgccct 98 >gi|78119359|gb|DV537743.1|DV537743 ZM_BFb0230N03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 781 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 726 cgccgccgcccttctccttgccg 748 >gi|78123393|gb|DV541777.1|DV541777 ZM_BFb0236K19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 780 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|86466288|gb|DY232659.1|DY232659 ZM_BFb0241O12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 600 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 320 gcgccttctccgcgctccc 338 ||||||||||||||||||| Sbjct: 130 gcgccttctccgcgctccc 148 >gi|86472645|gb|DY239015.1|DY239015 ZM_BFb0257E02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 529 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 76 tcctcgccgtcgtcgccct 94 >gi|86474499|gb|DY240869.1|DY240869 ZM_BFb0260O04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 885 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|86475190|gb|DY241560.1|DY241560 ZM_BFb0262B07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 415 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 368 acgccggcgacaggctcgtcgtc 390 >gi|88753112|gb|DY537253.1|DY537253 ZM_BFb0271L07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 316 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 90 tcctcgccgtcgtcgccct 108 >gi|89246985|gb|DY618771.1|DY618771 ZM_BFb0274N03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 790 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|89248077|gb|DY619863.1|DY619863 ZM_BFb0278B17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 709 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 668 agagcaagaagaagaagaa 686 ||||||||||||||||||| Sbjct: 202 agagcaagaagaagaagaa 220 >gi|89248228|gb|DY620014.1|DY620014 ZM_BFb0278F18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 563 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 79 tcctcgccgtcgtcgccct 97 >gi|89251308|gb|DY623094.1|DY623094 ZM_BFb0293H18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 509 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 77 tcctcgccgtcgtcgccct 95 >gi|89252458|gb|DY624244.1|DY624244 ZM_BFb0302G06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 516 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|91050413|gb|EB160831.1|EB160831 ZM_BFb0298P14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 636 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|91055009|gb|EB165427.1|EB165427 ZM_BFb0341E12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 704 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 79 caagaagaagaagaaggcc 61 >gi|91055010|gb|EB165428.1|EB165428 ZM_BFb0341E12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 704 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 626 caagaagaagaagaaggcc 644 >gi|91056834|gb|EB167252.1|EB167252 ZM_BFb0377O12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 708 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 81 tcctcgccgtcgtcgccct 99 >gi|91869390|gb|EB400362.1|EB400362 ZM_BFb0305H05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 309 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 84 tcctcgccgtcgtcgccct 102 >gi|91871005|gb|EB401193.1|EB401193 ZM_BFb0307B11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 755 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 388 acgccggcgacaggctcgtcgtc 410 >gi|93012355|gb|EB637875.1|EB637875 ZM_BFb0324G14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 388 acgccggcgacaggctcgtcgtc 410 >gi|93013330|gb|EB638850.1|EB638850 ZM_BFb0326E18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 758 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 69 cgccgccgcccttctcctcgccg 91 |||||||||||||||||| |||| Sbjct: 729 cgccgccgcccttctccttgccg 751 >gi|54651177|gb|BT016396.1| Zea mays clone Contig229 mRNA sequence Length = 1341 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 757 caagaagaagaagaaggcc 775 >gi|54653233|gb|BT018452.1| Zea mays clone EL01N0408A12.d mRNA sequence Length = 1457 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 401 acgccggcgacaggctcgtcgtc 423 >gi|21209301|gb|AY106223.1| Zea mays PCO114759 mRNA sequence Length = 1532 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 107 tcctcgccgtcgtcgccct 125 >gi|21212188|gb|AY108895.1| Zea mays PCO149879 mRNA sequence Length = 628 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 409 acgccggcgacaggctcgtcgtc 431 >gi|1491773|emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1 Length = 1412 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 85 tcctcgccgtcgtcgccct 103 >gi|1491773|emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1 Length = 1412 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 tcctcgccgtcgtcgccct 101 ||||||||||||||||||| Sbjct: 85 tcctcgccgtcgtcgccct 103 >gi|45587226|gb|BV117853.1| PZA00815 CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 663 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 225 gctgctgcagtcgacgcgg 243 ||||||||||||||||||| Sbjct: 184 gctgctgcagtcgacgcgg 166 >gi|54653233|gb|BT018452.1| Zea mays clone EL01N0408A12.d mRNA sequence Length = 1457 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 569 acgccggggacaggctcgtcgtc 591 ||||||| ||||||||||||||| Sbjct: 401 acgccggcgacaggctcgtcgtc 423 >gi|54651177|gb|BT016396.1| Zea mays clone Contig229 mRNA sequence Length = 1341 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 672 caagaagaagaagaaggcc 690 ||||||||||||||||||| Sbjct: 757 caagaagaagaagaaggcc 775 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 581,186 Number of Sequences: 836351 Number of extensions: 581186 Number of successful extensions: 73222 Number of sequences better than 10.0: 632 Number of HSP's better than 10.0 without gapping: 572 Number of HSP's successfully gapped in prelim test: 60 Number of HSP's that attempted gapping in prelim test: 71949 Number of HSP's gapped (non-prelim): 1258 length of query: 753 length of database: 669,372,029 effective HSP length: 19 effective length of query: 734 effective length of database: 653,481,360 effective search space: 479655318240 effective search space used: 479655318240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)