BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 3671909.2.1 (767 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|78180651|gb|DV550979.1|DV550979 1000053-A01.GAD10-F UGI-Reseq... 1179 0.0 gi|6696038|gb|AW289146.1|AW289146 707010B03.y3 707 - Mixed adult... 1059 0.0 gi|12058149|gb|BF733060.1|BF733060 1000053A01.x2 1000 - Unigene ... 868 0.0 gi|21207600|gb|AY104522.1| Zea mays PCO077650 mRNA sequence 813 0.0 gi|21207600|gb|AY104522.1| Zea mays PCO077650 mRNA sequence 813 0.0 gi|6695765|gb|AW288843.1|AW288843 707010G10.y2 707 - Mixed adult... 777 0.0 gi|45590055|gb|BV120682.1| PZA00903 Oh43 Zea mays Oh43 Zea mays ... 581 e-164 gi|45590059|gb|BV120686.1| PZA00903 Ky21 Zea mays Ky21 Zea mays ... 577 e-163 gi|45590061|gb|BV120688.1| PZA00903 Hp301 Zea mays Hp301 Zea may... 557 e-157 gi|45590056|gb|BV120683.1| PZA00903 Il14H Zea mays Il14H Zea may... 551 e-155 gi|45590066|gb|BV120693.1| PZA00903 CML333 Zea mays CML333 Zea m... 549 e-154 gi|45590065|gb|BV120692.1| PZA00903 Kul11 Zea mays Kul11 Zea may... 549 e-154 gi|45590064|gb|BV120691.1| PZA00903 Kul3 Zea mays Kul3 Zea mays ... 541 e-152 gi|6695693|gb|AW288771.1|AW288771 707010B03.x5 707 - Mixed adult... 402 e-110 gi|45590063|gb|BV120690.1| PZA00903 NC350 Zea mays NC350 Zea may... 264 1e-68 gi|45590057|gb|BV120684.1| PZA00903 Mo17(1) Zea mays Mo17(1) Zea... 264 1e-68 gi|45590060|gb|BV120687.1| PZA00903 M37W Zea mays M37W Zea mays ... 262 6e-68 gi|45590053|gb|BV120680.1| PZA00903 B73(1) Zea mays B73(1) Zea m... 248 9e-64 gi|45590062|gb|BV120689.1| PZA00903 CML247 Zea mays CML247 Zea m... 246 3e-63 gi|45590058|gb|BV120685.1| PZA00903 Mo17(2) Zea mays Mo17(2) Zea... 246 3e-63 gi|45590054|gb|BV120681.1| PZA00903 B73(2) Zea mays B73(2) Zea m... 230 2e-58 gi|45590067|gb|BV120694.1| PZA00903 CML322 Zea mays CML322 Zea m... 194 1e-47 gi|37392468|gb|CF633485.1|CF633485 zmrws48_0B20-016-d11.s3 zmrws... 72 1e-10 gi|50327994|gb|CO523120.1|CO523120 3530_1_152_1_H09.x_1 3530 - F... 72 1e-10 gi|71306311|gb|DR789298.1|DR789298 ZM_BFb0007M09.f ZM_BFb Zea ma... 72 1e-10 gi|71420517|gb|DR805122.1|DR805122 ZM_BFb0030H14.f ZM_BFb Zea ma... 72 1e-10 gi|78120569|gb|DV538953.1|DV538953 ZM_BFb0232J12.f ZM_BFb Zea ma... 72 1e-10 gi|78122966|gb|DV541350.1|DV541350 ZM_BFb0236B10.f ZM_BFb Zea ma... 72 1e-10 gi|91051677|gb|EB162095.1|EB162095 ZM_BFb0301N18.f ZM_BFb Zea ma... 72 1e-10 gi|71322406|gb|DR797872.1|DR797872 ZM_BFb0020C20.f ZM_BFb Zea ma... 66 7e-09 gi|71768641|gb|DR966578.1|DR966578 ZM_BFb0087A04.f ZM_BFb Zea ma... 66 7e-09 gi|74243336|gb|DT651250.1|DT651250 ZM_BFb0115D23.f ZM_BFb Zea ma... 66 7e-09 gi|76013322|gb|DT940492.1|DT940492 ZM_BFb0123F18.f ZM_BFb Zea ma... 66 7e-09 gi|78089529|gb|DV517903.1|DV517903 ZM_BFb0201K09.f ZM_BFb Zea ma... 66 7e-09 gi|78120301|gb|DV538685.1|DV538685 ZM_BFb0232D16.f ZM_BFb Zea ma... 66 7e-09 gi|89250210|gb|DY621996.1|DY621996 ZM_BFb0286N01.f ZM_BFb Zea ma... 66 7e-09 gi|91053419|gb|EB163837.1|EB163837 ZM_BFb0311O16.f ZM_BFb Zea ma... 66 7e-09 gi|6851581|gb|AW352591.1|AW352591 660031E03.x1 660 - Mixed stage... 64 3e-08 gi|32791139|gb|CD943375.1|CD943375 RCP_27 GeneTag1 Zea mays cDNA... 62 1e-07 gi|32793194|gb|CD945430.1|CD945430 RDY_40 GeneTag1 Zea mays cDNA... 62 1e-07 gi|32825918|gb|CD965596.1|CD965596 SEK_285 GeneTag2 Zea mays cDN... 62 1e-07 gi|32826440|gb|CD966118.1|CD966118 SEL_98 GeneTag2 Zea mays cDNA... 62 1e-07 gi|71764817|gb|DR962754.1|DR962754 ZM_BFb0081G11.f ZM_BFb Zea ma... 58 2e-06 gi|76013953|gb|DT941123.1|DT941123 ZM_BFb0124F20.f ZM_BFb Zea ma... 58 2e-06 gi|14202208|gb|BG835885.1|BG835885 Zm06_08b05_R Zm06_AAFC_ECORC_... 56 7e-06 gi|14245303|gb|BG873885.1|BG873885 MEST43-G07.T3 ISUM4-TN Zea ma... 56 7e-06 gi|50325763|gb|CO520889.1|CO520889 3530_1_138_1_C02.x_1 3530 - F... 56 7e-06 gi|50332695|gb|CO527821.1|CO527821 3530_1_184_1_D02.x_1 3530 - F... 56 7e-06 gi|71430585|gb|DR811635.1|DR811635 ZM_BFb0039O22.f ZM_BFb Zea ma... 56 7e-06 gi|71433597|gb|DR814647.1|DR814647 ZM_BFb0044G10.r ZM_BFb Zea ma... 56 7e-06 gi|71759670|gb|DR957607.1|DR957607 ZM_BFb0057C06.f ZM_BFb Zea ma... 56 7e-06 gi|74234174|gb|DT642088.1|DT642088 ZM_BFb0100H08.f ZM_BFb Zea ma... 56 7e-06 gi|74240208|gb|DT648122.1|DT648122 ZM_BFb0109H08.f ZM_BFb Zea ma... 56 7e-06 gi|74240266|gb|DT648180.1|DT648180 ZM_BFb0109I14.f ZM_BFb Zea ma... 56 7e-06 gi|78083196|gb|DV511589.1|DV511589 ZM_BFb0191N16.f ZM_BFb Zea ma... 56 7e-06 gi|78086610|gb|DV515003.1|DV515003 ZM_BFb0197G06.f ZM_BFb Zea ma... 56 7e-06 gi|86474038|gb|DY240408.1|DY240408 ZM_BFb0259N16.f ZM_BFb Zea ma... 56 7e-06 gi|86474231|gb|DY240601.1|DY240601 ZM_BFb0260E01.f ZM_BFb Zea ma... 56 7e-06 gi|88757920|gb|DY542061.1|DY542061 ZM_BFb0367G11.r ZM_BFb Zea ma... 56 7e-06 gi|89252877|gb|DY624663.1|DY624663 ZM_BFb0347C24.r ZM_BFb Zea ma... 56 7e-06 gi|91873267|gb|EB403224.1|EB403224 ZM_BFb0310I12.r ZM_BFb Zea ma... 56 7e-06 gi|71424242|gb|DR806269.1|DR806269 ZM_BFb0032B23.f ZM_BFb Zea ma... 54 3e-05 gi|71774000|gb|DR971887.1|DR971887 ZM_BFb0094M16.f ZM_BFb Zea ma... 54 3e-05 gi|78074168|gb|DV502602.1|DV502602 ZM_BFb0174I02.f ZM_BFb Zea ma... 54 3e-05 gi|78083010|gb|DV511403.1|DV511403 ZM_BFb0191I19.f ZM_BFb Zea ma... 54 3e-05 gi|88757919|gb|DY542060.1|DY542060 ZM_BFb0367G11.f ZM_BFb Zea ma... 54 3e-05 gi|91873266|gb|EB403223.1|EB403223 ZM_BFb0310I12.f ZM_BFb Zea ma... 54 3e-05 gi|78120542|gb|DV538926.1|DV538926 ZM_BFb0232I22.f ZM_BFb Zea ma... 50 4e-04 gi|4688361|gb|AI637031.1|AI637031 496003D11.x1 496 - stressed sh... 48 0.002 gi|7304703|gb|AW600642.1|AW600642 707104D05.x1 707 - Mixed adult... 48 0.002 gi|18660933|gb|BM501125.1|BM501125 PAC000000001152 Pioneer AF-1 ... 48 0.002 gi|37387590|gb|CF630992.1|CF630992 zmrws48_0B10-003-a10.s4 zmrws... 48 0.002 gi|40335836|gb|CK369906.1|CK369906 zmrws485_0B10-003-a10.s0 zmrw... 48 0.002 gi|60352311|gb|DN219284.1|DN219284 MEST1079_D04.T7-1 UGA-ZmSAM-X... 48 0.002 gi|71326939|gb|DR800129.1|DR800129 ZM_BFb0023G04.f ZM_BFb Zea ma... 48 0.002 gi|76935715|gb|DV174444.1|DV174444 ZM_BFb0178B21.r ZM_BFb Zea ma... 48 0.002 gi|89248466|gb|DY620252.1|DY620252 ZM_BFb0278M09.f ZM_BFb Zea ma... 48 0.002 gi|93015387|gb|EB640907.1|EB640907 ZM_BFb0330C13.f ZM_BFb Zea ma... 48 0.002 gi|21207161|gb|AY104083.1| Zea mays PCO090231 mRNA sequence 48 0.002 gi|21207161|gb|AY104083.1| Zea mays PCO090231 mRNA sequence 48 0.002 gi|4730327|gb|AI649493.1|AI649493 603005C05.x1 603 - stressed ro... 46 0.007 gi|5055486|gb|AI734373.1|AI734373 606030C10.x1 606 - Ear tissue ... 46 0.007 gi|6826928|gb|AW330571.1|AW330571 707029D02.x2 707 - Mixed adult... 46 0.007 gi|9254255|gb|BE344723.1|BE344723 946028D11.x1 946 - tassel prim... 46 0.007 gi|9254256|gb|BE344724.1|BE344724 946028D11.y1 946 - tassel prim... 46 0.007 gi|14208455|gb|BG842133.1|BG842133 MEST36-F01.T3 ISUM3-TL Zea ma... 46 0.007 gi|14245434|gb|BG874016.1|BG874016 MEST45-D02.T3 ISUM4-TN Zea ma... 46 0.007 gi|33466477|gb|CF243526.1|CF243526 3530_1_21_1_G09.x_1 3530 - Fu... 46 0.007 gi|37375843|gb|CF624395.1|CF624395 zmrws05_0A20-003-c01.s4 zmrws... 46 0.007 gi|37392156|gb|CF633325.1|CF633325 zmrws48_0B20-014-e03.s4 zmrws... 46 0.007 gi|37394824|gb|CF634690.1|CF634690 zmrww00_0A20-001-b08.s2 zmrww... 46 0.007 gi|50331899|gb|CO527025.1|CO527025 3530_1_179_1_G05.x_1 3530 - F... 46 0.007 gi|50332050|gb|CO527176.1|CO527176 3530_1_17_1_G09.x_1 3530 - Fu... 46 0.007 gi|60356564|gb|DN223537.1|DN223537 MEST1144_B04.T7-1 UGA-ZmSAM-X... 46 0.007 gi|71298189|gb|DR785071.1|DR785071 ZM_BFb0001H08.f ZM_BFb Zea ma... 46 0.007 gi|71302152|gb|DR787183.1|DR787183 ZM_BFb0004H20.f ZM_BFb Zea ma... 46 0.007 gi|71308857|gb|DR790678.1|DR790678 ZM_BFb0009M03.f ZM_BFb Zea ma... 46 0.007 gi|71418226|gb|DR804374.1|DR804374 ZM_BFb0029G21.f ZM_BFb Zea ma... 46 0.007 gi|71418693|gb|DR804509.1|DR804509 ZM_BFb0029J20.f ZM_BFb Zea ma... 46 0.007 gi|71422795|gb|DR805848.1|DR805848 ZM_BFb0031I07.f ZM_BFb Zea ma... 46 0.007 gi|71430402|gb|DR811452.1|DR811452 ZM_BFb0039K16.f ZM_BFb Zea ma... 46 0.007 gi|71431463|gb|DR812513.1|DR812513 ZM_BFb0041E01.f ZM_BFb Zea ma... 46 0.007 gi|71438122|gb|DR819172.1|DR819172 ZM_BFb0055D17.r ZM_BFb Zea ma... 46 0.007 gi|71440218|gb|DR821268.1|DR821268 ZM_BFb0060H16.f ZM_BFb Zea ma... 46 0.007 gi|71446569|gb|DR827619.1|DR827619 ZM_BFb0070O17.f ZM_BFb Zea ma... 46 0.007 gi|71756687|gb|DR954624.1|DR954624 ZM_BFb0047E24.f ZM_BFb Zea ma... 46 0.007 gi|71758514|gb|DR956451.1|DR956451 ZM_BFb0052P21.f ZM_BFb Zea ma... 46 0.007 gi|71761551|gb|DR959488.1|DR959488 ZM_BFb0071K13.f ZM_BFb Zea ma... 46 0.007 gi|71765050|gb|DR962987.1|DR962987 ZM_BFb0081L20.f ZM_BFb Zea ma... 46 0.007 gi|71769835|gb|DR967772.1|DR967772 ZM_BFb0088M09.f ZM_BFb Zea ma... 46 0.007 gi|71771667|gb|DR969604.1|DR969604 ZM_BFb0091G19.f ZM_BFb Zea ma... 46 0.007 gi|71773017|gb|DR970936.1|DR970936 ZM_BFb0093G17.f ZM_BFb Zea ma... 46 0.007 gi|74234782|gb|DT642696.1|DT642696 ZM_BFb0101F12.f ZM_BFb Zea ma... 46 0.007 gi|76012975|gb|DT940145.1|DT940145 ZM_BFb0122N08.f ZM_BFb Zea ma... 46 0.007 gi|76017954|gb|DT945124.1|DT945124 ZM_BFb0132D08.f ZM_BFb Zea ma... 46 0.007 gi|76020804|gb|DT947974.1|DT947974 ZM_BFb0136I06.f ZM_BFb Zea ma... 46 0.007 gi|76021455|gb|DT948625.1|DT948625 ZM_BFb0137I18.f ZM_BFb Zea ma... 46 0.007 gi|76928328|gb|DV171581.1|DV171581 ZM_BFb0172C16.f ZM_BFb Zea ma... 46 0.007 gi|76929838|gb|DV172186.1|DV172186 ZM_BFb0173I10.f ZM_BFb Zea ma... 46 0.007 gi|76912324|gb|DV164675.1|DV164675 ZM_BFb0161E01.f ZM_BFb Zea ma... 46 0.007 gi|76923368|gb|DV169452.1|DV169452 ZM_BFb0168I22.f ZM_BFb Zea ma... 46 0.007 gi|76926324|gb|DV170809.1|DV170809 ZM_BFb0170K12.r ZM_BFb Zea ma... 46 0.007 gi|78023613|gb|DV492000.1|DV492000 1000088-G03.T7-1 UGI-Reseq Ze... 46 0.007 gi|78024408|gb|DV492795.1|DV492795 1000088-F03.T7-1 UGI-Reseq Ze... 46 0.007 gi|78075901|gb|DV504335.1|DV504335 ZM_BFb0181C17.f ZM_BFb Zea ma... 46 0.007 gi|78078000|gb|DV506415.1|DV506415 ZM_BFb0184C09.f ZM_BFb Zea ma... 46 0.007 gi|78110789|gb|DV529187.1|DV529187 ZM_BFb0217P11.f ZM_BFb Zea ma... 46 0.007 gi|78112253|gb|DV530647.1|DV530647 ZM_BFb0220I03.f ZM_BFb Zea ma... 46 0.007 gi|78115426|gb|DV533814.1|DV533814 ZM_BFb0225B10.f ZM_BFb Zea ma... 46 0.007 gi|78116396|gb|DV534783.1|DV534783 ZM_BFb0226I11.f ZM_BFb Zea ma... 46 0.007 gi|84969887|gb|DW468293.1|DW468293 ZM_BFb0170K12.f ZM_BFb Zea ma... 46 0.007 gi|86465700|gb|DY232073.1|DY232073 ZM_BFb0241B10.f ZM_BFb Zea ma... 46 0.007 gi|86473170|gb|DY239540.1|DY239540 ZM_BFb0258E08.f ZM_BFb Zea ma... 46 0.007 gi|88756163|gb|DY540304.1|DY540304 ZM_BFb0355I21.f ZM_BFb Zea ma... 46 0.007 gi|89252737|gb|DY624523.1|DY624523 ZM_BFb0318L09.f ZM_BFb Zea ma... 46 0.007 gi|89763696|gb|DY690785.1|DY690785 ZM_BFb0290D10.f ZM_BFb Zea ma... 46 0.007 gi|89764314|gb|DY691167.1|DY691167 ZM_BFb0290N07.f ZM_BFb Zea ma... 46 0.007 gi|91049791|gb|EB160209.1|EB160209 ZM_BFb0296O16.r ZM_BFb Zea ma... 46 0.007 gi|91052199|gb|EB162617.1|EB162617 ZM_BFb0303C16.f ZM_BFb Zea ma... 46 0.007 gi|91056662|gb|EB167080.1|EB167080 ZM_BFb0377K10.f ZM_BFb Zea ma... 46 0.007 gi|91871900|gb|EB401857.1|EB401857 ZM_BFb0308D07.f ZM_BFb Zea ma... 46 0.007 gi|21210129|gb|AY107051.1| Zea mays PCO135033 mRNA sequence 46 0.007 gi|21210129|gb|AY107051.1| Zea mays PCO135033 mRNA sequence 46 0.007 gi|12046721|gb|BF728860.1|BF728860 1000068C08.x2 1000 - Unigene ... 44 0.026 gi|32809982|gb|CD962216.1|CD962216 SDN_137 GeneTag2 Zea mays cDN... 44 0.026 gi|32923346|gb|CF028158.1|CF028158 QCB6d08.yg QCB Zea mays cDNA ... 44 0.026 gi|7009393|gb|AW455658.1|AW455658 707087D05.x1 707 - Mixed adult... 40 0.40 gi|16925444|gb|BM078512.1|BM078512 MEST120-F05.T3 ISUM4-TN Zea m... 40 0.40 gi|37419128|gb|CF647240.1|CF647240 3530_1_41_1_C02.x_1 3530 - Fu... 40 0.40 gi|40303352|gb|CK347739.1|CK347739 zmrsub1_0B10-005-a03.s3 zmrsu... 40 0.40 gi|71432373|gb|DR813423.1|DR813423 ZM_BFb0042J13.f ZM_BFb Zea ma... 40 0.40 gi|71441614|gb|DR822664.1|DR822664 ZM_BFb0062P22.f ZM_BFb Zea ma... 40 0.40 gi|71759552|gb|DR957489.1|DR957489 ZM_BFb0056L24.f ZM_BFb Zea ma... 40 0.40 gi|71760768|gb|DR958705.1|DR958705 ZM_BFb0061M18.f ZM_BFb Zea ma... 40 0.40 gi|71762566|gb|DR960503.1|DR960503 ZM_BFb0075C16.f ZM_BFb Zea ma... 40 0.40 gi|71771239|gb|DR969176.1|DR969176 ZM_BFb0090M21.f ZM_BFb Zea ma... 40 0.40 gi|74236007|gb|DT643921.1|DT643921 ZM_BFb0103C12.r ZM_BFb Zea ma... 40 0.40 gi|74240417|gb|DT648331.1|DT648331 ZM_BFb0109M06.f ZM_BFb Zea ma... 40 0.40 gi|76293119|gb|DV032687.1|DV032687 ZM_BFb0156J04.f ZM_BFb Zea ma... 40 0.40 gi|76294322|gb|DV033890.1|DV033890 ZM_BFb0158K01.r ZM_BFb Zea ma... 40 0.40 gi|76929419|gb|DV172008.1|DV172008 ZM_BFb0173C10.f ZM_BFb Zea ma... 40 0.40 gi|78081760|gb|DV510172.1|DV510172 ZM_BFb0189K19.f ZM_BFb Zea ma... 40 0.40 gi|78089354|gb|DV517728.1|DV517728 ZM_BFb0201G05.f ZM_BFb Zea ma... 40 0.40 gi|88746043|gb|DY530184.1|DY530184 ZM_BFb0248C11.r ZM_BFb Zea ma... 40 0.40 gi|88753311|gb|DY537452.1|DY537452 ZM_BFb0273D15.f ZM_BFb Zea ma... 40 0.40 gi|88758346|gb|DY542715.1|DY542715 III-952-2A-F05.M13-R UGIII-Re... 40 0.40 gi|93013622|gb|EB639142.1|EB639142 ZM_BFb0326L19.f ZM_BFb Zea ma... 40 0.40 gi|93015095|gb|EB640615.1|EB640615 ZM_BFb0329K07.f ZM_BFb Zea ma... 40 0.40 gi|45670167|gb|BV130644.1| PZA00586 Zea mays ssp. parviglumis Wi... 40 0.40 gi|45670166|gb|BV130643.1| PZA00586 Zea mays ssp. parviglumis Be... 40 0.40 gi|45670165|gb|BV130642.1| PZA00586 Zea mays ssp. parviglumis Ka... 40 0.40 gi|45670164|gb|BV130641.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670163|gb|BV130640.1| PZA00586 Zea mays ssp. parviglumis US... 40 0.40 gi|45670162|gb|BV130639.1| PZA00586 Zea mays ssp. parviglumis CI... 40 0.40 gi|45670161|gb|BV130638.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670160|gb|BV130637.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670159|gb|BV130636.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670158|gb|BV130635.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670156|gb|BV130633.1| PZA00586 Zea mays ssp. parviglumis CI... 40 0.40 gi|45670155|gb|BV130632.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670154|gb|BV130631.1| PZA00586 Zea mays ssp. parviglumis JS... 40 0.40 gi|45670153|gb|BV130630.1| PZA00586 Zea mays ssp. mays CML69 Zea... 40 0.40 gi|45670152|gb|BV130629.1| PZA00586 Zea mays ssp. mays CML322 Ze... 40 0.40 gi|45670151|gb|BV130628.1| PZA00586 Zea mays ssp. mays CML333 Ze... 40 0.40 gi|45670150|gb|BV130627.1| PZA00586 Zea mays ssp. mays Kul11 Zea... 40 0.40 gi|45670149|gb|BV130626.1| PZA00586 Zea mays ssp. mays Kul3 Zea ... 40 0.40 gi|45670148|gb|BV130625.1| PZA00586 Zea mays ssp. mays NC350 Zea... 40 0.40 gi|45670147|gb|BV130624.1| PZA00586 Zea mays ssp. mays CML247 Ze... 40 0.40 gi|45670146|gb|BV130623.1| PZA00586 Zea mays ssp. mays Hp301 Zea... 40 0.40 gi|45670145|gb|BV130622.1| PZA00586 Zea mays ssp. mays Ky21 Zea ... 40 0.40 gi|45670144|gb|BV130621.1| PZA00586 Zea mays ssp. mays Mo17(2) Z... 40 0.40 gi|45670143|gb|BV130620.1| PZA00586 Zea mays ssp. mays Mo17(1) Z... 40 0.40 gi|45670142|gb|BV130619.1| PZA00586 Zea mays ssp. mays Il14H Zea... 40 0.40 gi|45670141|gb|BV130618.1| PZA00586 Zea mays ssp. mays Oh43 Zea ... 40 0.40 gi|45670140|gb|BV130617.1| PZA00586 Zea mays ssp. mays B73(2) Ze... 40 0.40 gi|45670139|gb|BV130616.1| PZA00586 Zea mays ssp. mays B73(1) Ze... 40 0.40 gi|5030475|gb|AI714669.1|AI714669 606017A01.x2 606 - Ear tissue ... 38 1.6 gi|5670921|gb|AI932184.1|AI932184 618029D06.x1 618 - Inbred Tass... 38 1.6 gi|6342740|gb|AW165564.1|AW165564 618048F04.x1 618 - Inbred Tass... 38 1.6 gi|6827612|gb|AW331255.1|AW331255 707050E06.x1 707 - Mixed adult... 38 1.6 gi|6851497|gb|AW352507.1|AW352507 707050E06.y1 707 - Mixed adult... 38 1.6 gi|7304420|gb|AW600359.1|AW600359 660066D05.x1 660 - Mixed stage... 38 1.6 gi|8930262|gb|BE225026.1|BE225026 945042H12.x2 945 - Mixed adult... 38 1.6 gi|9461663|gb|BE453843.1|BE453843 946047B10.x1 946 - tassel prim... 38 1.6 gi|9566158|gb|BE475667.1|BE475667 946047B10.x2 946 - tassel prim... 38 1.6 gi|14548501|gb|BI096845.1|BI096845 949015H09.y1 949 - Juvenile l... 38 1.6 gi|16377371|gb|BI991889.1|BI991889 1020053C05.x1 1020 - Unigene ... 38 1.6 gi|18176894|gb|BM378104.1|BM378104 MEST351-G04.T3 ISUM5-RN Zea m... 38 1.6 gi|18176926|gb|BM378136.1|BM378136 MEST166-A08.T3 ISUM5-RN Zea m... 38 1.6 gi|18176959|gb|BM378169.1|BM378169 MEST207-H02.T3 ISUM5-RN Zea m... 38 1.6 gi|18176997|gb|BM378207.1|BM378207 MEST266-F11.T3 ISUM5-RN Zea m... 38 1.6 gi|18177068|gb|BM378278.1|BM378278 MEST377-H10.T3 ISUM5-RN Zea m... 38 1.6 gi|21891752|gb|BQ744965.1|BQ744965 946112F09.y1 946 - tassel pri... 38 1.6 gi|22542175|gb|BU092613.1|BU092613 946154G05.y1 946 - tassel pri... 38 1.6 gi|22545663|gb|BU098022.1|BU098022 946123C07.y1 946 - tassel pri... 38 1.6 gi|28188214|gb|CB179824.1|CB179824 EST0929 Zea mays sperm cell c... 38 1.6 gi|28422669|gb|CB251958.1|CB251958 3529_1_19_1_A09.x_1 3529 - 2 ... 38 1.6 gi|30052186|gb|AI065475.2|AI065475 af84a03.s1 maize inflorescenc... 38 1.6 gi|30088166|gb|CB886371.1|CB886371 3529_1_94_1_G08.x_1 3529 - 2 ... 38 1.6 gi|32826553|gb|CD966231.1|CD966231 SEN_250 GeneTag2 Zea mays cDN... 38 1.6 gi|32926037|gb|CF030849.1|CF030849 QCD27c04.yg QCD Zea mays cDNA... 38 1.6 gi|37384410|gb|CF629274.1|CF629274 zmrws48_0A10-015-d05.s4 zmrws... 38 1.6 gi|37385655|gb|CF629981.1|CF629981 zmrws48_0A20-007-e10.s4 zmrws... 38 1.6 gi|37397922|gb|CF636269.1|CF636269 zmrww00_0B10-006-g08.s4 zmrww... 38 1.6 gi|45847336|gb|CN071279.1|CN071279 1021010C08.x1 1021 - Unigene ... 38 1.6 gi|50322876|gb|CO518002.1|CO518002 3530_1_117_1_C08.x_1 3530 - F... 38 1.6 gi|50325494|gb|CO520620.1|CO520620 3530_1_136_1_B10.x_1 3530 - F... 38 1.6 gi|50328832|gb|CO523958.1|CO523958 3530_1_158_1_D11.x_1 3530 - F... 38 1.6 gi|60340375|gb|DN207348.1|DN207348 MEST847_G06.T7-1 UGA-ZmSAM-XZ... 38 1.6 gi|60343479|gb|DN210452.1|DN210452 MEST898_F05.T7-1 UGA-ZmSAM-XZ... 38 1.6 gi|60396353|gb|DN229222.1|DN229222 MEST1012_F06.T7-1 UGA-ZmSAM-X... 38 1.6 gi|60399653|gb|DN232463.1|DN232463 MEST1180_A12.T7-1 UGA-ZmSAM-X... 38 1.6 gi|71305342|gb|DR788804.1|DR788804 ZM_BFb0006P17.f ZM_BFb Zea ma... 38 1.6 gi|71310784|gb|DR791689.1|DR791689 ZM_BFb0011E08.f ZM_BFb Zea ma... 38 1.6 gi|71317229|gb|DR795302.1|DR795302 ZM_BFb0016G13.f ZM_BFb Zea ma... 38 1.6 gi|71444754|gb|DR825804.1|DR825804 ZM_BFb0068E15.r ZM_BFb Zea ma... 38 1.6 gi|71756667|gb|DR954604.1|DR954604 ZM_BFb0047C24.f ZM_BFb Zea ma... 38 1.6 gi|76021470|gb|DT948640.1|DT948640 ZM_BFb0137J02.r ZM_BFb Zea ma... 38 1.6 gi|76293912|gb|DV033480.1|DV033480 ZM_BFb0157L17.f ZM_BFb Zea ma... 38 1.6 gi|78023537|gb|DV491924.1|DV491924 1000084-F04.T7-1 UGI-Reseq Ze... 38 1.6 gi|78076917|gb|DV505351.1|DV505351 ZM_BFb0182K08.f ZM_BFb Zea ma... 38 1.6 gi|78077882|gb|DV506307.1|DV506307 ZM_BFb0183P18.f ZM_BFb Zea ma... 38 1.6 gi|78079774|gb|DV508186.1|DV508186 ZM_BFb0186K23.f ZM_BFb Zea ma... 38 1.6 gi|78083637|gb|DV512030.1|DV512030 ZM_BFb0192I04.f ZM_BFb Zea ma... 38 1.6 gi|78104230|gb|DV522648.1|DV522648 ZM_BFb0208I07.f ZM_BFb Zea ma... 38 1.6 gi|78107505|gb|DV525923.1|DV525923 ZM_BFb0213F09.f ZM_BFb Zea ma... 38 1.6 gi|78109546|gb|DV527962.1|DV527962 ZM_BFb0216D20.f ZM_BFb Zea ma... 38 1.6 gi|86471189|gb|DY237559.1|DY237559 ZM_BFb0254M07.f ZM_BFb Zea ma... 38 1.6 gi|88746976|gb|DY531117.1|DY531117 ZM_BFb0249L18.f ZM_BFb Zea ma... 38 1.6 gi|89755580|gb|DY685952.1|DY685952 ZM_BFb0272L14.r ZM_BFb Zea ma... 38 1.6 gi|89758039|gb|DY687382.1|DY687382 ZM_BFb0276P17.f ZM_BFb Zea ma... 38 1.6 gi|91049445|gb|EB159863.1|EB159863 ZM_BFb0296F17.f ZM_BFb Zea ma... 38 1.6 gi|91870858|gb|EB401118.1|EB401118 ZM_BFb0306O24.f ZM_BFb Zea ma... 38 1.6 gi|93014322|gb|EB639842.1|EB639842 ZM_BFb0328B13.f ZM_BFb Zea ma... 38 1.6 gi|550437|emb|X81829.1|ZMCYP71C2 Z.mays CYP71C2 mRNA for cytochr... 38 1.6 gi|21209185|gb|AY106107.1| Zea mays PCO065952 mRNA sequence 38 1.6 gi|21213255|gb|AY109508.1| Zea mays CL1574_1 mRNA sequence 38 1.6 gi|1870200|emb|Y11404.1|ZMCI31AC2 Z.mays cyp71c2 gene 38 1.6 gi|550437|emb|X81829.1|ZMCYP71C2 Z.mays CYP71C2 mRNA for cytochr... 38 1.6 gi|45677112|gb|BV137589.1| PZA00115 Zea mays ssp. mays M37W Zea ... 38 1.6 gi|45670157|gb|BV130634.1| PZA00586 Zea mays ssp. parviglumis JS... 38 1.6 gi|45664144|gb|BV124621.1| PZA00700 Zea mays ssp. parviglumis Ka... 38 1.6 gi|45664142|gb|BV124619.1| PZA00700 Zea mays ssp. parviglumis JS... 38 1.6 gi|45664141|gb|BV124618.1| PZA00700 Zea mays ssp. parviglumis US... 38 1.6 gi|45664140|gb|BV124617.1| PZA00700 Zea mays ssp. parviglumis CI... 38 1.6 gi|45664133|gb|BV124610.1| PZA00700 Zea mays ssp. parviglumis JS... 38 1.6 gi|45664132|gb|BV124609.1| PZA00700 Zea mays ssp. mays CML69 Zea... 38 1.6 gi|45664130|gb|BV124607.1| PZA00700 Zea mays ssp. mays Kul11 Zea... 38 1.6 gi|45664129|gb|BV124606.1| PZA00700 Zea mays ssp. mays Kul3 Zea ... 38 1.6 gi|45664128|gb|BV124605.1| PZA00700 Zea mays ssp. mays NC350 Zea... 38 1.6 gi|45664127|gb|BV124604.1| PZA00700 Zea mays ssp. mays Hp301 Zea... 38 1.6 gi|45664126|gb|BV124603.1| PZA00700 Zea mays ssp. mays M37W Zea ... 38 1.6 gi|45664125|gb|BV124602.1| PZA00700 Zea mays ssp. mays Ky21 Zea ... 38 1.6 gi|45664124|gb|BV124601.1| PZA00700 Zea mays ssp. mays Mo17(2) Z... 38 1.6 gi|45664123|gb|BV124600.1| PZA00700 Zea mays ssp. mays Mo17(1) Z... 38 1.6 gi|45664122|gb|BV124599.1| PZA00700 Zea mays ssp. mays B73(2) Ze... 38 1.6 gi|22603392|dbj|BD057786.1| Cytochrome P450 Monooxygenases 38 1.6 gi|21213255|gb|AY109508.1| Zea mays CL1574_1 mRNA sequence 38 1.6 gi|21209185|gb|AY106107.1| Zea mays PCO065952 mRNA sequence 38 1.6 gi|92900020|gb|AC185438.1| Zea mays chromosome 4 clone CH201-461... 38 1.6 gi|91206514|gb|AC184862.1| Zea mays chromosome UNK clone CH201-1... 38 1.6 gi|55975247|gb|AC152918.1| Zea mays chromosome 4 clone Z464F01 m... 38 1.6 gi|41014699|gb|AC146950.2| Zea mays clone ZMMBBc0464F01, *** SEQ... 38 1.6 gi|4314837|gb|AI438892.2|AI438892 486014D09.x2 486 - leaf primor... 36 6.3 gi|4314838|gb|AI438893.2|AI438893 486014D10.x2 486 - leaf primor... 36 6.3 gi|5555549|gb|AI881500.1|AI881500 606069H06.y1 606 - Ear tissue ... 36 6.3 gi|6166608|gb|AW144872.1|AW144872 707013B11.y2 707 - Mixed adult... 36 6.3 gi|6760619|gb|AW324718.1|AW324718 707041F04.x4 707 - Mixed adult... 36 6.3 gi|6827256|gb|AW330899.1|AW330899 707023D12.x3 707 - Mixed adult... 36 6.3 gi|6827313|gb|AW330956.1|AW330956 707030F10.x2 707 - Mixed adult... 36 6.3 gi|6827789|gb|AW331432.1|AW331432 707013B11.y4 707 - Mixed adult... 36 6.3 gi|6918501|gb|AW400031.1|AW400031 707060C03.x1 707 - Mixed adult... 36 6.3 gi|6918686|gb|AW400216.1|AW400216 707054G01.y1 707 - Mixed adult... 36 6.3 gi|6952423|gb|AW424491.1|AW424491 707016D06.y1 707 - Mixed adult... 36 6.3 gi|8318748|gb|BE025313.1|BE025313 945028C08.y2 945 - Mixed adult... 36 6.3 gi|8665777|gb|BE186593.1|BE186593 946009A01.X1 946 - tassel prim... 36 6.3 gi|9953735|gb|BE640318.1|BE640318 946083D07.x1 946 - tassel prim... 36 6.3 gi|12972663|gb|BG268094.1|BG268094 1000164A05.x4 1000 - Unigene ... 36 6.3 gi|14202673|gb|BG836350.1|BG836350 Zm06_01d01_R Zm06_AAFC_ECORC_... 36 6.3 gi|14242895|gb|BG840275.2|BG840275 MEST11-B09.T7-1 ISUM4-TN Zea ... 36 6.3 gi|14243095|gb|BG840729.2|BG840729 MEST11-B09.T3 ISUM4-TN Zea ma... 36 6.3 gi|15057133|gb|BI361105.1|BI361105 949055F02.x3 949 - Juvenile l... 36 6.3 gi|15057243|gb|BI361215.1|BI361215 949057F02.x2 949 - Juvenile l... 36 6.3 gi|16926461|gb|BM079529.1|BM079529 MEST95-H01.T3 ISUM4-TN Zea ma... 36 6.3 gi|18178539|gb|BM379749.1|BM379749 MEST510-A04.univ ISUM6 Zea ma... 36 6.3 gi|21329816|gb|BQ485197.1|BQ485197 3524_1_11_1_E12.y_1 3524 - Ma... 36 6.3 gi|21331061|gb|BQ486442.1|BQ486442 3524_1_31_1_D11.y_1 3524 - Ma... 36 6.3 gi|21390462|gb|BQ528511.1|BQ528511 3524_1_33_1_B07.y_1 3524 - Ma... 36 6.3 gi|21481068|gb|BQ577751.1|BQ577751 3524_1_41_1_G12.y_1 3524 - Ma... 36 6.3 gi|21481394|gb|BQ578077.1|BQ578077 3524_1_52_1_G06.y_1 3524 - Ma... 36 6.3 gi|21759831|gb|BQ635372.1|BQ635372 1091069E12.x1 1091 - Immature... 36 6.3 gi|22818817|gb|BU498907.1|BU498907 946170G03.x1 946 - tassel pri... 36 6.3 gi|26455165|gb|CA826748.1|CA826748 1114004D07.y1 1114 - Unigene ... 36 6.3 gi|26455346|gb|CA826929.1|CA826929 1114007B08.y1 1114 - Unigene ... 36 6.3 gi|28566524|gb|CB278172.1|CB278172 EST1075 Zea mays sperm cell c... 36 6.3 gi|28566526|gb|CB278174.1|CB278174 EST1077 Zea mays sperm cell c... 36 6.3 gi|30307093|gb|CD001766.1|CD001766 3529_1_104_1_A02.x_1 3529 - 2... 36 6.3 gi|30591548|gb|CD052429.1|CD052429 EST1688 Zea mays sperm cell c... 36 6.3 gi|30591570|gb|CD052440.1|CD052440 EST1699 Zea mays sperm cell c... 36 6.3 gi|29130603|gb|CB381307.1|CB381307 3529_1_45_1_F09.y_1 3529 - 2 ... 36 6.3 gi|31250351|gb|CD219375.1|CD219375 EST0272 Zea mays embryo sac c... 36 6.3 gi|31364322|gb|CD448677.1|CD448677 EK07D2305A10.b Endosperm_6 Ze... 36 6.3 gi|31364403|gb|CD448758.1|CD448758 EK07D2309B08.b Endosperm_6 Ze... 36 6.3 gi|31664336|gb|CD573061.1|CD573061 3529_1_126_1_C12.x_1 3529 - 2... 36 6.3 gi|31664337|gb|CD573062.1|CD573062 3529_1_126_1_C12.y_1 3529 - 2... 36 6.3 gi|31664384|gb|CD573109.1|CD573109 3529_1_126_1_F06.x_1 3529 - 2... 36 6.3 gi|32164874|gb|CD670192.1|CD670192 3529_1_128_1_G04.x_1 3529 - 2... 36 6.3 gi|32871104|gb|CF010786.1|CF010786 QBJ4b03.pg QBJ Zea mays cDNA ... 36 6.3 gi|32871105|gb|CF010787.1|CF010787 QBJ4b03.xg QBJ Zea mays cDNA ... 36 6.3 gi|32920460|gb|CF025272.1|CF025272 QCA14f02.yg QCA Zea mays cDNA... 36 6.3 gi|32922730|gb|CF027542.1|CF027542 QCB22c02.yg QCB Zea mays cDNA... 36 6.3 gi|32923153|gb|CF027965.1|CF027965 QCB3g11.yg QCB Zea mays cDNA ... 36 6.3 gi|32923181|gb|CF027993.1|CF027993 QCB4c01.yg QCB Zea mays cDNA ... 36 6.3 gi|33770681|gb|CF272975.1|CF272975 EST2537 Zea mays sperm cell c... 36 6.3 gi|33770812|gb|CF273106.1|CF273106 EST2668 Zea mays sperm cell c... 36 6.3 gi|37361426|gb|CF602715.1|CF602715 EST3788 Zea mays sperm cell c... 36 6.3 gi|37395341|gb|CF634950.1|CF634950 zmrww00_0A20-004-h05.s1 zmrww... 36 6.3 gi|37396479|gb|CF635530.1|CF635530 zmrww00_0A20-011-e11.s3 zmrww... 36 6.3 gi|40302900|gb|CK347287.1|CK347287 zmrsub1_0A20-003-a01.s3 zmrsu... 36 6.3 gi|50325591|gb|CO520717.1|CO520717 3530_1_136_1_H02.y_1 3530 - F... 36 6.3 gi|50326690|gb|CO521816.1|CO521816 3530_1_144_1_A07.x_1 3530 - F... 36 6.3 gi|50326691|gb|CO521817.1|CO521817 3530_1_144_1_A07.y_1 3530 - F... 36 6.3 gi|50326713|gb|CO521839.1|CO521839 3530_1_144_1_B07.x_1 3530 - F... 36 6.3 gi|50326714|gb|CO521840.1|CO521840 3530_1_144_1_B07.y_1 3530 - F... 36 6.3 gi|60350502|gb|DN217475.1|DN217475 MEST1051_D10.T7-1 UGA-ZmSAM-X... 36 6.3 gi|67015598|gb|CO444347.1|CO444347 MZCCL10070D09.g Maize Endospe... 36 6.3 gi|67019651|gb|CO448400.1|CO448400 MZCCL10126B02.g Maize Endospe... 36 6.3 gi|67020785|gb|CO449534.1|CO449534 MZCCL10133H02.g Maize Endospe... 36 6.3 gi|67024636|gb|CO453385.1|CO453385 MZCCL10189H11.g Maize Endospe... 36 6.3 gi|67028645|gb|CO457394.1|CO457394 MZCCS15008F03.g Maize Endospe... 36 6.3 gi|67033730|gb|CO462479.1|CO462479 MZCCS15027E06.g Maize Endospe... 36 6.3 gi|69351212|gb|DR452058.1|DR452058 E0134 Zea mays egg cell cDNA ... 36 6.3 gi|71436880|gb|DR817930.1|DR817930 ZM_BFb0052A20.r ZM_BFb Zea ma... 36 6.3 gi|74236006|gb|DT643920.1|DT643920 ZM_BFb0103C12.f ZM_BFb Zea ma... 36 6.3 gi|74241235|gb|DT649149.1|DT649149 ZM_BFb0111H16.r ZM_BFb Zea ma... 36 6.3 gi|74241485|gb|DT649399.1|DT649399 ZM_BFb0112B11.f ZM_BFb Zea ma... 36 6.3 gi|74241486|gb|DT649400.1|DT649400 ZM_BFb0112B11.r ZM_BFb Zea ma... 36 6.3 gi|76288809|gb|DV028377.1|DV028377 ZM_BFb0150F08.r ZM_BFb Zea ma... 36 6.3 gi|78081218|gb|DV509630.1|DV509630 ZM_BFb0188N16.f ZM_BFb Zea ma... 36 6.3 gi|78081219|gb|DV509631.1|DV509631 ZM_BFb0188N16.r ZM_BFb Zea ma... 36 6.3 gi|78103746|gb|DV522174.1|DV522174 ZM_BFb0207M16.f ZM_BFb Zea ma... 36 6.3 gi|78103747|gb|DV522175.1|DV522175 ZM_BFb0207M16.r ZM_BFb Zea ma... 36 6.3 gi|78179129|gb|DV549502.1|DV549502 1000058-D11.GAD10-F UGI-Reseq... 36 6.3 gi|78179528|gb|DV549901.1|DV549901 1000066-A06.GAD10-F UGI-Reseq... 36 6.3 gi|84979987|gb|DW530336.1|DW530336 ZMEC_03D06 ZmEC Zea mays cDNA... 36 6.3 gi|87154251|gb|DY399040.1|DY399040 IV-3524-2D-B08.T3 UGIV-3524-R... 36 6.3 gi|88748842|gb|DY532983.1|DY532983 ZM_BFb0263G11.f ZM_BFb Zea ma... 36 6.3 gi|88748843|gb|DY532984.1|DY532984 ZM_BFb0263G11.r ZM_BFb Zea ma... 36 6.3 gi|89759155|gb|DY688062.1|DY688062 ZM_BFb0282A13.f ZM_BFb Zea ma... 36 6.3 gi|91874082|gb|EB404039.1|EB404039 ZM_BFb0313A02.f ZM_BFb Zea ma... 36 6.3 gi|91875009|gb|EB404966.1|EB404966 ZM_BFb0314J22.f ZM_BFb Zea ma... 36 6.3 gi|92088005|gb|EB484236.1|EB484236 E4260 Zea mays egg cell cDNA ... 36 6.3 gi|54651778|gb|BT016997.1| Zea mays clone EK07D2309B08.c mRNA se... 36 6.3 gi|21212440|gb|AY109054.1| Zea mays PCO116163 mRNA sequence 36 6.3 gi|21213342|gb|AY109572.1| Zea mays CL1008_1 mRNA sequence 36 6.3 gi|21213396|gb|AY109609.1| Zea mays CL8480_1 mRNA sequence 36 6.3 gi|21216856|gb|AY112266.1| Zea mays CL5157_1 mRNA sequence 36 6.3 gi|47098807|gb|BV149350.1| PZA01957-69372-W22_R-scm2 Zea mays W2... 36 6.3 gi|47098806|gb|BV149349.1| PZA01957-69360-Tx501 Zea mays Tx501 Z... 36 6.3 gi|47098805|gb|BV149348.1| PZA01957-69370-Tx303 Zea mays Tx303 Z... 36 6.3 gi|47098804|gb|BV149347.1| PZA01957-69369-T218 Zea mays T218 Zea... 36 6.3 gi|47098803|gb|BV149346.1| PZA01957-69371-NC7A Zea mays NC7A Zea... 36 6.3 gi|47098802|gb|BV149345.1| PZA01957-69359-Mp708 Zea mays Mp708 Z... 36 6.3 gi|47098801|gb|BV149344.1| PZA01957-69368-Mo17 Zea mays Mo17 Zea... 36 6.3 gi|47098799|gb|BV149342.1| PZA01957-69361-IHO Zea mays IHO Zea m... 36 6.3 gi|47098798|gb|BV149341.1| PZA01957-69357-GT119 Zea mays GT119 Z... 36 6.3 gi|47098797|gb|BV149340.1| PZA01957-69358-CO159 Zea mays CO159 Z... 36 6.3 gi|47098796|gb|BV149339.1| PZA01957-69356-B73 Zea mays B73 Zea m... 36 6.3 gi|54651778|gb|BT016997.1| Zea mays clone EK07D2309B08.c mRNA se... 36 6.3 gi|22606676|dbj|BD061070.1| Secreted expressed sequence tags (sE... 36 6.3 gi|21216856|gb|AY112266.1| Zea mays CL5157_1 mRNA sequence 36 6.3 gi|21213396|gb|AY109609.1| Zea mays CL8480_1 mRNA sequence 36 6.3 gi|21213342|gb|AY109572.1| Zea mays CL1008_1 mRNA sequence 36 6.3 gi|21212440|gb|AY109054.1| Zea mays PCO116163 mRNA sequence 36 6.3 gi|58082263|gb|AC155401.2| Zea mays strain B73 clone ZMMBBb0171M... 36 6.3 >gi|78180651|gb|DV550979.1|DV550979 1000053-A01.GAD10-F UGI-Reseq Zea mays cDNA, mRNA sequence Length = 655 Score = 1180 bits (595), Expect = 0.0 Identities = 615/619 (99%), Gaps = 2/619 (0%) Strand = Plus / Plus Query: 1 gaaaatttgatagcttcaccgtacccacatatttacgataccg-gcacacccattacata 59 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 38 gaaaatttgatagcttcaccgtacccacatatttacgataccgtgcacacccattacata 97 Query: 60 cgtaaccgcaggtatacatattcacgataagattgtcatcgctacataaaaagacataaa 119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 98 cgtaaccgcaggtatacatattcacgataagattgtcatcgctacataaaaagacataaa 157 Query: 120 attagaggctgtgtcctcctttgaaagccttcaacaggtaggtccataatgtagatgggc 179 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 158 attagaggttgtgtcctcctttgaaagccttcaacaggtaggtccataatgtagatgggc 217 Query: 180 tttggacctatcgttcttaaactactagcttatagtaggccatagtggggaaacgagtca 239 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 218 tt-ggacctatcgttcttaaactactagcttatagtaggccatagtggggaaacgagtca 276 Query: 240 acgacacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagct 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 277 acgacacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagct 336 Query: 300 tgtcgatcacgtgaattcacacggcgattagacaccgggaacagggaggcgcacgcggag 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 337 tgtcgatcacgtgaattcacacggcgattagacaccgggaacagggaggcgcacgcggag 396 Query: 360 gatggggcggagtagcaggtcggccttccgtctcgcggtgatgccaaacgcctcggccat 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 397 gatggggcggagtagcaggtcggccttccgtctcgcggtgatgccaaacgcctcggccat 456 Query: 420 gtcgaactcggcggggtcagacacgccgggcgcctcccagtcgaagtggaacagaaggct 479 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 457 gtcgaactcggcggggtcagacacgccgggcgcctcccagtcgaagtggaacaaaaggct 516 Query: 480 ggcgagcgcgagctcgacgttggcgagcccgaacgccatgcccggacacatcctccggcc 539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 517 ggcgagcgcgagctcgacgttggcgagcccgaacgccatgcccggacacatcctccggcc 576 Query: 540 ggcgccgaacggcaggagctcgaagtcggcgcccttgaactccaccgcgctggcctcggc 599 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 577 ggcgccgaacggcaggagctcgaagtcggcgcccttgaactccaccgcgctggcctcggc 636 Query: 600 ctcgaaccgctcggggcgg 618 ||||||||||||||||||| Sbjct: 637 ctcgaaccgctcggggcgg 655 >gi|6696038|gb|AW289146.1|AW289146 707010B03.y3 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 544 Score = 1059 bits (534), Expect = 0.0 Identities = 541/544 (99%) Strand = Plus / Minus Query: 207 gcttatagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgc 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 544 gcttatagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgc 485 Query: 267 tcgccggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcga 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 484 tcgccggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcga 425 Query: 327 ttagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggcctt 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 424 ttagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggcctt 365 Query: 387 ccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgcc 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 364 ccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgcc 305 Query: 447 gggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgag 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 304 gggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgag 245 Query: 507 cccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtc 566 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 244 cccgaacgccatgnccggacacatcctccggccggcgccgaacggcaggagctcgaagtc 185 Query: 567 ggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcggggcggaactcctc 626 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 184 ggcgcccttgaactccnccgcgctggcctcggcctcgaaccgctcggggcggaactcctc 125 Query: 627 ggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccagcacggt 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 124 ggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccagcacggt 65 Query: 687 ggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggactgccgcgggag 746 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 64 ggtgcccgcaggcacgtcgtagcccagcacgcggcgcggctcctgggactgccgcgggag 5 Query: 747 cagc 750 |||| Sbjct: 4 cagc 1 >gi|12058149|gb|BF733060.1|BF733060 1000053A01.x2 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 458 Score = 868 bits (438), Expect = 0.0 Identities = 453/458 (98%) Strand = Plus / Plus Query: 1 gaaaatttgatagcttcaccgtacccacatatttacgataccggcacacccattacatac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gaaaatttgatagcttcaccgtacccacatatttacgataccggcacacccattacatac 60 Query: 61 gtaaccgcaggtatacatattcacgataagattgtcatcgctacataaaaagacataaaa 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 gtaaccgcaggtatacatattcacgataagattgtcatcgctacataaaaagacataaaa 120 Query: 121 ttagaggctgtgtcctcctttgaaagccttcaacaggtaggtccataatgtagatgggct 180 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 121 ttagaggttgtgtcctcctttgaaagccttcaacaggtaggtccataatgtagatgtttt 180 Query: 181 ttggacctatcgttcttaaactactagcttatagtaggccatagtggggaaacgagtcaa 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ttggacctatcgttcttaaactactagcttatagtaggccatagtggggaaacgagtcaa 240 Query: 241 cgacacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagctt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 cgacacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagctt 300 Query: 301 gtcgatcacgtgaattcacacggcgattagacaccgggaacagggaggcgcacgcggagg 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 gtcgatcacgtgaattcacacggcgattagacaccgggaacagggaggcgcacgcggagg 360 Query: 361 atggggcggagtagcaggtcggccttccgtctcgcggtgatgccaaacgcctcggccatg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 atggggcggagtagcaggtcggccttccgtctcgcggtgatgccaaacgcctcggccatg 420 Query: 421 tcgaactcggcggggtcagacacgccgggcgcctccca 458 ||||||||||||||| |||||||||||||||||||||| Sbjct: 421 tcgaactcggcggggccagacacgccgggcgcctccca 458 >gi|21207600|gb|AY104522.1| Zea mays PCO077650 mRNA sequence Length = 1833 Score = 813 bits (410), Expect = 0.0 Identities = 428/434 (98%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 1558 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 1499 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1498 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 1439 Query: 441 cacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgtt 500 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1438 cacgccgggcgcctcccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgtt 1379 Query: 501 ggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctc 560 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 1378 ggcgagcccgaacgccatgcccgggcacatcctccggccggcgccgaacggcaggagctc 1319 Query: 561 gaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcggggcggaa 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 1318 gaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcgggccggaa 1259 Query: 621 ctcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccag 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1258 ctcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccag 1199 Query: 681 cacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggactgccg 740 ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1198 cacggtggtgcccgcgggcacgtcgtagcccagcacgcggcgcggctcctgggactgccg 1139 Query: 741 cgggagcagcagcg 754 |||||||||||||| Sbjct: 1138 cgggagcagcagcg 1125 Score = 266 bits (134), Expect = 4e-69 Identities = 207/229 (90%), Gaps = 13/229 (5%) Strand = Plus / Minus Query: 92 ttgtcatcgctacataaaaagacataaaattagaggctgtgtcctcctttgaaagccttc 151 ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| Sbjct: 1819 ttgtcatcgctacataaaa-gacataaaattagaggttgtgtcctcctttgaaagcc--- 1764 Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| Sbjct: 1763 aacaggtaggcccataatgtagatgggctt-ggacctagcgttcttaaactactagctta 1705 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 ||||||||||||| |||||| |||||||||| ||||| | ||||| ||||||| Sbjct: 1704 tagtaggccataggggggaa--------acgacacaccatgtcccctgccggggctcgcc 1653 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcaca 320 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1652 ggtggccaaatcctcagccagatcagcttgtcgatcacgtgaattcaca 1604 >gi|21207600|gb|AY104522.1| Zea mays PCO077650 mRNA sequence Length = 1833 Score = 813 bits (410), Expect = 0.0 Identities = 428/434 (98%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 1558 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 1499 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1498 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 1439 Query: 441 cacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgtt 500 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1438 cacgccgggcgcctcccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgtt 1379 Query: 501 ggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctc 560 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 1378 ggcgagcccgaacgccatgcccgggcacatcctccggccggcgccgaacggcaggagctc 1319 Query: 561 gaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcggggcggaa 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 1318 gaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcgggccggaa 1259 Query: 621 ctcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccag 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1258 ctcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcaccag 1199 Query: 681 cacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggactgccg 740 ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1198 cacggtggtgcccgcgggcacgtcgtagcccagcacgcggcgcggctcctgggactgccg 1139 Query: 741 cgggagcagcagcg 754 |||||||||||||| Sbjct: 1138 cgggagcagcagcg 1125 Score = 266 bits (134), Expect = 4e-69 Identities = 207/229 (90%), Gaps = 13/229 (5%) Strand = Plus / Minus Query: 92 ttgtcatcgctacataaaaagacataaaattagaggctgtgtcctcctttgaaagccttc 151 ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| Sbjct: 1819 ttgtcatcgctacataaaa-gacataaaattagaggttgtgtcctcctttgaaagcc--- 1764 Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| Sbjct: 1763 aacaggtaggcccataatgtagatgggctt-ggacctagcgttcttaaactactagctta 1705 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 ||||||||||||| |||||| |||||||||| ||||| | ||||| ||||||| Sbjct: 1704 tagtaggccataggggggaa--------acgacacaccatgtcccctgccggggctcgcc 1653 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcaca 320 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1652 ggtggccaaatcctcagccagatcagcttgtcgatcacgtgaattcaca 1604 >gi|6695765|gb|AW288843.1|AW288843 707010G10.y2 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 392 Score = 777 bits (392), Expect = 0.0 Identities = 392/392 (100%) Strand = Plus / Minus Query: 376 aggtcggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcgggg 435 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 392 aggtcggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcgggg 333 Query: 436 tcagacacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcg 495 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 332 tcagacacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcg 273 Query: 496 acgttggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcagg 555 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 272 acgttggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcagg 213 Query: 556 agctcgaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcgggg 615 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 212 agctcgaagtcggcgcccttgaactccaccgcgctggcctcggcctcgaaccgctcgggg 153 Query: 616 cggaactcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttc 675 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 152 cggaactcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttc 93 Query: 676 accagcacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggac 735 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 92 accagcacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggac 33 Query: 736 tgccgcgggagcagcagcgtcgacgcggccgc 767 |||||||||||||||||||||||||||||||| Sbjct: 32 tgccgcgggagcagcagcgtcgacgcggccgc 1 >gi|45590055|gb|BV120682.1| PZA00903 Oh43 Zea mays Oh43 Zea mays STS genomic, sequence tagged site Length = 300 Score = 581 bits (293), Expect = e-164 Identities = 300/301 (99%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 300 aacaggtaggtccataatgtagatgggctt-ggacctatcgttcttaaactactagctta 242 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 182 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattaga 331 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattaga 122 Query: 332 caccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtc 391 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 caccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtc 62 Query: 392 tcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcg 451 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcg 2 Query: 452 c 452 | Sbjct: 1 c 1 >gi|45590059|gb|BV120686.1| PZA00903 Ky21 Zea mays Ky21 Zea mays STS genomic, sequence tagged site Length = 298 Score = 577 bits (291), Expect = e-163 Identities = 298/299 (99%), Gaps = 1/299 (0%) Strand = Plus / Minus Query: 159 aggtccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtagg 218 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 298 aggtccataatgtagatgggctt-ggacctatcgttcttaaactactagcttatagtagg 240 Query: 219 ccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggcc 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 239 ccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggcc 180 Query: 279 aaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccggg 338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 179 aaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccggg 120 Query: 339 aacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggt 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 119 aacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggt 60 Query: 399 gatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgcctccc 457 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 59 gatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgcctccc 1 >gi|45590061|gb|BV120688.1| PZA00903 Hp301 Zea mays Hp301 Zea mays STS genomic, sequence tagged site Length = 288 Score = 557 bits (281), Expect = e-157 Identities = 288/289 (99%), Gaps = 1/289 (0%) Strand = Plus / Minus Query: 164 cataatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggccata 223 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 cataatgtagatgggctt-ggacctatcgttcttaaactactagcttatagtaggccata 230 Query: 224 gtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaatc 283 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 229 gtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaatc 170 Query: 284 ctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccgggaacag 343 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 169 ctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccgggaacag 110 Query: 344 ggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtgatgc 403 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 109 ggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtgatgc 50 Query: 404 caaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgc 452 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 49 caaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgc 1 >gi|45590056|gb|BV120683.1| PZA00903 Il14H Zea mays Il14H Zea mays STS genomic, sequence tagged site Length = 293 Score = 551 bits (278), Expect = e-155 Identities = 291/294 (98%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 164 cataatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggccata 223 |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 293 cataatgtagatgggctt-ggagctatcgttcttaaactactagcttatagtaggccata 235 Query: 224 gtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaatc 283 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 gtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaatc 175 Query: 284 ctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccgggaacag 343 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 174 ctcggccagatcagcttgtcgatcacgtgaattcacacggcgatgagacaccgggaacag 115 Query: 344 ggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtgatgc 403 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 114 ggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtgatgc 55 Query: 404 caaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgcctccc 457 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 54 caaacgcctcggccatgtcgaactcggcggggtcagacacgccgggcgcctccc 1 >gi|45590066|gb|BV120693.1| PZA00903 CML333 Zea mays CML333 Zea mays STS genomic, sequence tagged site Length = 284 Score = 549 bits (277), Expect = e-154 Identities = 284/285 (99%), Gaps = 1/285 (0%) Strand = Plus / Minus Query: 158 taggtccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtag 217 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 284 taggtccataatgtagatgggctt-ggacctatcgttcttaaactactagcttatagtag 226 Query: 218 gccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggc 277 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 gccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggc 166 Query: 278 caaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccgg 337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 caaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccgg 106 Query: 338 gaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcgg 397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 105 gaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcgg 46 Query: 398 tgatgccaaacgcctcggccatgtcgaactcggcggggtcagaca 442 ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 45 tgatgccaaacgcctcggccatgtcgaactcggcggggtcagaca 1 >gi|45590065|gb|BV120692.1| PZA00903 Kul11 Zea mays Kul11 Zea mays STS genomic, sequence tagged site Length = 292 Score = 549 bits (277), Expect = e-154 Identities = 290/293 (98%), Gaps = 1/293 (0%) Strand = Plus / Minus Query: 156 ggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagcttatagt 215 |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 292 ggtaggtccataatgtagatgggctt-ggagctatcgttcttaaactactagcttatagt 234 Query: 216 aggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtg 275 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 233 aggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtg 174 Query: 276 gccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacacc 335 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 173 gccaaatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgatgagacacc 114 Query: 336 gggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgc 395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 113 gggaacagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgc 54 Query: 396 ggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgg 448 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 53 ggtgatgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgg 1 >gi|45590064|gb|BV120691.1| PZA00903 Kul3 Zea mays Kul3 Zea mays STS genomic, sequence tagged site Length = 288 Score = 541 bits (273), Expect = e-152 Identities = 286/289 (98%), Gaps = 1/289 (0%) Strand = Plus / Minus Query: 160 ggtccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggc 219 |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 288 ggtccataatgtagatgggctt-ggagctatcgttcttaaactactagcttatagtaggc 230 Query: 220 catagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggcca 279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 229 catagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggcca 170 Query: 280 aatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgattagacaccggga 339 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 169 aatcctcggccagatcagcttgtcgatcacgtgaattcacacggcgatgagacaccggga 110 Query: 340 acagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtg 399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 109 acagggaggcgcacgcggaggatggggcggagtagcaggtcggccttccgtctcgcggtg 50 Query: 400 atgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgg 448 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 49 atgccaaacgcctcggccatgtcgaactcggcggggtcagacacgccgg 1 >gi|6695693|gb|AW288771.1|AW288771 707010B03.x5 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 233 Score = 402 bits (203), Expect = e-110 Identities = 228/234 (97%), Gaps = 2/234 (0%) Strand = Plus / Plus Query: 106 taaaaagacataaaattagaggctgtgtcctcctttgaaagccttcaacaggtaggtcca 165 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 1 taaaaagacataaaattagaggctgngtcctcctttgaaagccttcaacaggtaggtcca 60 Query: 166 taatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggccatagt 225 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 taatgtagatgggctt-ggacctatcgttcttaaactactagcttatagtaggccatagc 119 Query: 226 ggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaatcct 285 ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 120 ggggaaacgagccaacgacacaccttgtccgcggcccgcgctcgccggtggccaaatcct 179 Query: 286 cggccagatcagcttgtcgatcacgtgaattcacacgg-cgattagacaccggg 338 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 180 cggccagatcagcttgtcgatcacgtgaattcacacggccgattagacaccggg 233 >gi|45590063|gb|BV120690.1| PZA00903 NC350 Zea mays NC350 Zea mays STS genomic, sequence tagged site Length = 331 Score = 264 bits (133), Expect = 1e-68 Identities = 136/137 (99%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 137 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 78 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 77 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 18 Query: 441 cacgccgggcgcctccc 457 ||||||||||||||||| Sbjct: 17 cacgccgggcgcctccc 1 Score = 184 bits (93), Expect = 1e-44 Identities = 142/158 (89%), Gaps = 9/158 (5%) Strand = Plus / Minus Query: 163 ccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggccat 222 ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| Sbjct: 331 ccataatgtagatgggctt-ggacctagcgttcttaaactactagcttatagtaggccat 273 Query: 223 agtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaat 282 || ||||||||| ||||||| ||||| | ||||| |||||||||||||||||| Sbjct: 272 aggggggaaacg--------acacaccatgtcccctgccggggctcgccggtggccaaat 221 Query: 283 cctcggccagatcagcttgtcgatcacgtgaattcaca 320 |||| ||||||||||||||||||||||||||||||||| Sbjct: 220 cctcagccagatcagcttgtcgatcacgtgaattcaca 183 >gi|45590057|gb|BV120684.1| PZA00903 Mo17(1) Zea mays Mo17(1) Zea mays STS genomic, sequence tagged site Length = 341 Score = 264 bits (133), Expect = 1e-68 Identities = 136/137 (99%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 137 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 78 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 77 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 18 Query: 441 cacgccgggcgcctccc 457 ||||||||||||||||| Sbjct: 17 cacgccgggcgcctccc 1 Score = 174 bits (88), Expect = 1e-41 Identities = 150/169 (88%), Gaps = 10/169 (5%) Strand = Plus / Minus Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||||||| Sbjct: 341 aacaggtaggcccataatgtagatgggctt-ggacctagcgttcttaa-ctactagctta 284 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 ||||||||||||| |||||||| | |||||| ||||| | ||||| ||||||| Sbjct: 283 tagtaggccataggggggaaacca--------cacaccatgtcccctgccggggctcgcc 232 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcaca 320 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 231 ggtggccaaatcctcagccagatcagcttgtcgatcacgtgaattcaca 183 >gi|45590060|gb|BV120687.1| PZA00903 M37W Zea mays M37W Zea mays STS genomic, sequence tagged site Length = 269 Score = 262 bits (132), Expect = 6e-68 Identities = 135/136 (99%) Strand = Plus / Plus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 134 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 193 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 194 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 253 Query: 441 cacgccgggcgcctcc 456 |||||||||||||||| Sbjct: 254 cacgccgggcgcctcc 269 Score = 115 bits (58), Expect = 8e-24 Identities = 73/78 (93%) Strand = Plus / Plus Query: 243 acacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagcttgt 302 ||||||| ||||| | ||||| |||||||||||||||||||||| ||||||||||||||| Sbjct: 11 acacaccatgtcccctgccggggctcgccggtggccaaatcctcagccagatcagcttgt 70 Query: 303 cgatcacgtgaattcaca 320 |||||||||||||||||| Sbjct: 71 cgatcacgtgaattcaca 88 >gi|45590053|gb|BV120680.1| PZA00903 B73(1) Zea mays B73(1) Zea mays STS genomic, sequence tagged site Length = 335 Score = 248 bits (125), Expect = 9e-64 Identities = 134/137 (97%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 ||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 137 cggcgattagacaccgggaacggggaggcgcacgcggaggatggggcggaggaggaggtc 78 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 77 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 18 Query: 441 cacgccgggcgcctccc 457 ||||||||||||||||| Sbjct: 17 cacgccgggcgcctccc 1 Score = 224 bits (113), Expect = 1e-56 Identities = 155/170 (91%), Gaps = 8/170 (4%) Strand = Plus / Minus Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 335 aacaggtaggcccataatgtagatgggctttggacctatcgttcttaaactactagctta 276 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 ||||||||||||| |||||| |||||||||| |||||||| ||| |||||||| Sbjct: 275 tagtaggccataggggggaa--------acgacacaccatgtccgcgcccgccgctcgcc 224 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacac 321 |||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 223 ggtggccaaatcctcggccagagcagcttgtcgatcacgtgaatgcacac 174 >gi|45590062|gb|BV120689.1| PZA00903 CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 322 Score = 246 bits (124), Expect = 3e-63 Identities = 127/128 (99%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 128 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 69 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 68 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 9 Query: 441 cacgccgg 448 |||||||| Sbjct: 8 cacgccgg 1 Score = 184 bits (93), Expect = 1e-44 Identities = 142/158 (89%), Gaps = 9/158 (5%) Strand = Plus / Minus Query: 163 ccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtaggccat 222 ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| Sbjct: 322 ccataatgtagatgggctt-ggacctagcgttcttaaactactagcttatagtaggccat 264 Query: 223 agtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggccaaat 282 || ||||||||| ||||||| ||||| | ||||| |||||||||||||||||| Sbjct: 263 aggggggaaacg--------acacaccatgtcccctgccggggctcgccggtggccaaat 212 Query: 283 cctcggccagatcagcttgtcgatcacgtgaattcaca 320 |||| ||||||||||||||||||||||||||||||||| Sbjct: 211 cctcagccagatcagcttgtcgatcacgtgaattcaca 174 >gi|45590058|gb|BV120685.1| PZA00903 Mo17(2) Zea mays Mo17(2) Zea mays STS genomic, sequence tagged site Length = 326 Score = 246 bits (124), Expect = 3e-63 Identities = 127/128 (99%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 128 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtaggaggtc 69 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 68 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 9 Query: 441 cacgccgg 448 |||||||| Sbjct: 8 cacgccgg 1 Score = 163 bits (82), Expect = 4e-38 Identities = 144/163 (88%), Gaps = 10/163 (6%) Strand = Plus / Minus Query: 158 taggtccataatgtagatgggctttggacctatcgttcttaaactactagcttatagtag 217 |||| ||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||| Sbjct: 326 taggcccataatgtagatgggctt-ggacctagcgttcttaa-ctactagcttatagtag 269 Query: 218 gccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgccggtggc 277 ||||||| |||||||| | |||||| ||||| | ||||| ||||||||||||| Sbjct: 268 gccataggggggaaacca--------cacaccatgtcccctgccggggctcgccggtggc 217 Query: 278 caaatcctcggccagatcagcttgtcgatcacgtgaattcaca 320 ||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 216 caaatcctcagccagatcagcttgtcgatcacgtgaattcaca 174 >gi|45590054|gb|BV120681.1| PZA00903 B73(2) Zea mays B73(2) Zea mays STS genomic, sequence tagged site Length = 326 Score = 230 bits (116), Expect = 2e-58 Identities = 125/128 (97%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 ||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 128 cggcgattagacaccgggaacggggaggcgcacgcggaggatggggcggaggaggaggtc 69 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 68 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 9 Query: 441 cacgccgg 448 |||||||| Sbjct: 8 cacgccgg 1 Score = 224 bits (113), Expect = 1e-56 Identities = 155/170 (91%), Gaps = 8/170 (4%) Strand = Plus / Minus Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttcttaaactactagctta 211 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 326 aacaggtaggcccataatgtagatgggctttggacctatcgttcttaaactactagctta 267 Query: 212 tagtaggccatagtggggaaacgagtcaacgacacaccttgtccgcggccggcgctcgcc 271 ||||||||||||| |||||| |||||||||| |||||||| ||| |||||||| Sbjct: 266 tagtaggccataggggggaa--------acgacacaccatgtccgcgcccgccgctcgcc 215 Query: 272 ggtggccaaatcctcggccagatcagcttgtcgatcacgtgaattcacac 321 |||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 214 ggtggccaaatcctcggccagagcagcttgtcgatcacgtgaatgcacac 165 >gi|45590067|gb|BV120694.1| PZA00903 CML322 Zea mays CML322 Zea mays STS genomic, sequence tagged site Length = 278 Score = 194 bits (98), Expect = 1e-47 Identities = 107/110 (97%) Strand = Plus / Minus Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380 ||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 110 cggcgattagacaccgggaacggggaggcgcacgcggaggatggggcggaggaggaggtc 51 Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcgg 430 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 50 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcgg 1 Score = 165 bits (83), Expect = 1e-38 Identities = 125/140 (89%), Gaps = 8/140 (5%) Strand = Plus / Minus Query: 182 tggacctatcgttcttaaactactagcttatagtaggccatagtggggaaacgagtcaac 241 |||||||||||||||||||||||||||||||| |||||||| | ||||||||| Sbjct: 278 tggacctatcgttcttaaactactagcttatactaggccatgggggggaaacg------- 226 Query: 242 gacacaccttgtccgcggccggcgctcgccggtggccaaatcctcggccagatcagcttg 301 ||||||| | |||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 225 -acacaccatatccgcggccgccgctcgccggtggccaaatcctcggccagagcagcttg 167 Query: 302 tcgatcacgtgaattcacac 321 |||||||||||||||||||| Sbjct: 166 tcgatcacgtgaattcacac 147 >gi|37392468|gb|CF633485.1|CF633485 zmrws48_0B20-016-d11.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 660 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 365 cacatcctcctgccggcgccgaacggcaggagctcgaagt 404 >gi|50327994|gb|CO523120.1|CO523120 3530_1_152_1_H09.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 692 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 431 cacatcctcctgccggcgccgaacggcaggagctcgaagt 470 >gi|71306311|gb|DR789298.1|DR789298 ZM_BFb0007M09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 545 Score = 71.9 bits (36), Expect = 1e-10 Identities = 93/112 (83%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacgc 515 ||||||||| |||||||| | |||||| ||| ||||||||| ||||||||||| ||||| Sbjct: 219 ccagtcgaaatggaacagcaagctggccagcccgagctcgatattggcgagcccaaacgc 278 Query: 516 catgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcg 567 ||| || || || |||| || || ||||||||||| | || |||||||||| Sbjct: 279 catcccagggcagatccgtcgcccagcgccgaacggtatgaactcgaagtcg 330 Score = 44.1 bits (22), Expect = 0.026 Identities = 49/58 (84%) Strand = Plus / Plus Query: 697 ggcacgtcgtagcccagcacgcgacgcggctcctgggactgccgcgggagcagcagcg 754 |||||||||||||| |||||||| | |||||||| | | |||||||| |||||||| Sbjct: 454 ggcacgtcgtagccgagcacgcggcagtgctcctggcattcccgcgggatcagcagcg 511 >gi|71420517|gb|DR805122.1|DR805122 ZM_BFb0030H14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 715 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 280 cacatcctcctgccggcgccgaacggcaggagctcgaagt 319 >gi|78120569|gb|DV538953.1|DV538953 ZM_BFb0232J12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 623 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 403 cacatcctcctgccggcgccgaacggcaggagctcgaagt 442 >gi|78122966|gb|DV541350.1|DV541350 ZM_BFb0236B10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 701 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 237 cacatcctcctgccggcgccgaacggcaggagctcgaagt 276 >gi|91051677|gb|EB162095.1|EB162095 ZM_BFb0301N18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 466 Score = 71.9 bits (36), Expect = 1e-10 Identities = 39/40 (97%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 237 cacatcctcctgccggcgccgaacggcaggagctcgaagt 276 >gi|71322406|gb|DR797872.1|DR797872 ZM_BFb0020C20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 728 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 363 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 411 >gi|71768641|gb|DR966578.1|DR966578 ZM_BFb0087A04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 637 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 463 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 511 >gi|74243336|gb|DT651250.1|DT651250 ZM_BFb0115D23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 581 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 365 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 413 >gi|76013322|gb|DT940492.1|DT940492 ZM_BFb0123F18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 749 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 478 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 526 >gi|78089529|gb|DV517903.1|DV517903 ZM_BFb0201K09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 700 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 428 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 476 >gi|78120301|gb|DV538685.1|DV538685 ZM_BFb0232D16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 721 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 390 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 438 >gi|89250210|gb|DY621996.1|DY621996 ZM_BFb0286N01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 746 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 363 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 411 >gi|91053419|gb|EB163837.1|EB163837 ZM_BFb0311O16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 693 Score = 65.9 bits (33), Expect = 7e-09 Identities = 45/49 (91%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||||||||| | |||| ||||||||||||| |||| Sbjct: 338 atcctccggccggcgccgaacgggatgagcccgaagtcggcgcctttga 386 >gi|6851581|gb|AW352591.1|AW352591 660031E03.x1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 554 Score = 63.9 bits (32), Expect = 3e-08 Identities = 103/124 (83%), Gaps = 2/124 (1%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacag-aaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514 |||||||||||||||||| || || ||||||||||| ||||| | || |||||||||| Sbjct: 285 ccagtcgaagtggaacagcaacgc-ggcgagcgcgatctcgatatgagccagcccgaacg 343 Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574 |||||| || || |||| ||| ||||| |||||||| | || ||||||||| || |||| Sbjct: 344 tcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccct 403 Query: 575 tgaa 578 |||| Sbjct: 404 tgaa 407 Score = 36.2 bits (18), Expect = 6.3 Identities = 39/46 (84%) Strand = Plus / Plus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||| | ||| ||| ||||||| ||||||||||| || ||||| Sbjct: 491 cgttcacgatcaccgtgatgcccgccggcacgtcgtacccgagcac 536 >gi|32791139|gb|CD943375.1|CD943375 RCP_27 GeneTag1 Zea mays cDNA, mRNA sequence Length = 192 Score = 61.9 bits (31), Expect = 1e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514 ||||||||||| ||| || | ||||||||| |||||||||||||||| |||||||||| Sbjct: 76 ccagtcgaagtagaagagcaagctggcgagaccgagctcgacgttggccagcccgaacg 18 >gi|32793194|gb|CD945430.1|CD945430 RDY_40 GeneTag1 Zea mays cDNA, mRNA sequence Length = 192 Score = 61.9 bits (31), Expect = 1e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514 ||||||||||| ||| || | ||||||||| |||||||||||||||| |||||||||| Sbjct: 76 ccagtcgaagtagaagagcaagctggcgagaccgagctcgacgttggccagcccgaacg 18 >gi|32825918|gb|CD965596.1|CD965596 SEK_285 GeneTag2 Zea mays cDNA, mRNA sequence Length = 192 Score = 61.9 bits (31), Expect = 1e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514 ||||||||||| ||| || | ||||||||| |||||||||||||||| |||||||||| Sbjct: 117 ccagtcgaagtagaagagcaagctggcgagaccgagctcgacgttggccagcccgaacg 175 >gi|32826440|gb|CD966118.1|CD966118 SEL_98 GeneTag2 Zea mays cDNA, mRNA sequence Length = 192 Score = 61.9 bits (31), Expect = 1e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514 ||||||||||| ||| || | ||||||||| |||||||||||||||| |||||||||| Sbjct: 117 ccagtcgaagtagaagagcaagctggcgagaccgagctcgacgttggccagcccgaacg 175 >gi|71764817|gb|DR962754.1|DR962754 ZM_BFb0081G11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 699 Score = 58.0 bits (29), Expect = 2e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||| ||||| | |||| ||||||||||||| |||| Sbjct: 437 atcctccggccggcgccaaacgggatgagcccgaagtcggcgcctttga 485 >gi|76013953|gb|DT941123.1|DT941123 ZM_BFb0124F20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 782 Score = 58.0 bits (29), Expect = 2e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||| ||||| | |||| ||||||||||||| |||| Sbjct: 437 atcctccggccggcgccaaacgggatgagcccgaagtcggcgcctttga 485 >gi|14202208|gb|BG835885.1|BG835885 Zm06_08b05_R Zm06_AAFC_ECORC_Fusarium_graminearum_inoculated_corn_ear tip Zea mays cDNA clone Zm06_08b05, mRNA sequence Length = 469 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 105 atcctccggccggcgccgaacgggatgagctcgaag 70 >gi|14245303|gb|BG873885.1|BG873885 MEST43-G07.T3 ISUM4-TN Zea mays cDNA clone MEST43-G07 3', mRNA sequence Length = 597 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 448 ctccggccggcgccgaacgggatgagctcgaagtcg 483 >gi|50325763|gb|CO520889.1|CO520889 3530_1_138_1_C02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 549 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 363 atcctccggccggcgccgaacgggatgagctcgaag 398 >gi|50332695|gb|CO527821.1|CO527821 3530_1_184_1_D02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 661 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 426 ctccggccggcgccgaacgggatgagctcgaagtcg 461 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 560 cgcccacacgttcaccagcagcgtggtgcc 589 >gi|71430585|gb|DR811635.1|DR811635 ZM_BFb0039O22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 652 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 412 ctccggccggcgccgaacgggatgagctcgaagtcg 447 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 546 cgcccacacgttcaccagcagcgtggtgcc 575 >gi|71433597|gb|DR814647.1|DR814647 ZM_BFb0044G10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 819 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 188 ctccggccggcgccgaacgggatgagctcgaagtcg 223 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 322 cgcccacacgttcaccagcagcgtggtgcc 351 >gi|71759670|gb|DR957607.1|DR957607 ZM_BFb0057C06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 536 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 362 atcctccggccggcgccgaacgggatgagctcgaag 397 >gi|74234174|gb|DT642088.1|DT642088 ZM_BFb0100H08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 764 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 406 ctccggccggcgccgaacgggatgagctcgaagtcg 441 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 540 cgcccacacgttcaccagcagcgtggtgcc 569 >gi|74240208|gb|DT648122.1|DT648122 ZM_BFb0109H08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 540 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 411 atcctccggccggcgccgaacgggatgagctcgaag 446 >gi|74240266|gb|DT648180.1|DT648180 ZM_BFb0109I14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 586 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 406 ctccggccggcgccgaacgggatgagctcgaagtcg 441 >gi|78083196|gb|DV511589.1|DV511589 ZM_BFb0191N16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 692 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 363 atcctccggccggcgccgaacgggatgagctcgaag 398 >gi|78086610|gb|DV515003.1|DV515003 ZM_BFb0197G06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 768 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 396 atcctccggccggcgccgaacgggatgagctcgaag 431 >gi|86474038|gb|DY240408.1|DY240408 ZM_BFb0259N16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 594 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 378 atcctccggccggcgccgaacgggatgagctcgaag 413 >gi|86474231|gb|DY240601.1|DY240601 ZM_BFb0260E01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 745 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaag 564 ||||||||||||||||||||||| | |||||||||| Sbjct: 361 atcctccggccggcgccgaacgggatgagctcgaag 396 >gi|88757920|gb|DY542061.1|DY542061 ZM_BFb0367G11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 716 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Minus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 390 ctccggccggcgccgaacgggatgagctcgaagtcg 355 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Minus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 256 cgcccacacgttcaccagcagcgtggtgcc 227 >gi|89252877|gb|DY624663.1|DY624663 ZM_BFb0347C24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 188 ctccggccggcgccgaacgggatgagctcgaagtcg 223 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 322 cgcccacacgttcaccagcagcgtggtgcc 351 >gi|91873267|gb|EB403224.1|EB403224 ZM_BFb0310I12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 870 Score = 56.0 bits (28), Expect = 7e-06 Identities = 34/36 (94%) Strand = Plus / Minus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtcg 567 |||||||||||||||||||| | ||||||||||||| Sbjct: 486 ctccggccggcgccgaacgggatgagctcgaagtcg 451 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Minus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 352 cgcccacacgttcaccagcagcgtggtgcc 323 >gi|71424242|gb|DR806269.1|DR806269 ZM_BFb0032B23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 736 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtc 566 |||||||||||||||||||| | |||||||||||| Sbjct: 378 ctccggccggcgccgaacgggatgagctcgaagtc 412 >gi|71774000|gb|DR971887.1|DR971887 ZM_BFb0094M16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 610 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaa 563 ||||||||||||||||||||||| | ||||||||| Sbjct: 411 atcctccggccggcgccgaacgggatgagctcgaa 445 >gi|78074168|gb|DV502602.1|DV502602 ZM_BFb0174I02.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 614 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaa 563 ||||||||||||||||||||||| | ||||||||| Sbjct: 289 atcctccggccggcgccgaacgggatgagctcgaa 323 >gi|78083010|gb|DV511403.1|DV511403 ZM_BFb0191I19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 781 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtc 566 |||||||||||||||||||| | |||||||||||| Sbjct: 327 ctccggccggcgccgaacgggatgagctcgaagtc 361 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 461 cgcccacacgttcaccagcagcgtggtgcc 490 >gi|88757919|gb|DY542060.1|DY542060 ZM_BFb0367G11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 685 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtc 566 |||||||||||||||||||| | |||||||||||| Sbjct: 327 ctccggccggcgccgaacgggatgagctcgaagtc 361 Score = 36.2 bits (18), Expect = 6.3 Identities = 27/30 (90%) Strand = Plus / Plus Query: 663 cgcccagacgttcaccagcacggtggtgcc 692 |||||| ||||||||||||| |||||||| Sbjct: 461 cgcccacacgttcaccagcagcgtggtgcc 490 >gi|91873266|gb|EB403223.1|EB403223 ZM_BFb0310I12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 551 Score = 54.0 bits (27), Expect = 3e-05 Identities = 33/35 (94%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaagtc 566 |||||||||||||||||||| | |||||||||||| Sbjct: 406 ctccggccggcgccgaacgggatgagctcgaagtc 440 >gi|78120542|gb|DV538926.1|DV538926 ZM_BFb0232I22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 655 Score = 50.1 bits (25), Expect = 4e-04 Identities = 43/49 (87%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 ||||||||||||||||| ||||| | |||| | ||||||||||| |||| Sbjct: 437 atcctccggccggcgccaaacgggatgagcccaaagtcggcgcctttga 485 >gi|4688361|gb|AI637031.1|AI637031 496003D11.x1 496 - stressed shoot cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 347 Score = 48.1 bits (24), Expect = 0.002 Identities = 42/48 (87%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggc 503 ||||||||||| ||| || | ||||||||| |||||||||||||||| Sbjct: 254 ccagtcgaagtagaagagcaagctggcgagaccgagctcgacgttggc 301 >gi|7304703|gb|AW600642.1|AW600642 707104D05.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 412 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 130 atcctccggccggcgccgaacgggatgagctggtagtcgg 91 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 206 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 165 >gi|18660933|gb|BM501125.1|BM501125 PAC000000001152 Pioneer AF-1 array Zea mays cDNA, mRNA sequence Length = 459 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 72 atcctccggccggcgccgaacgggatgagctggtagtcgg 33 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 148 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 107 >gi|37387590|gb|CF630992.1|CF630992 zmrws48_0B10-003-a10.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 412 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 331 atcctccggccggcgccgaacgggatgagctggtagtcgg 370 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 255 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 296 >gi|40335836|gb|CK369906.1|CK369906 zmrws485_0B10-003-a10.s0 zmrws485 Zea mays cDNA 5', mRNA sequence Length = 441 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 89 atcctccggccggcgccgaacgggatgagctggtagtcgg 50 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 165 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 124 >gi|60352311|gb|DN219284.1|DN219284 MEST1079_D04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 483 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 358 atcctccggccggcgccgaacgggatgagctggtagtcgg 397 >gi|71326939|gb|DR800129.1|DR800129 ZM_BFb0023G04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 806 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 393 atcctccggccggcgccgaacgggatgagctggtagtcgg 432 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 317 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 358 >gi|76935715|gb|DV174444.1|DV174444 ZM_BFb0178B21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 783 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 175 atcctccggccggcgccgaacgggatgagctggtagtcgg 214 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 99 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 140 >gi|89248466|gb|DY620252.1|DY620252 ZM_BFb0278M09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 501 Score = 48.1 bits (24), Expect = 0.002 Identities = 66/80 (82%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacgc 515 |||||||||||| ||||| | | ||||| |||||||| | || || ||||||||||| Sbjct: 155 ccagtcgaagtgaaacagcaaccccgcgagagcgagctcaatgtgcgccagcccgaacgc 214 Query: 516 catgcccggacacatcctcc 535 |||||| || |||||||||| Sbjct: 215 catgccggggcacatcctcc 234 >gi|93015387|gb|EB640907.1|EB640907 ZM_BFb0330C13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 445 Score = 48.1 bits (24), Expect = 0.002 Identities = 30/32 (93%) Strand = Plus / Plus Query: 532 ctccggccggcgccgaacggcaggagctcgaa 563 |||||||||||||||||||| | ||||||||| Sbjct: 401 ctccggccggcgccgaacgggaagagctcgaa 432 >gi|21207161|gb|AY104083.1| Zea mays PCO090231 mRNA sequence Length = 1749 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 1339 atcctccggccggcgccgaacgggatgagctggtagtcgg 1300 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 1415 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 1374 >gi|21207161|gb|AY104083.1| Zea mays PCO090231 mRNA sequence Length = 1749 Score = 48.1 bits (24), Expect = 0.002 Identities = 36/40 (90%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcgg 568 ||||||||||||||||||||||| | ||||| | |||||| Sbjct: 1339 atcctccggccggcgccgaacgggatgagctggtagtcgg 1300 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 1415 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 1374 >gi|4730327|gb|AI649493.1|AI649493 603005C05.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 637 Score = 46.1 bits (23), Expect = 0.007 Identities = 23/23 (100%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||||||||||||| Sbjct: 581 atcctccggccggcgccgaacgg 603 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| ||| |||||| ||||||||||||| Sbjct: 505 ctcccattcgaagtggtgcaggaggctgacgagcgcgagctc 546 >gi|5055486|gb|AI734373.1|AI734373 606030C10.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 578 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 386 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 428 >gi|6826928|gb|AW330571.1|AW330571 707029D02.x2 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 546 Score = 46.1 bits (23), Expect = 0.007 Identities = 23/23 (100%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||||||||||||| Sbjct: 79 atcctccggccggcgccgaacgg 57 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| ||| |||||| ||||||||||||| Sbjct: 155 ctcccattcgaagtggtgcaggaggctgacgagcgcgagctc 114 >gi|9254255|gb|BE344723.1|BE344723 946028D11.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 585 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 264 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 306 >gi|9254256|gb|BE344724.1|BE344724 946028D11.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 585 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 555 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 513 >gi|14208455|gb|BG842133.1|BG842133 MEST36-F01.T3 ISUM3-TL Zea mays cDNA clone MEST36-F01 3', mRNA sequence Length = 557 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Minus Query: 505 agcccgaacgccatgcccggacacatcctcc 535 ||||||||||||||||| || |||||||||| Sbjct: 482 agcccgaacgccatgccggggcacatcctcc 452 Score = 44.1 bits (22), Expect = 0.026 Identities = 40/46 (86%) Strand = Plus / Minus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 325 cgttcaccagcaccatggtgccacgaggcacgtcgtagccgagcac 280 >gi|14245434|gb|BG874016.1|BG874016 MEST45-D02.T3 ISUM4-TN Zea mays cDNA clone MEST45-D02 3', mRNA sequence Length = 608 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Minus Query: 505 agcccgaacgccatgcccggacacatcctcc 535 ||||||||||||||||| || |||||||||| Sbjct: 482 agcccgaacgccatgccggggcacatcctcc 452 Score = 44.1 bits (22), Expect = 0.026 Identities = 40/46 (86%) Strand = Plus / Minus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 325 cgttcaccagcaccatggtgccacgaggcacgtcgtagccgagcac 280 >gi|33466477|gb|CF243526.1|CF243526 3530_1_21_1_G09.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 777 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 421 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 463 >gi|37375843|gb|CF624395.1|CF624395 zmrws05_0A20-003-c01.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 637 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 380 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 422 >gi|37392156|gb|CF633325.1|CF633325 zmrws48_0B20-014-e03.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 428 Score = 46.1 bits (23), Expect = 0.007 Identities = 23/23 (100%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||||||||||||| Sbjct: 393 atcctccggccggcgccgaacgg 415 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 317 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 358 >gi|37394824|gb|CF634690.1|CF634690 zmrww00_0A20-001-b08.s2 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 683 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Plus Query: 505 agcccgaacgccatgcccggacacatcctcc 535 ||||||||||||||||| || |||||||||| Sbjct: 299 agcccgaacgccatgccggggcacatcctcc 329 Score = 44.1 bits (22), Expect = 0.026 Identities = 40/46 (86%) Strand = Plus / Plus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 456 cgttcaccagcaccatggtgccacgaggcacgtcgtagccgagcac 501 >gi|50331899|gb|CO527025.1|CO527025 3530_1_179_1_G05.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 650 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 444 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 486 >gi|50332050|gb|CO527176.1|CO527176 3530_1_17_1_G09.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 706 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 421 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 463 >gi|60356564|gb|DN223537.1|DN223537 MEST1144_B04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 607 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 364 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 406 >gi|71298189|gb|DR785071.1|DR785071 ZM_BFb0001H08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 714 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71302152|gb|DR787183.1|DR787183 ZM_BFb0004H20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 625 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|71308857|gb|DR790678.1|DR790678 ZM_BFb0009M03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 581 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71418226|gb|DR804374.1|DR804374 ZM_BFb0029G21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 816 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Plus Query: 505 agcccgaacgccatgcccggacacatcctcc 535 ||||||||||||||||| || |||||||||| Sbjct: 274 agcccgaacgccatgccggggcacatcctcc 304 Score = 44.1 bits (22), Expect = 0.026 Identities = 40/46 (86%) Strand = Plus / Plus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 431 cgttcaccagcaccatggtgccacgaggcacgtcgtagccgagcac 476 >gi|71418693|gb|DR804509.1|DR804509 ZM_BFb0029J20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 761 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71422795|gb|DR805848.1|DR805848 ZM_BFb0031I07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 666 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 396 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 438 >gi|71430402|gb|DR811452.1|DR811452 ZM_BFb0039K16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 778 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 422 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 464 >gi|71431463|gb|DR812513.1|DR812513 ZM_BFb0041E01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 722 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71438122|gb|DR819172.1|DR819172 ZM_BFb0055D17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 579 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 205 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 163 >gi|71440218|gb|DR821268.1|DR821268 ZM_BFb0060H16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 754 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71446569|gb|DR827619.1|DR827619 ZM_BFb0070O17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 621 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 494 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 536 >gi|71756687|gb|DR954624.1|DR954624 ZM_BFb0047E24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 747 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 396 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 438 >gi|71758514|gb|DR956451.1|DR956451 ZM_BFb0052P21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 699 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 428 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 470 >gi|71761551|gb|DR959488.1|DR959488 ZM_BFb0071K13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 716 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 403 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 445 >gi|71765050|gb|DR962987.1|DR962987 ZM_BFb0081L20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 722 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71769835|gb|DR967772.1|DR967772 ZM_BFb0088M09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 742 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 403 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 445 >gi|71771667|gb|DR969604.1|DR969604 ZM_BFb0091G19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 610 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|71773017|gb|DR970936.1|DR970936 ZM_BFb0093G17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 717 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|74234782|gb|DT642696.1|DT642696 ZM_BFb0101F12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 676 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 403 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 445 >gi|76012975|gb|DT940145.1|DT940145 ZM_BFb0122N08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 714 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 396 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 438 >gi|76017954|gb|DT945124.1|DT945124 ZM_BFb0132D08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 656 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|76020804|gb|DT947974.1|DT947974 ZM_BFb0136I06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 687 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 494 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 536 >gi|76021455|gb|DT948625.1|DT948625 ZM_BFb0137I18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 703 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|76928328|gb|DV171581.1|DV171581 ZM_BFb0172C16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 724 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 422 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 464 >gi|76929838|gb|DV172186.1|DV172186 ZM_BFb0173I10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 641 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 380 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 422 >gi|76912324|gb|DV164675.1|DV164675 ZM_BFb0161E01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 787 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|76923368|gb|DV169452.1|DV169452 ZM_BFb0168I22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 610 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|76926324|gb|DV170809.1|DV170809 ZM_BFb0170K12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 770 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|78023613|gb|DV492000.1|DV492000 1000088-G03.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 585 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 378 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 420 >gi|78024408|gb|DV492795.1|DV492795 1000088-F03.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 581 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 378 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 420 >gi|78075901|gb|DV504335.1|DV504335 ZM_BFb0181C17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 725 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|78078000|gb|DV506415.1|DV506415 ZM_BFb0184C09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 763 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 412 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 454 >gi|78110789|gb|DV529187.1|DV529187 ZM_BFb0217P11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 777 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 422 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 464 >gi|78112253|gb|DV530647.1|DV530647 ZM_BFb0220I03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 748 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|78115426|gb|DV533814.1|DV533814 ZM_BFb0225B10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 637 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|78116396|gb|DV534783.1|DV534783 ZM_BFb0226I11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 698 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 403 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 445 >gi|84969887|gb|DW468293.1|DW468293 ZM_BFb0170K12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 599 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|86465700|gb|DY232073.1|DY232073 ZM_BFb0241B10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 671 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 428 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 470 >gi|86473170|gb|DY239540.1|DY239540 ZM_BFb0258E08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 660 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|88756163|gb|DY540304.1|DY540304 ZM_BFb0355I21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 576 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|89252737|gb|DY624523.1|DY624523 ZM_BFb0318L09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 470 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 287 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 329 >gi|89763696|gb|DY690785.1|DY690785 ZM_BFb0290D10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 702 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 403 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 445 >gi|89764314|gb|DY691167.1|DY691167 ZM_BFb0290N07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 594 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|91049791|gb|EB160209.1|EB160209 ZM_BFb0296O16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 844 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Minus Query: 505 agcccgaacgccatgcccggacacatcctcc 535 ||||||||||||||||| || |||||||||| Sbjct: 798 agcccgaacgccatgccggggcacatcctcc 768 Score = 44.1 bits (22), Expect = 0.026 Identities = 40/46 (86%) Strand = Plus / Minus Query: 671 cgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcac 716 ||||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 641 cgttcaccagcaccatggtgccacgaggcacgtcgtagccgagcac 596 >gi|91052199|gb|EB162617.1|EB162617 ZM_BFb0303C16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 712 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 459 >gi|91056662|gb|EB167080.1|EB167080 ZM_BFb0377K10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 735 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 396 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 438 >gi|91871900|gb|EB401857.1|EB401857 ZM_BFb0308D07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 418 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 376 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 418 >gi|21210129|gb|AY107051.1| Zea mays PCO135033 mRNA sequence Length = 1850 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 1416 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 1374 >gi|21210129|gb|AY107051.1| Zea mays PCO135033 mRNA sequence Length = 1850 Score = 46.1 bits (23), Expect = 0.007 Identities = 38/43 (88%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||||||| | ||||||||||||||||| Sbjct: 1416 cggccggcgccgaacggcagcacgcggaagtcggcgcccttga 1374 >gi|12046721|gb|BF728860.1|BF728860 1000068C08.x2 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 293 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 55 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 14 >gi|32809982|gb|CD962216.1|CD962216 SDN_137 GeneTag2 Zea mays cDNA, mRNA sequence Length = 255 Score = 44.1 bits (22), Expect = 0.026 Identities = 37/42 (88%) Strand = Plus / Minus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagcgcgagctc 494 |||||| ||||||||| |||||||||| | ||||||||||| Sbjct: 79 ctcccattcgaagtggtgcagaaggctgacaagcgcgagctc 38 >gi|32923346|gb|CF028158.1|CF028158 QCB6d08.yg QCB Zea mays cDNA clone QCB6d08, mRNA sequence Length = 177 Score = 44.1 bits (22), Expect = 0.026 Identities = 31/34 (91%) Strand = Plus / Plus Query: 453 ctcccagtcgaagtggaacagaaggctggcgagc 486 |||||||||||||||| | | ||||||||||||| Sbjct: 47 ctcccagtcgaagtggtagacaaggctggcgagc 80 >gi|7009393|gb|AW455658.1|AW455658 707087D05.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 496 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 748 agcagcgtcgacgcggccgc 767 |||||||||||||||||||| Sbjct: 20 agcagcgtcgacgcggccgc 1 >gi|16925444|gb|BM078512.1|BM078512 MEST120-F05.T3 ISUM4-TN Zea mays cDNA clone MEST120-F05 3', mRNA sequence Length = 481 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 433 cggccggcgccgaacggcag 452 >gi|37419128|gb|CF647240.1|CF647240 3530_1_41_1_C02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 263 Score = 40.1 bits (20), Expect = 0.40 Identities = 26/28 (92%) Strand = Plus / Plus Query: 740 gcgggagcagcagcgtcgacgcggccgc 767 ||||||||||||||| || ||||||||| Sbjct: 53 gcgggagcagcagcggcggcgcggccgc 80 >gi|40303352|gb|CK347739.1|CK347739 zmrsub1_0B10-005-a03.s3 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 696 Score = 40.1 bits (20), Expect = 0.40 Identities = 26/28 (92%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggca 553 |||||||||||||||| |||||| |||| Sbjct: 338 cacatcctccggccggagccgaagggca 365 >gi|71432373|gb|DR813423.1|DR813423 ZM_BFb0042J13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 729 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 458 gaaccgctcggggcggaact 477 >gi|71441614|gb|DR822664.1|DR822664 ZM_BFb0062P22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 739 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 451 gaaccgctcggggcggaact 470 >gi|71759552|gb|DR957489.1|DR957489 ZM_BFb0056L24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 454 Score = 40.1 bits (20), Expect = 0.40 Identities = 29/32 (90%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacggcaggagctc 560 ||||||||||||||||| ||||| | |||||| Sbjct: 380 atcctccggccggcgccaaacgggatgagctc 411 >gi|71760768|gb|DR958705.1|DR958705 ZM_BFb0061M18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 664 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 469 gaaccgctcggggcggaact 488 >gi|71762566|gb|DR960503.1|DR960503 ZM_BFb0075C16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 767 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 388 gaaccgctcggggcggaact 407 >gi|71771239|gb|DR969176.1|DR969176 ZM_BFb0090M21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 583 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 458 gaaccgctcggggcggaact 477 >gi|74236007|gb|DT643921.1|DT643921 ZM_BFb0103C12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 430 Score = 40.1 bits (20), Expect = 0.40 Identities = 23/24 (95%) Strand = Plus / Plus Query: 409 gcctcggccatgtcgaactcggcg 432 ||||| |||||||||||||||||| Sbjct: 73 gcctcagccatgtcgaactcggcg 96 >gi|74240417|gb|DT648331.1|DT648331 ZM_BFb0109M06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 622 Score = 40.1 bits (20), Expect = 0.40 Identities = 41/48 (85%) Strand = Plus / Plus Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggc 503 ||||||||||| || || | ||||||||| |||||||||||||||| Sbjct: 293 ccagtcgaagtaaaagagcaagctggcgagaccgagctcgacgttggc 340 >gi|76293119|gb|DV032687.1|DV032687 ZM_BFb0156J04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 761 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 474 gaaccgctcggggcggaact 493 >gi|76294322|gb|DV033890.1|DV033890 ZM_BFb0158K01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 766 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 501 ggcgagcccgaacgccatgc 520 |||||||||||||||||||| Sbjct: 532 ggcgagcccgaacgccatgc 551 >gi|76929419|gb|DV172008.1|DV172008 ZM_BFb0173C10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 694 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 458 gaaccgctcggggcggaact 477 >gi|78081760|gb|DV510172.1|DV510172 ZM_BFb0189K19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 678 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 458 gaaccgctcggggcggaact 477 >gi|78089354|gb|DV517728.1|DV517728 ZM_BFb0201G05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 752 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 469 gaaccgctcggggcggaact 488 >gi|88746043|gb|DY530184.1|DY530184 ZM_BFb0248C11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 468 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 68 cggccggcgccgaacggcag 49 >gi|88753311|gb|DY537452.1|DY537452 ZM_BFb0273D15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 563 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 460 gaaccgctcggggcggaact 479 >gi|88758346|gb|DY542715.1|DY542715 III-952-2A-F05.M13-R UGIII-Reseq Zea mays cDNA, mRNA sequence Length = 412 Score = 40.1 bits (20), Expect = 0.40 Identities = 23/24 (95%) Strand = Plus / Plus Query: 607 cgctcggggcggaactcctcgggg 630 ||||||||||||||||| |||||| Sbjct: 389 cgctcggggcggaactcgtcgggg 412 >gi|93013622|gb|EB639142.1|EB639142 ZM_BFb0326L19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 719 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 417 cggccggcgccgaacggcag 436 >gi|93015095|gb|EB640615.1|EB640615 ZM_BFb0329K07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 660 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Plus Query: 603 gaaccgctcggggcggaact 622 |||||||||||||||||||| Sbjct: 458 gaaccgctcggggcggaact 477 >gi|45670167|gb|BV130644.1| PZA00586 Zea mays ssp. parviglumis Wilkes Site 6 Zea mays Wilkes Site 6 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670166|gb|BV130643.1| PZA00586 Zea mays ssp. parviglumis Beadle & Kato site 4 Zea mays Beadle & Kato site 4 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 281 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670165|gb|BV130642.1| PZA00586 Zea mays ssp. parviglumis Kato Site 4 Zea mays Kato Site 4 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 286 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670164|gb|BV130641.1| PZA00586 Zea mays ssp. parviglumis JSGyMAS 264 Zea mays JSGyMAS 264 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 250 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 29 cggccggcgccgaacggcag 10 >gi|45670163|gb|BV130640.1| PZA00586 Zea mays ssp. parviglumis USDA PI566686 Zea mays USDA PI566686 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 262 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 29 cggccggcgccgaacggcag 10 >gi|45670162|gb|BV130639.1| PZA00586 Zea mays ssp. parviglumis CIMMYT 11355 Zea mays CIMMYT 11355 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 274 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670161|gb|BV130638.1| PZA00586 Zea mays ssp. parviglumis JSGyLOS 161 Zea mays JSGyLOS 161 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 278 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670160|gb|BV130637.1| PZA00586 Zea mays ssp. parviglumis JSG 374 Zea mays JSG 374 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 262 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670159|gb|BV130636.1| PZA00586 Zea mays ssp. parviglumis JSG 378 Zea mays JSG 378 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 266 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670158|gb|BV130635.1| PZA00586 Zea mays ssp. parviglumis JSGyLOS 109 Zea mays JSGyLOS 109 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670156|gb|BV130633.1| PZA00586 Zea mays ssp. parviglumis CIMMYT 8783 Zea mays CIMMYT 8783 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 284 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670155|gb|BV130632.1| PZA00586 Zea mays ssp. parviglumis JSGyMAS 401 Zea mays JSGyMAS 401 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670154|gb|BV130631.1| PZA00586 Zea mays ssp. parviglumis JSGyLOS 119 Zea mays JSGyLOS 119 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 275 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 28 cggccggcgccgaacggcag 9 >gi|45670153|gb|BV130630.1| PZA00586 Zea mays ssp. mays CML69 Zea mays CML69 Zea mays STS genomic, sequence tagged site Length = 284 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 29 cggccggcgccgaacggcag 10 >gi|45670152|gb|BV130629.1| PZA00586 Zea mays ssp. mays CML322 Zea mays CML322 Zea mays STS genomic, sequence tagged site Length = 274 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670151|gb|BV130628.1| PZA00586 Zea mays ssp. mays CML333 Zea mays CML333 Zea mays STS genomic, sequence tagged site Length = 282 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670150|gb|BV130627.1| PZA00586 Zea mays ssp. mays Kul11 Zea mays Kul11 Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670149|gb|BV130626.1| PZA00586 Zea mays ssp. mays Kul3 Zea mays Kul3 Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670148|gb|BV130625.1| PZA00586 Zea mays ssp. mays NC350 Zea mays NC350 Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670147|gb|BV130624.1| PZA00586 Zea mays ssp. mays CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670146|gb|BV130623.1| PZA00586 Zea mays ssp. mays Hp301 Zea mays Hp301 Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670145|gb|BV130622.1| PZA00586 Zea mays ssp. mays Ky21 Zea mays Ky21 Zea mays STS genomic, sequence tagged site Length = 272 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670144|gb|BV130621.1| PZA00586 Zea mays ssp. mays Mo17(2) Zea mays Mo17(2) Zea mays STS genomic, sequence tagged site Length = 266 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670143|gb|BV130620.1| PZA00586 Zea mays ssp. mays Mo17(1) Zea mays Mo17(1) Zea mays STS genomic, sequence tagged site Length = 266 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670142|gb|BV130619.1| PZA00586 Zea mays ssp. mays Il14H Zea mays Il14H Zea mays STS genomic, sequence tagged site Length = 257 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670141|gb|BV130618.1| PZA00586 Zea mays ssp. mays Oh43 Zea mays Oh43 Zea mays STS genomic, sequence tagged site Length = 248 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670140|gb|BV130617.1| PZA00586 Zea mays ssp. mays B73(2) Zea mays B73(2) Zea mays STS genomic, sequence tagged site Length = 287 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|45670139|gb|BV130616.1| PZA00586 Zea mays ssp. mays B73(1) Zea mays B73(1) Zea mays STS genomic, sequence tagged site Length = 266 Score = 40.1 bits (20), Expect = 0.40 Identities = 20/20 (100%) Strand = Plus / Minus Query: 535 cggccggcgccgaacggcag 554 |||||||||||||||||||| Sbjct: 32 cggccggcgccgaacggcag 13 >gi|5030475|gb|AI714669.1|AI714669 606017A01.x2 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 601 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 285 atcctccggccggagccgaacgg 307 >gi|5670921|gb|AI932184.1|AI932184 618029D06.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 186 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 137 atcctccggccggagccgaacgg 159 >gi|6342740|gb|AW165564.1|AW165564 618048F04.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 473 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 405 atcctccggccggagccgaacgg 427 >gi|6827612|gb|AW331255.1|AW331255 707050E06.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 547 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 749 gcagcgtcgacgcggccgc 767 ||||||||||||||||||| Sbjct: 529 gcagcgtcgacgcggccgc 547 >gi|6851497|gb|AW352507.1|AW352507 707050E06.y1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 555 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 749 gcagcgtcgacgcggccgc 767 ||||||||||||||||||| Sbjct: 27 gcagcgtcgacgcggccgc 9 >gi|7304420|gb|AW600359.1|AW600359 660066D05.x1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 497 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 209 atcctccggccggagccgaacgg 231 >gi|8930262|gb|BE225026.1|BE225026 945042H12.x2 945 - Mixed adult tissues from Walbot lab, same as 707 (SK) Zea mays cDNA, mRNA sequence Length = 525 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 749 gcagcgtcgacgcggccgc 767 ||||||||||||||||||| Sbjct: 507 gcagcgtcgacgcggccgc 525 >gi|9461663|gb|BE453843.1|BE453843 946047B10.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 491 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 198 atcctccggccggagccgaacgg 220 >gi|9566158|gb|BE475667.1|BE475667 946047B10.x2 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 496 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 204 atcctccggccggagccgaacgg 226 >gi|14548501|gb|BI096845.1|BI096845 949015H09.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 384 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 745 agcagcagcgtcgacgcggccgc 767 ||||||||||||||||| ||||| Sbjct: 242 agcagcagcgtcgacgccgccgc 264 >gi|16377371|gb|BI991889.1|BI991889 1020053C05.x1 1020 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 572 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 393 cacatcctccggccggacccgaacgccagga 423 >gi|18176894|gb|BM378104.1|BM378104 MEST351-G04.T3 ISUM5-RN Zea mays cDNA clone MEST351-G04 3', mRNA sequence Length = 510 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 93 atcctccggccggagccgaacgg 71 >gi|18176926|gb|BM378136.1|BM378136 MEST166-A08.T3 ISUM5-RN Zea mays cDNA clone MEST166-A08 3', mRNA sequence Length = 510 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 93 atcctccggccggagccgaacgg 71 >gi|18176959|gb|BM378169.1|BM378169 MEST207-H02.T3 ISUM5-RN Zea mays cDNA clone MEST207-H02 3', mRNA sequence Length = 510 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 93 atcctccggccggagccgaacgg 71 >gi|18176997|gb|BM378207.1|BM378207 MEST266-F11.T3 ISUM5-RN Zea mays cDNA clone MEST266-F11 3', mRNA sequence Length = 511 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 94 atcctccggccggagccgaacgg 72 >gi|18177068|gb|BM378278.1|BM378278 MEST377-H10.T3 ISUM5-RN Zea mays cDNA clone MEST377-H10 3', mRNA sequence Length = 509 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 92 atcctccggccggagccgaacgg 70 >gi|21891752|gb|BQ744965.1|BQ744965 946112F09.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 517 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 365 atcctccggccggagccgaacgg 343 >gi|22542175|gb|BU092613.1|BU092613 946154G05.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 547 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 340 atcctccggccggagccgaacgg 318 >gi|22545663|gb|BU098022.1|BU098022 946123C07.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 628 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 340 atcctccggccggagccgaacgg 318 >gi|28188214|gb|CB179824.1|CB179824 EST0929 Zea mays sperm cell cDNA library Zea mays cDNA clone Zmsp3723 5', mRNA sequence Length = 691 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 480 ggcgagcgcgagctcgacg 498 ||||||||||||||||||| Sbjct: 361 ggcgagcgcgagctcgacg 379 >gi|28422669|gb|CB251958.1|CB251958 3529_1_19_1_A09.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 539 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 247 atcctccggccggagccgaacgg 269 >gi|30052186|gb|AI065475.2|AI065475 af84a03.s1 maize inflorescence immature ear library Zea mays cDNA clone af84a03 3', mRNA sequence Length = 473 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 745 agcagcagcgtcgacgcggccgc 767 ||||||||||||||||| ||||| Sbjct: 298 agcagcagcgtcgacgccgccgc 320 >gi|30088166|gb|CB886371.1|CB886371 3529_1_94_1_G08.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 478 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 165 atcctccggccggagccgaacgg 187 >gi|32826553|gb|CD966231.1|CD966231 SEN_250 GeneTag2 Zea mays cDNA, mRNA sequence Length = 194 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 409 gcctcggccatgtcgaactcggc 431 |||||||||||||||| |||||| Sbjct: 66 gcctcggccatgtcgagctcggc 44 >gi|32926037|gb|CF030849.1|CF030849 QCD27c04.yg QCD Zea mays cDNA clone QCD27c04, mRNA sequence Length = 468 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 214 atcctccggccggagccgaacgg 236 >gi|37384410|gb|CF629274.1|CF629274 zmrws48_0A10-015-d05.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 576 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 269 atcctccggccggagccgaacgg 291 >gi|37385655|gb|CF629981.1|CF629981 zmrws48_0A20-007-e10.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 597 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 419 atcctccggccggagccgaacgg 441 >gi|37397922|gb|CF636269.1|CF636269 zmrww00_0B10-006-g08.s4 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 842 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 423 atcctccggccggagccgaacgg 445 >gi|45847336|gb|CN071279.1|CN071279 1021010C08.x1 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 588 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 230 atcctccggccggagccgaacgg 252 >gi|50322876|gb|CO518002.1|CO518002 3530_1_117_1_C08.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 627 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagt 565 ||||||| ||||||||||| |||||||||| Sbjct: 456 cggccggacccgaacggcagcagctcgaagt 486 >gi|50325494|gb|CO520620.1|CO520620 3530_1_136_1_B10.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 520 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 381 cacatcctccggccggacccgaacgccagga 411 >gi|50328832|gb|CO523958.1|CO523958 3530_1_158_1_D11.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 484 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 331 cacatcctccggccggacccgaacgccagga 361 >gi|60340375|gb|DN207348.1|DN207348 MEST847_G06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 681 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 277 atcctccggccggagccgaacgg 299 >gi|60343479|gb|DN210452.1|DN210452 MEST898_F05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 656 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 442 atcctccggccggagccgaacgg 464 >gi|60396353|gb|DN229222.1|DN229222 MEST1012_F06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 720 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 457 atcctccggccggagccgaacgg 479 >gi|60399653|gb|DN232463.1|DN232463 MEST1180_A12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 571 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 334 cacatcctccggccggacccgaacgccagga 364 >gi|71305342|gb|DR788804.1|DR788804 ZM_BFb0006P17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 754 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 305 cacatcctccggccggacccgaacgccagga 335 >gi|71310784|gb|DR791689.1|DR791689 ZM_BFb0011E08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 619 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 535 cggccggcgccgaacggcaggagctcgaagt 565 ||||||| ||||||||||| |||||||||| Sbjct: 385 cggccggacccgaacggcagcagctcgaagt 415 >gi|71317229|gb|DR795302.1|DR795302 ZM_BFb0016G13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 739 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 605 accgctcggggcggaactc 623 ||||||||||||||||||| Sbjct: 125 accgctcggggcggaactc 107 >gi|71444754|gb|DR825804.1|DR825804 ZM_BFb0068E15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 889 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 826 atcctccggccggagccgaacgg 804 >gi|71756667|gb|DR954604.1|DR954604 ZM_BFb0047C24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 604 Score = 38.2 bits (19), Expect = 1.6 Identities = 34/39 (87%) Strand = Plus / Plus Query: 539 cggcgccgaacggcaggagctcgaagtcggcgcccttga 577 |||||||||||||||| | ||||||||||||||||| Sbjct: 402 cggcgccgaacggcagcacgcggaagtcggcgcccttga 440 >gi|76021470|gb|DT948640.1|DT948640 ZM_BFb0137J02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 723 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 456 atcctccggccggagccgaacgg 434 >gi|76293912|gb|DV033480.1|DV033480 ZM_BFb0157L17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 666 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 303 cacatcctccggccggacccgaacgccagga 333 >gi|78023537|gb|DV491924.1|DV491924 1000084-F04.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 647 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 285 atcctccggccggagccgaacgg 307 >gi|78076917|gb|DV505351.1|DV505351 ZM_BFb0182K08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 684 Score = 38.2 bits (19), Expect = 1.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 536 ggccggcgccgaacggcag 554 ||||||||||||||||||| Sbjct: 402 ggccggcgccgaacggcag 420 >gi|78077882|gb|DV506307.1|DV506307 ZM_BFb0183P18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 724 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 421 cacatcctccggccggacccgaacgccagga 451 >gi|78079774|gb|DV508186.1|DV508186 ZM_BFb0186K23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 622 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|78083637|gb|DV512030.1|DV512030 ZM_BFb0192I04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 633 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|78104230|gb|DV522648.1|DV522648 ZM_BFb0208I07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 798 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|78107505|gb|DV525923.1|DV525923 ZM_BFb0213F09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 713 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|78109546|gb|DV527962.1|DV527962 ZM_BFb0216D20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 658 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|86471189|gb|DY237559.1|DY237559 ZM_BFb0254M07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 612 Score = 38.2 bits (19), Expect = 1.6 Identities = 28/31 (90%) Strand = Plus / Plus Query: 526 cacatcctccggccggcgccgaacggcagga 556 |||||||||||||||| ||||||| ||||| Sbjct: 280 cacatcctccggccggacccgaacgccagga 310 >gi|88746976|gb|DY531117.1|DY531117 ZM_BFb0249L18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 683 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 423 atcctccggccggagccgaacgg 445 >gi|89755580|gb|DY685952.1|DY685952 ZM_BFb0272L14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 336 Score = 38.2 bits (19), Expect = 1.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 529 atcctccggccggcgccgaacgg 551 ||||||||||||| ||||||||| Sbjct: 199 atcctccggccggagccgaacgg 221 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 307,612 Number of Sequences: 836351 Number of extensions: 307612 Number of successful extensions: 31126 Number of sequences better than 10.0: 396 Number of HSP's better than 10.0 without gapping: 394 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 30539 Number of HSP's gapped (non-prelim): 510 length of query: 767 length of database: 669,372,029 effective HSP length: 19 effective length of query: 748 effective length of database: 653,481,360 effective search space: 488804057280 effective search space used: 488804057280 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)