BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 3438088.2.1 (615 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|6342670|gb|AW165494.1|AW165494 618047B12.x1 618 - Inbred Tass... 1172 0.0 gi|50334087|gb|CO529213.1|CO529213 3530_1_193_1_A12.x_1 3530 - F... 1172 0.0 gi|71426407|gb|DR807457.1|DR807457 ZM_BFb0033M04.f ZM_BFb Zea ma... 1172 0.0 gi|76285582|gb|DV025150.1|DV025150 ZM_BFb0145K03.f ZM_BFb Zea ma... 1172 0.0 gi|78027685|gb|DV496072.1|DV496072 1000206-E04.T7-1 UGI-Reseq Ze... 1164 0.0 gi|78544951|gb|DV622449.1|DV622449 IV-1091-402D-H02.T7-1 UGIV-10... 1164 0.0 gi|78025814|gb|DV494201.1|DV494201 1000206-E05.T7-1 UGI-Reseq Ze... 1156 0.0 gi|21331869|gb|BQ487250.1|BQ487250 1091052D07.x1 1091 - Immature... 1104 0.0 gi|6431791|gb|AW171995.1|AW171995 618047B12.y1 618 - Inbred Tass... 827 0.0 gi|24764164|gb|CA399331.1|CA399331 EL01N0317D04.g Endosperm_3 Ze... 779 0.0 gi|60351728|gb|DN218701.1|DN218701 MEST1070_B11.T7-1 UGA-ZmSAM-X... 517 e-145 gi|71308746|gb|DR790610.1|DR790610 ZM_BFb0009K12.f ZM_BFb Zea ma... 517 e-145 gi|74241493|gb|DT649407.1|DT649407 ZM_BFb0112B16.f ZM_BFb Zea ma... 502 e-140 gi|22542815|gb|BU093253.1|BU093253 1091058B12.x1 1091 - Immature... 486 e-135 gi|21216531|gb|AY111941.1| Zea mays CL68270_1 mRNA sequence 416 e-114 gi|21216531|gb|AY111941.1| Zea mays CL68270_1 mRNA sequence 416 e-114 gi|50329137|gb|CO524263.1|CO524263 3530_1_160_1_E11.x_1 3530 - F... 325 4e-87 gi|12973793|gb|BG268656.1|BG268656 1000206E04.x2 1000 - Unigene ... 315 4e-84 gi|86467497|gb|DY233867.1|DY233867 ZM_BFb0243L07.f ZM_BFb Zea ma... 220 2e-55 gi|32846285|gb|CD985966.1|CD985966 QAN16f12.yg QAN Zea mays cDNA... 70 4e-10 gi|32847775|gb|CD987456.1|CD987456 QAO1a06.yg QAO Zea mays cDNA ... 70 4e-10 gi|32848452|gb|CD988133.1|CD988133 QAO9c02.yg QAO Zea mays cDNA ... 70 4e-10 gi|32849905|gb|CD989586.1|CD989586 QAT3h08.yg QAT Zea mays cDNA ... 70 4e-10 gi|32850358|gb|CD990039.1|CD990039 QAV2d09.yg QAV Zea mays cDNA ... 70 4e-10 gi|32938675|gb|CF043494.1|CF043494 QCJ18b10.yg QCJ Zea mays cDNA... 70 4e-10 gi|32939292|gb|CF044111.1|CF044111 QCJ25d11.yg QCJ Zea mays cDNA... 70 4e-10 gi|32849937|gb|CD989618.1|CD989618 QAT4d01.yg QAT Zea mays cDNA ... 66 6e-09 gi|13490652|gb|BG517416.1|BG517416 947062C10.y1 947 - 2 week sho... 62 9e-08 gi|24768931|gb|CA404060.1|CA404060 EL01N0511D04.g Endosperm_4 Ze... 62 9e-08 gi|31353920|gb|CD438277.1|CD438277 EL01N0511D04.b Endosperm_5 Ze... 62 9e-08 gi|33467240|gb|CF244289.1|CF244289 3530_1_28_1_D03.x_1 3530 - Fu... 62 9e-08 gi|37393645|gb|CF634088.1|CF634088 zmrww00_0A10-008-b10.s0 zmrww... 62 9e-08 gi|60339973|gb|DN206946.1|DN206946 MEST841_C08.T7-1 UGA-ZmSAM-XZ... 62 9e-08 gi|60354843|gb|DN221816.1|DN221816 MEST1120_D03.T7-1 UGA-ZmSAM-X... 62 9e-08 gi|67010311|gb|CO439060.1|CO439060 MZCCL10001D11.g Maize Endospe... 62 9e-08 gi|67023594|gb|CO452343.1|CO452343 MZCCL10177A05.g Maize Endospe... 62 9e-08 gi|71428264|gb|DR809314.1|DR809314 ZM_BFb0036H09.f ZM_BFb Zea ma... 62 9e-08 gi|74239514|gb|DT647428.1|DT647428 ZM_BFb0108G12.r ZM_BFb Zea ma... 62 9e-08 gi|84976768|gb|DW475190.1|DW475190 0241 Zea mays central cell cD... 62 9e-08 gi|54652638|gb|BT017857.1| Zea mays clone EL01N0511D04.c mRNA se... 62 9e-08 gi|21207273|gb|AY104195.1| Zea mays PCO094435 mRNA sequence 62 9e-08 gi|85540233|gb|BT023982.1| Zea mays clone EL01N0414A03 mRNA sequ... 62 9e-08 gi|85540233|gb|BT023982.1| Zea mays clone EL01N0414A03 mRNA sequ... 62 9e-08 gi|54652638|gb|BT017857.1| Zea mays clone EL01N0511D04.c mRNA se... 62 9e-08 gi|21207273|gb|AY104195.1| Zea mays PCO094435 mRNA sequence 62 9e-08 gi|67024772|gb|CO453521.1|CO453521 MZCCL10193F12.g Maize Endospe... 58 1e-06 gi|6020730|gb|AW065538.1|AW065538 614059H06.y1 614 - root cDNA l... 54 2e-05 gi|6859920|gb|AW355914.1|AW355914 707015H12.x1 707 - Mixed adult... 54 2e-05 gi|12045747|gb|BF727886.1|BF727886 1000054D09.x3 1000 - Unigene ... 54 2e-05 gi|13149353|gb|BG319675.1|BG319675 Zm03_07e07_A Zm03_AAFC_ECORC_... 54 2e-05 gi|37380273|gb|CF626933.1|CF626933 zmrws05_0B20-004-h06.s4 zmrws... 54 2e-05 gi|37380768|gb|CF627218.1|CF627218 zmrws05_0B20-008-d12.s4 zmrws... 54 2e-05 gi|37380948|gb|CF627322.1|CF627322 zmrws05_0B20-009-h01.s2 zmrws... 54 2e-05 gi|37396834|gb|CF635711.1|CF635711 zmrww00_0A20-013-f06.s2 zmrww... 54 2e-05 gi|37397108|gb|CF635849.1|CF635849 zmrww00_0B10-001-c04.s1 zmrww... 54 2e-05 gi|40335079|gb|CK369149.1|CK369149 zmrws055_0B21-004-h06.s0 zmrw... 54 2e-05 gi|50324782|gb|CO519908.1|CO519908 3530_1_131_1_B03.x_1 3530 - F... 54 2e-05 gi|67014779|gb|CO443528.1|CO443528 MZCCL10062D12.g Maize Endospe... 54 2e-05 gi|71430048|gb|DR811098.1|DR811098 ZM_BFb0039C16.f ZM_BFb Zea ma... 54 2e-05 gi|71431449|gb|DR812499.1|DR812499 ZM_BFb0041D16.f ZM_BFb Zea ma... 54 2e-05 gi|71436025|gb|DR817075.1|DR817075 ZM_BFb0050D23.f ZM_BFb Zea ma... 54 2e-05 gi|71446595|gb|DR827645.1|DR827645 ZM_BFb0070P09.f ZM_BFb Zea ma... 54 2e-05 gi|71758473|gb|DR956410.1|DR956410 ZM_BFb0052N19.f ZM_BFb Zea ma... 54 2e-05 gi|74235589|gb|DT643503.1|DT643503 ZM_BFb0102I08.f ZM_BFb Zea ma... 54 2e-05 gi|76015967|gb|DT943137.1|DT943137 ZM_BFb0128O14.f ZM_BFb Zea ma... 54 2e-05 gi|78081453|gb|DV509865.1|DV509865 ZM_BFb0189D12.f ZM_BFb Zea ma... 54 2e-05 gi|78114458|gb|DV532847.1|DV532847 ZM_BFb0223L05.f ZM_BFb Zea ma... 54 2e-05 gi|78180864|gb|DV551237.1|DV551237 1000054-D09.GAD10-F UGI-Reseq... 54 2e-05 gi|91052738|gb|EB163156.1|EB163156 ZM_BFb0303P18.f ZM_BFb Zea ma... 54 2e-05 gi|91052739|gb|EB163157.1|EB163157 ZM_BFb0303P18.r ZM_BFb Zea ma... 54 2e-05 gi|91055179|gb|EB165597.1|EB165597 ZM_BFb0341I07.f ZM_BFb Zea ma... 54 2e-05 gi|91877342|gb|EB407299.1|EB407299 ZM_BFb0319G15.f ZM_BFb Zea ma... 54 2e-05 gi|93013167|gb|EB638687.1|EB638687 ZM_BFb0326A13.f ZM_BFb Zea ma... 54 2e-05 gi|93016768|gb|EB642288.1|EB642288 ZM_BFb0332I14.f ZM_BFb Zea ma... 54 2e-05 gi|93016769|gb|EB642289.1|EB642289 ZM_BFb0332I14.r ZM_BFb Zea ma... 54 2e-05 gi|18177276|gb|BM378486.1|BM378486 MEST564-A07.univ ISUM7 Zea ma... 52 8e-05 gi|21828651|gb|BQ703335.1|BQ703335 946108D02.x1 946 - tassel pri... 52 8e-05 gi|32927528|gb|CF032340.1|CF032340 QCE1e12.yg QCE Zea mays cDNA ... 52 8e-05 gi|32927544|gb|CF032356.1|CF032356 QCE1g09.yg QCE Zea mays cDNA ... 52 8e-05 gi|32927676|gb|CF032488.1|CF032488 QCE3f02.yg QCE Zea mays cDNA ... 52 8e-05 gi|32927847|gb|CF032659.1|CF032659 QCE6c05.yg QCE Zea mays cDNA ... 52 8e-05 gi|13490923|gb|BG517687.1|BG517687 947070B01.y1 947 - 2 week sho... 50 3e-04 gi|37384531|gb|CF629347.1|CF629347 zmrws48_0A10-016-c07.s3 zmrws... 50 3e-04 gi|37384859|gb|CF629529.1|CF629529 zmrws48_0A20-002-d12.s2 zmrws... 50 3e-04 gi|37391948|gb|CF633219.1|CF633219 zmrws48_0B20-013-a11.s3 zmrws... 50 3e-04 gi|40335617|gb|CK369687.1|CK369687 zmrws485_0A21-002-d12.s0 zmrw... 50 3e-04 gi|37398064|gb|CF636341.1|CF636341 zmrww00_0B10-007-f09.s4 zmrww... 48 0.001 gi|71765912|gb|DR963849.1|DR963849 ZM_BFb0082P21.f ZM_BFb Zea ma... 48 0.001 gi|5901174|gb|AW042274.1|AW042274 614026D12.y1 614 - root cDNA l... 46 0.005 gi|6194458|gb|AW146562.1|AW146562 614073E07.y3 614 - root cDNA l... 46 0.005 gi|32927600|gb|CF032412.1|CF032412 QCE2e07.yg QCE Zea mays cDNA ... 46 0.005 gi|44901557|gb|CK828102.1|CK828102 zmrww00_0A21-014-a01.s0 zmrww... 46 0.005 gi|45567834|gb|CK985769.1|CK985769 zmrsub1_0A20-011-g02.s4 zmrsu... 46 0.005 gi|67026010|gb|CO454759.1|CO454759 MZCCL10212C07.g Maize Endospe... 46 0.005 gi|88757747|gb|DY541888.1|DY541888 ZM_BFb0367B23.f ZM_BFb Zea ma... 46 0.005 gi|91049844|gb|EB160262.1|EB160262 ZM_BFb0298A04.f ZM_BFb Zea ma... 46 0.005 gi|16379856|gb|BI993181.1|BI993181 1020074B03.x3 1020 - Unigene ... 44 0.021 gi|16918963|gb|BM073975.1|BM073975 MEST78-E04.T3 ISUM4-TN Zea ma... 44 0.021 gi|32927356|gb|CF032168.1|CF032168 QCE15b04.yg QCE Zea mays cDNA... 44 0.021 gi|33466434|gb|CF243483.1|CF243483 3530_1_21_1_E01.y_1 3530 - Fu... 44 0.021 gi|37425514|gb|CF650500.1|CF650500 3530_1_88_1_B03.x_1 3530 - Fu... 44 0.021 gi|50326569|gb|CO521695.1|CO521695 3530_1_143_1_C02.y_1 3530 - F... 44 0.021 gi|50326608|gb|CO521734.1|CO521734 3530_1_143_1_E05.y_1 3530 - F... 44 0.021 gi|50327104|gb|CO522230.1|CO522230 3530_1_146_1_F07.y_1 3530 - F... 44 0.021 gi|50327241|gb|CO522367.1|CO522367 3530_1_147_1_F02.y_1 3530 - F... 44 0.021 gi|50330631|gb|CO525757.1|CO525757 3530_1_171_1_B09.y_1 3530 - F... 44 0.021 gi|50332007|gb|CO527133.1|CO527133 3530_1_17_1_E01.y_1 3530 - Fu... 44 0.021 gi|60399081|gb|DN231895.1|DN231895 MEST1080_A09.T7-1 UGA-ZmSAM-X... 44 0.021 gi|67014587|gb|CO443336.1|CO443336 MZCCL10056A08.g Maize Endospe... 44 0.021 gi|67014905|gb|CO443654.1|CO443654 MZCCL10048A09.g Maize Endospe... 44 0.021 gi|71299558|gb|DR785788.1|DR785788 ZM_BFb0002H07.r ZM_BFb Zea ma... 44 0.021 gi|71307347|gb|DR789865.1|DR789865 ZM_BFb0008J13.r ZM_BFb Zea ma... 44 0.021 gi|71311766|gb|DR792330.1|DR792330 ZM_BFb0012C08.r ZM_BFb Zea ma... 44 0.021 gi|71423703|gb|DR806132.1|DR806132 ZM_BFb0031O17.r ZM_BFb Zea ma... 44 0.021 gi|71430206|gb|DR811256.1|DR811256 ZM_BFb0039G03.r ZM_BFb Zea ma... 44 0.021 gi|71435019|gb|DR816069.1|DR816069 ZM_BFb0047A11.r ZM_BFb Zea ma... 44 0.021 gi|71436080|gb|DR817130.1|DR817130 ZM_BFb0050F08.r ZM_BFb Zea ma... 44 0.021 gi|71440687|gb|DR821737.1|DR821737 ZM_BFb0061E21.r ZM_BFb Zea ma... 44 0.021 gi|71769306|gb|DR967243.1|DR967243 ZM_BFb0088A11.r ZM_BFb Zea ma... 44 0.021 gi|74232717|gb|DT640631.1|DT640631 ZM_BFb0098F11.r ZM_BFb Zea ma... 44 0.021 gi|74233533|gb|DT641447.1|DT641447 ZM_BFb0099I06.r ZM_BFb Zea ma... 44 0.021 gi|74236601|gb|DT644515.1|DT644515 ZM_BFb0104A15.r ZM_BFb Zea ma... 44 0.021 gi|76012385|gb|DT939555.1|DT939555 ZM_BFb0121P19.r ZM_BFb Zea ma... 44 0.021 gi|76013280|gb|DT940450.1|DT940450 ZM_BFb0123E19.r ZM_BFb Zea ma... 44 0.021 gi|76020041|gb|DT947211.1|DT947211 ZM_BFb0135E19.r ZM_BFb Zea ma... 44 0.021 gi|76020527|gb|DT947697.1|DT947697 ZM_BFb0136B12.r ZM_BFb Zea ma... 44 0.021 gi|76020893|gb|DT948063.1|DT948063 ZM_BFb0136K07.r ZM_BFb Zea ma... 44 0.021 gi|76287010|gb|DV026578.1|DV026578 ZM_BFb0147K19.r ZM_BFb Zea ma... 44 0.021 gi|76918904|gb|DV167501.1|DV167501 ZM_BFb0165K06.r ZM_BFb Zea ma... 44 0.021 gi|78082312|gb|DV510724.1|DV510724 ZM_BFb0190I08.r ZM_BFb Zea ma... 44 0.021 gi|78083740|gb|DV512133.1|DV512133 ZM_BFb0192K15.r ZM_BFb Zea ma... 44 0.021 gi|78085312|gb|DV513705.1|DV513705 ZM_BFb0195A15.r ZM_BFb Zea ma... 44 0.021 gi|78089120|gb|DV517508.1|DV517508 ZM_BFb0201A24.r ZM_BFb Zea ma... 44 0.021 gi|78111953|gb|DV530349.1|DV530349 ZM_BFb0220B16.r ZM_BFb Zea ma... 44 0.021 gi|78112281|gb|DV530675.1|DV530675 ZM_BFb0220I17.r ZM_BFb Zea ma... 44 0.021 gi|78113946|gb|DV532335.1|DV532335 ZM_BFb0222P12.r ZM_BFb Zea ma... 44 0.021 gi|86474751|gb|DY241121.1|DY241121 ZM_BFb0261F07.r ZM_BFb Zea ma... 44 0.021 gi|88756787|gb|DY540928.1|DY540928 ZM_BFb0358J21.r ZM_BFb Zea ma... 44 0.021 gi|89758009|gb|DY687352.1|DY687352 ZM_BFb0276O17.f ZM_BFb Zea ma... 44 0.021 gi|89762420|gb|DY690011.1|DY690011 ZM_BFb0287A07.r ZM_BFb Zea ma... 44 0.021 gi|91056069|gb|EB166487.1|EB166487 ZM_BFb0348I16.r ZM_BFb Zea ma... 44 0.021 gi|91868699|gb|EB400121.1|EB400121 ZM_BFb0304P06.r ZM_BFb Zea ma... 44 0.021 gi|6654292|gb|AW267697.1|AW267697 687088H10.x1 687 - Early embry... 42 0.081 gi|20803054|gb|BQ294104.1|BQ294104 1091026C07.y2 1091 - Immature... 40 0.32 gi|21891489|gb|BQ744702.1|BQ744702 946108D02.y1 946 - tassel pri... 40 0.32 gi|26457071|gb|CA828654.1|CA828654 1114031E04.y2 1114 - Unigene ... 40 0.32 gi|31558489|gb|CD527701.1|CD527701 3529_1_122_1_D01.y_1 3529 - 2... 40 0.32 gi|32850717|gb|CD990398.1|CD990398 QAW3d09.yg QAW Zea mays cDNA ... 40 0.32 gi|32927901|gb|CF032713.1|CF032713 QCE7a03.yg QCE Zea mays cDNA ... 40 0.32 gi|32931527|gb|CF036339.1|CF036339 QCG30a06.yg QCG Zea mays cDNA... 40 0.32 gi|40337331|gb|CK371401.1|CK371401 zmrww005_0B10-007-f09.s0 zmrw... 40 0.32 gi|67017289|gb|CO446038.1|CO446038 MZCCL10118F11.g Maize Endospe... 40 0.32 gi|67022056|gb|CO450805.1|CO450805 MZCCL10155D04.g Maize Endospe... 40 0.32 gi|76288341|gb|DV027909.1|DV027909 ZM_BFb0149K08.r ZM_BFb Zea ma... 40 0.32 gi|78077137|gb|DV505571.1|DV505571 ZM_BFb0182P06.r ZM_BFb Zea ma... 40 0.32 gi|78121165|gb|DV539549.1|DV539549 ZM_BFb0233H08.r ZM_BFb Zea ma... 40 0.32 gi|88754821|gb|DY538962.1|DY538962 ZM_BFb0297C10.r ZM_BFb Zea ma... 40 0.32 gi|91870878|gb|EB401127.1|EB401127 ZM_BFb0306P05.r ZM_BFb Zea ma... 40 0.32 gi|91206523|gb|AC184871.1| Zea mays chromosome UNK clone CH201-1... 40 0.32 gi|5915595|gb|AW053236.1|AW053236 614073E07.x1 614 - root cDNA l... 38 1.3 gi|13150844|gb|BG321166.1|BG321166 Zm04_05a07_R Zm04_AAFC_ECORC_... 38 1.3 gi|20811068|gb|BQ295546.1|BQ295546 1091037C10.y2 1091 - Immature... 38 1.3 gi|26456545|gb|CA828128.1|CA828128 1114024B11.y2 1114 - Unigene ... 38 1.3 gi|30031795|gb|CB833646.1|CB833646 3529_1_83_1_A04.y_1 3529 - 2 ... 38 1.3 gi|30031812|gb|CB833663.1|CB833663 3529_1_83_1_B03.y_1 3529 - 2 ... 38 1.3 gi|32799970|gb|CD952206.1|CD952206 SBB_103 GeneTag2 Zea mays cDN... 38 1.3 gi|32906863|gb|CF011676.1|CF011676 QBK10h04.xg QBK Zea mays cDNA... 38 1.3 gi|37417434|gb|CF646370.1|CF646370 3530_1_112_1_H03.x_1 3530 - F... 38 1.3 gi|37418732|gb|CF647038.1|CF647038 3530_1_37_1_H04.x_1 3530 - Fu... 38 1.3 gi|50326127|gb|CO521253.1|CO521253 3530_1_140_1_D10.x_1 3530 - F... 38 1.3 gi|50326128|gb|CO521254.1|CO521254 3530_1_140_1_D10.y_1 3530 - F... 38 1.3 gi|50327086|gb|CO522212.1|CO522212 3530_1_146_1_E09.x_1 3530 - F... 38 1.3 gi|50327087|gb|CO522213.1|CO522213 3530_1_146_1_E09.y_1 3530 - F... 38 1.3 gi|67014653|gb|CO443402.1|CO443402 MZCCL10056G10.g Maize Endospe... 38 1.3 gi|67019974|gb|CO448723.1|CO448723 MZCCL10131D01.g Maize Endospe... 38 1.3 gi|67027655|gb|CO456404.1|CO456404 MZCCS15005H10.g Maize Endospe... 38 1.3 gi|71302523|gb|DR787380.1|DR787380 ZM_BFb0004M15.r ZM_BFb Zea ma... 38 1.3 gi|71319861|gb|DR796687.1|DR796687 ZM_BFb0018H06.r ZM_BFb Zea ma... 38 1.3 gi|71327068|gb|DR800176.1|DR800176 ZM_BFb0023H07.r ZM_BFb Zea ma... 38 1.3 gi|71429846|gb|DR810896.1|DR810896 ZM_BFb0038N21.r ZM_BFb Zea ma... 38 1.3 gi|71433543|gb|DR814593.1|DR814593 ZM_BFb0044F03.r ZM_BFb Zea ma... 38 1.3 gi|71439229|gb|DR820279.1|DR820279 ZM_BFb0058F12.r ZM_BFb Zea ma... 38 1.3 gi|71446594|gb|DR827644.1|DR827644 ZM_BFb0070P08.r ZM_BFb Zea ma... 38 1.3 gi|71768220|gb|DR966157.1|DR966157 ZM_BFb0086G07.r ZM_BFb Zea ma... 38 1.3 gi|71769718|gb|DR967655.1|DR967655 ZM_BFb0088J18.f ZM_BFb Zea ma... 38 1.3 gi|71769719|gb|DR967656.1|DR967656 ZM_BFb0088J18.r ZM_BFb Zea ma... 38 1.3 gi|71771280|gb|DR969217.1|DR969217 ZM_BFb0090N19.r ZM_BFb Zea ma... 38 1.3 gi|71772142|gb|DR970079.1|DR970079 ZM_BFb0092B24.r ZM_BFb Zea ma... 38 1.3 gi|71773349|gb|DR971253.1|DR971253 ZM_BFb0093N21.f ZM_BFb Zea ma... 38 1.3 gi|74232889|gb|DT640803.1|DT640803 ZM_BFb0098J06.r ZM_BFb Zea ma... 38 1.3 gi|74233933|gb|DT641847.1|DT641847 ZM_BFb0100B13.f ZM_BFb Zea ma... 38 1.3 gi|74233934|gb|DT641848.1|DT641848 ZM_BFb0100B13.r ZM_BFb Zea ma... 38 1.3 gi|74234614|gb|DT642528.1|DT642528 ZM_BFb0101B09.f ZM_BFb Zea ma... 38 1.3 gi|74234615|gb|DT642529.1|DT642529 ZM_BFb0101B09.r ZM_BFb Zea ma... 38 1.3 gi|74238189|gb|DT646103.1|DT646103 ZM_BFb0106H06.f ZM_BFb Zea ma... 38 1.3 gi|74238190|gb|DT646104.1|DT646104 ZM_BFb0106H06.r ZM_BFb Zea ma... 38 1.3 gi|74242342|gb|DT650256.1|DT650256 ZM_BFb0113L01.r ZM_BFb Zea ma... 38 1.3 gi|74244292|gb|DT652206.1|DT652206 ZM_BFb0118C02.r ZM_BFb Zea ma... 38 1.3 gi|76010491|gb|DT937661.1|DT937661 ZM_BFb0117D12.f ZM_BFb Zea ma... 38 1.3 gi|76010492|gb|DT937662.1|DT937662 ZM_BFb0117D12.r ZM_BFb Zea ma... 38 1.3 gi|76012256|gb|DT939426.1|DT939426 ZM_BFb0121K05.r ZM_BFb Zea ma... 38 1.3 gi|76012643|gb|DT939813.1|DT939813 ZM_BFb0122F15.f ZM_BFb Zea ma... 38 1.3 gi|76012644|gb|DT939814.1|DT939814 ZM_BFb0122F15.r ZM_BFb Zea ma... 38 1.3 gi|76014415|gb|DT941585.1|DT941585 ZM_BFb0125N12.f ZM_BFb Zea ma... 38 1.3 gi|76015034|gb|DT942204.1|DT942204 ZM_BFb0127D07.r ZM_BFb Zea ma... 38 1.3 gi|76020692|gb|DT947862.1|DT947862 ZM_BFb0136F17.f ZM_BFb Zea ma... 38 1.3 gi|76020693|gb|DT947863.1|DT947863 ZM_BFb0136F17.r ZM_BFb Zea ma... 38 1.3 gi|76283477|gb|DV023045.1|DV023045 ZM_BFb0142I01.r ZM_BFb Zea ma... 38 1.3 gi|76919754|gb|DV167852.1|DV167852 ZM_BFb0166D03.f ZM_BFb Zea ma... 38 1.3 gi|76929269|gb|DV171937.1|DV171937 ZM_BFb0172P18.r ZM_BFb Zea ma... 38 1.3 gi|76930300|gb|DV172324.1|DV172324 ZM_BFb0173M20.r ZM_BFb Zea ma... 38 1.3 gi|78073756|gb|DV502190.1|DV502190 ZM_BFb0173M20.f ZM_BFb Zea ma... 38 1.3 gi|78074538|gb|DV502972.1|DV502972 ZM_BFb0178B04.f ZM_BFb Zea ma... 38 1.3 gi|78076246|gb|DV504680.1|DV504680 ZM_BFb0181K16.f ZM_BFb Zea ma... 38 1.3 gi|78076247|gb|DV504681.1|DV504681 ZM_BFb0181K16.r ZM_BFb Zea ma... 38 1.3 gi|78076974|gb|DV505408.1|DV505408 ZM_BFb0182L13.f ZM_BFb Zea ma... 38 1.3 gi|78076975|gb|DV505409.1|DV505409 ZM_BFb0182L13.r ZM_BFb Zea ma... 38 1.3 gi|78081636|gb|DV510048.1|DV510048 ZM_BFb0189H17.r ZM_BFb Zea ma... 38 1.3 gi|78081833|gb|DV510245.1|DV510245 ZM_BFb0189M11.f ZM_BFb Zea ma... 38 1.3 gi|78081834|gb|DV510246.1|DV510246 ZM_BFb0189M11.r ZM_BFb Zea ma... 38 1.3 gi|78087054|gb|DV515447.1|DV515447 ZM_BFb0198A12.r ZM_BFb Zea ma... 38 1.3 gi|78087343|gb|DV515736.1|DV515736 ZM_BFb0198H05.r ZM_BFb Zea ma... 38 1.3 gi|78115240|gb|DV533628.1|DV533628 ZM_BFb0224M22.r ZM_BFb Zea ma... 38 1.3 gi|78115993|gb|DV534381.1|DV534381 ZM_BFb0225P06.r ZM_BFb Zea ma... 38 1.3 gi|84970326|gb|DW468676.1|DW468676 ZM_BFb0172P18.f ZM_BFb Zea ma... 38 1.3 gi|86466821|gb|DY233191.1|DY233191 ZM_BFb0242K13.f ZM_BFb Zea ma... 38 1.3 gi|86468770|gb|DY235140.1|DY235140 ZM_BFb0245L14.r ZM_BFb Zea ma... 38 1.3 gi|86469552|gb|DY235922.1|DY235922 ZM_BFb0246O08.r ZM_BFb Zea ma... 38 1.3 gi|86470590|gb|DY236960.1|DY236960 ZM_BFb0253K21.r ZM_BFb Zea ma... 38 1.3 gi|89248319|gb|DY620105.1|DY620105 ZM_BFb0278I08.r ZM_BFb Zea ma... 38 1.3 gi|89249942|gb|DY621728.1|DY621728 ZM_BFb0285K24.f ZM_BFb Zea ma... 38 1.3 gi|89755958|gb|DY686180.1|DY686180 ZM_BFb0274E01.r ZM_BFb Zea ma... 38 1.3 gi|91872441|gb|EB402398.1|EB402398 ZM_BFb0309D02.r ZM_BFb Zea ma... 38 1.3 gi|91873372|gb|EB403329.1|EB403329 ZM_BFb0310L10.f ZM_BFb Zea ma... 38 1.3 gi|91873373|gb|EB403330.1|EB403330 ZM_BFb0310L10.r ZM_BFb Zea ma... 38 1.3 gi|91878323|gb|EB408280.1|EB408280 ZM_BFb0320P22.r ZM_BFb Zea ma... 38 1.3 gi|93013716|gb|EB639236.1|EB639236 ZM_BFb0326O03.r ZM_BFb Zea ma... 38 1.3 gi|93015371|gb|EB640891.1|EB640891 ZM_BFb0330C04.r ZM_BFb Zea ma... 38 1.3 gi|93015694|gb|EB641214.1|EB641214 ZM_BFb0330K06.f ZM_BFb Zea ma... 38 1.3 gi|93017044|gb|EB642564.1|EB642564 ZM_BFb0332P12.r ZM_BFb Zea ma... 38 1.3 gi|21212172|gb|AY108884.1| Zea mays PCO064378 mRNA sequence 38 1.3 gi|47102550|gb|BV153093.1| PZA02282-74838-Mo17 Zea mays Mo17 Zea... 38 1.3 gi|21212172|gb|AY108884.1| Zea mays PCO064378 mRNA sequence 38 1.3 gi|92110175|gb|AC185312.1| Zea mays chromosome UNK clone CH201-3... 38 1.3 gi|90568153|gb|AC183941.1| Zea mays chromosome UNK clone CH201-9... 38 1.3 gi|58082471|gb|AC155612.2| Zea mays strain B73 clone ZMMBBc0286H... 38 1.3 gi|409620|gb|T12682.1|T12682 zEST00051-5 Maize Leaf, Stratagene ... 36 5.0 gi|4609652|gb|AI600491.1|AI600491 486075F03.x1 486 - leaf primor... 36 5.0 gi|5152836|gb|AI759134.1|AI759134 605085E09.x1 605 - Endosperm c... 36 5.0 gi|5819347|gb|AI987553.1|AI987553 614055E06.x1 614 - root cDNA l... 36 5.0 gi|7009419|gb|AW455684.1|AW455684 707089D07.x1 707 - Mixed adult... 36 5.0 gi|9794622|gb|BE552930.1|BE552930 946087E07.y1 946 - tassel prim... 36 5.0 gi|14243832|gb|BG841532.2|BG841532 MEST22-G01.T3 ISUM4-TN Zea ma... 36 5.0 gi|14244182|gb|BG841852.2|BG841852 MEST27-D01.T3 ISUM4-TN Zea ma... 36 5.0 gi|14996876|gb|BI319042.1|BI319042 949038D07.x2 949 - Juvenile l... 36 5.0 gi|16917025|gb|BM073093.1|BM073093 MEST60-D10.T3 ISUM4-TN Zea ma... 36 5.0 gi|16925048|gb|BM078116.1|BM078116 MEST115-C08.T3 ISUM4-TN Zea m... 36 5.0 gi|18163378|gb|BM333217.1|BM333217 MEST185-F02.T3 ISUM5-RN Zea m... 36 5.0 gi|18175375|gb|BM350720.1|BM350720 MEST212-H02.T3 ISUM5-RN Zea m... 36 5.0 gi|18179488|gb|BM380698.1|BM380698 MEST523-G03.univ ISUM6 Zea ma... 36 5.0 gi|18650024|gb|BM498843.1|BM498843 952024C05.y1 952 - BMS tissue... 36 5.0 gi|19437177|gb|BM953587.1|BM953587 952064A12.x1 952 - BMS tissue... 36 5.0 gi|19437178|gb|BM953588.1|BM953588 952064A12.y1 952 - BMS tissue... 36 5.0 gi|19822775|gb|BQ048799.1|BQ048799 952024C05.y2 952 - BMS tissue... 36 5.0 gi|22491330|gb|BU051253.1|BU051253 1111040G02.y2 1111 - Unigene ... 36 5.0 gi|28873289|gb|CB329301.1|CB329301 3529_1_29_1_B08.y_1 3529 - 2 ... 36 5.0 gi|28982982|gb|BQ538409.2|BQ538409 MEST600-G04.T3 ISUM4-TN Zea m... 36 5.0 gi|28983105|gb|BQ539467.2|BQ539467 MEST601-E05.T3 ISUM4-TN Zea m... 36 5.0 gi|29543862|gb|CB604242.1|CB604242 3529_1_56_1_C06.x_1 3529 - 2 ... 36 5.0 gi|31353371|gb|CD437728.1|CD437728 EL01N0504D06.b Endosperm_5 Ze... 36 5.0 gi|31358593|gb|CD442950.1|CD442950 EL01N0420A09.b Endosperm_4 Ze... 36 5.0 gi|31361024|gb|CD445381.1|CD445381 EL01N0450H05.b Endosperm_4 Ze... 36 5.0 gi|32863620|gb|CF003302.1|CF003302 QBH1a12.xg QBH Zea mays cDNA ... 36 5.0 gi|32863658|gb|CF003340.1|CF003340 QBH1d09.xg QBH Zea mays cDNA ... 36 5.0 gi|32910031|gb|CF014843.1|CF014843 QBL19e10.xg QBL Zea mays cDNA... 36 5.0 gi|32918884|gb|CF023696.1|CF023696 QBS10a02.xg QBS Zea mays cDNA... 36 5.0 gi|32933071|gb|CF037883.1|CF037883 QCH13g06.yg QCH Zea mays cDNA... 36 5.0 gi|32937956|gb|CF042775.1|CF042775 QCI7h01.yg QCI Zea mays cDNA ... 36 5.0 gi|37380172|gb|CF626869.1|CF626869 zmrws05_0B20-004-b06.s0 zmrws... 36 5.0 gi|37387449|gb|CF630918.1|CF630918 zmrws48_0B10-002-c02.s0 zmrws... 36 5.0 gi|40287168|gb|CK327560.1|CK327560 EST4870 Zea mays sperm cell c... 36 5.0 gi|40302904|gb|CK347291.1|CK347291 zmrsub1_0A20-003-a05.s0 zmrsu... 36 5.0 gi|40335016|gb|CK369086.1|CK369086 zmrws055_0B21-004-b06.s0 zmrw... 36 5.0 gi|40335769|gb|CK369839.1|CK369839 zmrws485_0B10-002-c02.s0 zmrw... 36 5.0 gi|50328857|gb|CO523983.1|CO523983 3530_1_158_1_F07.y_1 3530 - F... 36 5.0 gi|50338219|gb|CO533345.1|CO533345 3530_1_219_1_C12.x_1 3530 - F... 36 5.0 gi|60340512|gb|DN207485.1|DN207485 MEST850_F01.T7-1 UGA-ZmSAM-XZ... 36 5.0 gi|60342369|gb|DN209342.1|DN209342 MEST883_G11.T7-1 UGA-ZmSAM-XZ... 36 5.0 gi|60342397|gb|DN209370.1|DN209370 MEST884_A04.T7-1 UGA-ZmSAM-XZ... 36 5.0 gi|60342849|gb|DN209822.1|DN209822 MEST889_C02.T7-1 UGA-ZmSAM-XZ... 36 5.0 gi|60347185|gb|DN214158.1|DN214158 MEST992_A05.T7-1 UGA-ZmSAM-XZ... 36 5.0 gi|60349367|gb|DN216340.1|DN216340 MEST1033_C06.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60349801|gb|DN216774.1|DN216774 MEST1040_D10.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60355188|gb|DN222161.1|DN222161 MEST1124_D03.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60358015|gb|DN224988.1|DN224988 MEST1168_G01.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60358506|gb|DN225479.1|DN225479 MEST1175_E04.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60358517|gb|DN225490.1|DN225490 MEST1175_H06.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60394428|gb|DN227298.1|DN227298 MEST1203_H10.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60395464|gb|DN228334.1|DN228334 MEST1218_B04.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60399006|gb|DN231822.1|DN231822 MEST1210_A08.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60399273|gb|DN232087.1|DN232087 MEST1118_A10.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60399520|gb|DN232332.1|DN232332 MEST1001_A12.T7-1 UGA-ZmSAM-X... 36 5.0 gi|60399521|gb|DN232333.1|DN232333 MEST1002_A12.T7-1 UGA-ZmSAM-X... 36 5.0 gi|67011592|gb|CO440341.1|CO440341 MZCCL10019B12.g Maize Endospe... 36 5.0 gi|67022427|gb|CO451176.1|CO451176 MZCCL10161D11.g Maize Endospe... 36 5.0 gi|67026232|gb|CO454981.1|CO454981 MZCCL10210C04.g Maize Endospe... 36 5.0 gi|67029360|gb|CO458109.1|CO458109 MZCCS15013E10.g Maize Endospe... 36 5.0 gi|67030757|gb|CO459506.1|CO459506 MZCCS20019C07.g Maize Endospe... 36 5.0 gi|67039301|gb|CO465556.1|CO465556 MZCCS20033B09.g Maize Endospe... 36 5.0 gi|71304820|gb|DR788521.1|DR788521 ZM_BFb0006J05.r ZM_BFb Zea ma... 36 5.0 gi|71324268|gb|DR798836.1|DR798836 ZM_BFb0021I11.r ZM_BFb Zea ma... 36 5.0 gi|71328633|gb|DR800987.1|DR800987 ZM_BFb0024J13.r ZM_BFb Zea ma... 36 5.0 gi|71329715|gb|DR801580.1|DR801580 ZM_BFb0025H14.r ZM_BFb Zea ma... 36 5.0 gi|71332195|gb|DR803018.1|DR803018 ZM_BFb0027H24.r ZM_BFb Zea ma... 36 5.0 gi|71417051|gb|DR803906.1|DR803906 ZM_BFb0028M04.f ZM_BFb Zea ma... 36 5.0 gi|71417724|gb|DR804186.1|DR804186 ZM_BFb0029C14.r ZM_BFb Zea ma... 36 5.0 gi|71427120|gb|DR808170.1|DR808170 ZM_BFb0034M12.r ZM_BFb Zea ma... 36 5.0 gi|71429670|gb|DR810720.1|DR810720 ZM_BFb0038J11.r ZM_BFb Zea ma... 36 5.0 gi|71430878|gb|DR811928.1|DR811928 ZM_BFb0040G05.f ZM_BFb Zea ma... 36 5.0 gi|71430879|gb|DR811929.1|DR811929 ZM_BFb0040G05.r ZM_BFb Zea ma... 36 5.0 gi|71431796|gb|DR812846.1|DR812846 ZM_BFb0041L13.r ZM_BFb Zea ma... 36 5.0 gi|71432159|gb|DR813209.1|DR813209 ZM_BFb0042E04.r ZM_BFb Zea ma... 36 5.0 gi|71436377|gb|DR817427.1|DR817427 ZM_BFb0050M18.r ZM_BFb Zea ma... 36 5.0 gi|71437833|gb|DR818883.1|DR818883 ZM_BFb0054H16.r ZM_BFb Zea ma... 36 5.0 gi|71446573|gb|DR827623.1|DR827623 ZM_BFb0070O19.r ZM_BFb Zea ma... 36 5.0 gi|71763563|gb|DR961500.1|DR961500 ZM_BFb0078A11.f ZM_BFb Zea ma... 36 5.0 gi|71766284|gb|DR964221.1|DR964221 ZM_BFb0083I24.r ZM_BFb Zea ma... 36 5.0 gi|71768082|gb|DR966019.1|DR966019 ZM_BFb0086D01.r ZM_BFb Zea ma... 36 5.0 gi|74239863|gb|DT647777.1|DT647777 ZM_BFb0108O17.r ZM_BFb Zea ma... 36 5.0 gi|74241234|gb|DT649148.1|DT649148 ZM_BFb0111H15.r ZM_BFb Zea ma... 36 5.0 gi|74241623|gb|DT649537.1|DT649537 ZM_BFb0112F05.r ZM_BFb Zea ma... 36 5.0 gi|76010428|gb|DT937598.1|DT937598 ZM_BFb0117B19.r ZM_BFb Zea ma... 36 5.0 gi|76012139|gb|DT939309.1|DT939309 ZM_BFb0121E23.r ZM_BFb Zea ma... 36 5.0 gi|76016505|gb|DT943675.1|DT943675 ZM_BFb0129L14.r ZM_BFb Zea ma... 36 5.0 gi|76020583|gb|DT947753.1|DT947753 ZM_BFb0136D01.r ZM_BFb Zea ma... 36 5.0 gi|76020609|gb|DT947779.1|DT947779 ZM_BFb0136D16.r ZM_BFb Zea ma... 36 5.0 gi|76021524|gb|DT948694.1|DT948694 ZM_BFb0137K06.f ZM_BFb Zea ma... 36 5.0 gi|76282282|gb|DV021850.1|DV021850 ZM_BFb0140M11.f ZM_BFb Zea ma... 36 5.0 gi|76284463|gb|DV024031.1|DV024031 ZM_BFb0144A10.r ZM_BFb Zea ma... 36 5.0 gi|76289509|gb|DV029077.1|DV029077 ZM_BFb0151F14.r ZM_BFb Zea ma... 36 5.0 gi|76291594|gb|DV031162.1|DV031162 ZM_BFb0154F20.r ZM_BFb Zea ma... 36 5.0 gi|76293618|gb|DV033186.1|DV033186 ZM_BFb0157F01.f ZM_BFb Zea ma... 36 5.0 gi|76914786|gb|DV165691.1|DV165691 ZM_BFb0162M08.r ZM_BFb Zea ma... 36 5.0 gi|76917388|gb|DV166809.1|DV166809 ZM_BFb0164I20.r ZM_BFb Zea ma... 36 5.0 gi|76918826|gb|DV167470.1|DV167470 ZM_BFb0165J12.r ZM_BFb Zea ma... 36 5.0 gi|76926452|gb|DV170870.1|DV170870 ZM_BFb0170M10.r ZM_BFb Zea ma... 36 5.0 gi|76928077|gb|DV171476.1|DV171476 ZM_BFb0171O17.r ZM_BFb Zea ma... 36 5.0 gi|78021421|gb|DV489808.1|DV489808 1000031-H04.T7-1 UGI-Reseq Ze... 36 5.0 gi|78026941|gb|DV495328.1|DV495328 1000111-H06.T7-1 UGI-Reseq Ze... 36 5.0 gi|78073561|gb|DV501995.1|DV501995 ZM_BFb0129H23.r ZM_BFb Zea ma... 36 5.0 gi|78078617|gb|DV507029.1|DV507029 ZM_BFb0185A07.r ZM_BFb Zea ma... 36 5.0 gi|78079657|gb|DV508069.1|DV508069 ZM_BFb0186I06.r ZM_BFb Zea ma... 36 5.0 gi|78085264|gb|DV513657.1|DV513657 ZM_BFb0194P06.f ZM_BFb Zea ma... 36 5.0 gi|78085809|gb|DV514202.1|DV514202 ZM_BFb0196A21.r ZM_BFb Zea ma... 36 5.0 gi|78091130|gb|DV519504.1|DV519504 ZM_BFb0203P06.r ZM_BFb Zea ma... 36 5.0 gi|78091712|gb|DV520086.1|DV520086 ZM_BFb0204M22.r ZM_BFb Zea ma... 36 5.0 gi|78103907|gb|DV522327.1|DV522327 ZM_BFb0208A04.r ZM_BFb Zea ma... 36 5.0 gi|78105909|gb|DV524327.1|DV524327 ZM_BFb0210P16.r ZM_BFb Zea ma... 36 5.0 gi|78108623|gb|DV527041.1|DV527041 ZM_BFb0214O14.r ZM_BFb Zea ma... 36 5.0 gi|78110047|gb|DV528462.1|DV528462 ZM_BFb0216P07.r ZM_BFb Zea ma... 36 5.0 gi|78110658|gb|DV529063.1|DV529063 ZM_BFb0217M16.r ZM_BFb Zea ma... 36 5.0 gi|78111537|gb|DV529934.1|DV529934 ZM_BFb0219B04.f ZM_BFb Zea ma... 36 5.0 gi|78116043|gb|DV534431.1|DV534431 ZM_BFb0226A12.r ZM_BFb Zea ma... 36 5.0 gi|78123821|gb|DV542205.1|DV542205 ZM_BFb0237E22.r ZM_BFb Zea ma... 36 5.0 gi|78125070|gb|DV543454.1|DV543454 ZM_BFb0239H07.r ZM_BFb Zea ma... 36 5.0 gi|78125170|gb|DV543554.1|DV543554 ZM_BFb0239J23.r ZM_BFb Zea ma... 36 5.0 gi|84969911|gb|DW468313.1|DW468313 ZM_BFb0170M10.f ZM_BFb Zea ma... 36 5.0 gi|87153041|gb|DY397830.1|DY397830 III-952-10C-G02.M13-R UGIII-R... 36 5.0 gi|87153226|gb|DY398015.1|DY398015 III-952-4B-F01.M13-R UGIII-Re... 36 5.0 gi|88756066|gb|DY540207.1|DY540207 ZM_BFb0355G12.r ZM_BFb Zea ma... 36 5.0 gi|89248515|gb|DY620301.1|DY620301 ZM_BFb0278N12.r ZM_BFb Zea ma... 36 5.0 gi|89756009|gb|DY686211.1|DY686211 ZM_BFb0274F11.r ZM_BFb Zea ma... 36 5.0 gi|91048097|gb|EB158515.1|EB158515 ZM_BFb0291K12.r ZM_BFb Zea ma... 36 5.0 gi|91048897|gb|EB159315.1|EB159315 ZM_BFb0294I12.r ZM_BFb Zea ma... 36 5.0 gi|91052376|gb|EB162794.1|EB162794 ZM_BFb0303G20.f ZM_BFb Zea ma... 36 5.0 gi|91054189|gb|EB164607.1|EB164607 ZM_BFb0337B06.r ZM_BFb Zea ma... 36 5.0 gi|91056934|gb|EB167352.1|EB167352 ZM_BFb0382B17.r ZM_BFb Zea ma... 36 5.0 gi|91871916|gb|EB401873.1|EB401873 ZM_BFb0308D19.r ZM_BFb Zea ma... 36 5.0 gi|91877296|gb|EB407253.1|EB407253 ZM_BFb0319F11.f ZM_BFb Zea ma... 36 5.0 gi|91878365|gb|EB408322.1|EB408322 ZM_BFb0321B10.r ZM_BFb Zea ma... 36 5.0 gi|93012673|gb|EB638193.1|EB638193 ZM_BFb0325D13.r ZM_BFb Zea ma... 36 5.0 gi|93013938|gb|EB639458.1|EB639458 ZM_BFb0327F11.r ZM_BFb Zea ma... 36 5.0 gi|93014022|gb|EB639542.1|EB639542 ZM_BFb0327H17.r ZM_BFb Zea ma... 36 5.0 gi|93014137|gb|EB639657.1|EB639657 ZM_BFb0327L09.r ZM_BFb Zea ma... 36 5.0 gi|93015559|gb|EB641079.1|EB641079 ZM_BFb0330G17.r ZM_BFb Zea ma... 36 5.0 gi|93016233|gb|EB641753.1|EB641753 ZM_BFb0331J17.r ZM_BFb Zea ma... 36 5.0 gi|93016537|gb|EB642057.1|EB642057 ZM_BFb0332C18.r ZM_BFb Zea ma... 36 5.0 gi|54651505|gb|BT016724.1| Zea mays clone Contig557 mRNA sequence 36 5.0 gi|21208254|gb|AY105176.1| Zea mays PCO111982 mRNA sequence 36 5.0 gi|21211066|gb|AY107988.1| Zea mays PCO086949 mRNA sequence 36 5.0 gi|54651505|gb|BT016724.1| Zea mays clone Contig557 mRNA sequence 36 5.0 gi|21211066|gb|AY107988.1| Zea mays PCO086949 mRNA sequence 36 5.0 gi|21208254|gb|AY105176.1| Zea mays PCO111982 mRNA sequence 36 5.0 gi|89257778|gb|AC177894.2| Zea mays chromosome UNK clone CH201-2... 36 5.0 gi|58082466|gb|AC155607.2| Zea mays strain B73 clone ZMMBBc0259F... 36 5.0 gi|58082311|gb|AC155450.2| Zea mays strain B73 clone ZMMBBb0346K... 36 5.0 gi|57790154|gb|AC150780.2| Zea mays clone ZMMBBc0269J21, *** SEQ... 36 5.0 gi|57790149|gb|AC150253.2| Zea mays clone ZMMBBc0090N10, *** SEQ... 36 5.0 gi|57790156|gb|AC149831.2| Zea mays clone ZMMBBc0408K22, *** SEQ... 36 5.0 gi|58531563|gb|AC149308.3| Zea mays clone ZMMBBc0307H13, *** SEQ... 36 5.0 >gi|6342670|gb|AW165494.1|AW165494 618047B12.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 615 Score = 1172 bits (591), Expect = 0.0 Identities = 607/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 61 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 120 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 601 tcttcaaaggattct 615 >gi|50334087|gb|CO529213.1|CO529213 3530_1_193_1_A12.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 692 Score = 1172 bits (591), Expect = 0.0 Identities = 607/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 40 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 99 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 100 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 159 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 160 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 219 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 279 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 280 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 339 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 340 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 399 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 400 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 459 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 460 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 519 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 520 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 579 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 580 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 639 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 640 tcttcaaaggattct 654 >gi|71426407|gb|DR807457.1|DR807457 ZM_BFb0033M04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 796 Score = 1172 bits (591), Expect = 0.0 Identities = 607/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 113 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 172 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 173 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 232 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 233 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 292 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 293 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 352 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 353 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 412 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 413 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 472 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 473 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 532 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 533 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 592 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 593 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 652 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 653 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 712 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 713 tcttcaaaggattct 727 >gi|76285582|gb|DV025150.1|DV025150 ZM_BFb0145K03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 840 Score = 1172 bits (591), Expect = 0.0 Identities = 607/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 11 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 70 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 71 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 130 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 190 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 250 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 310 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 311 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 370 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 430 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 490 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 491 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 550 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 551 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 610 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 611 tcttcaaaggattct 625 >gi|78027685|gb|DV496072.1|DV496072 1000206-E04.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 667 Score = 1164 bits (587), Expect = 0.0 Identities = 606/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 29 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 88 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 89 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 148 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 208 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 209 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 268 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 269 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaaaacatgg 328 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 329 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 388 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 389 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 448 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 449 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 508 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 509 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 568 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 569 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 628 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 629 tcttcaaaggattct 643 >gi|78544951|gb|DV622449.1|DV622449 IV-1091-402D-H02.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 714 Score = 1164 bits (587), Expect = 0.0 Identities = 606/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 24 cccaggatatcagttactgaccccgacatccatgcaaaacgtagtactagtcctttacat 83 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 84 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 143 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 144 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 203 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 204 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 263 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 264 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 323 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 324 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 383 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 384 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 443 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 444 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 503 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 504 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 563 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 564 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 623 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 624 tcttcaaaggattct 638 >gi|78025814|gb|DV494201.1|DV494201 1000206-E05.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 644 Score = 1156 bits (583), Expect = 0.0 Identities = 605/615 (98%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 29 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 88 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 89 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 148 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 208 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 209 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 268 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| Sbjct: 269 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcaaaaaacatgg 328 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 329 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 388 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 389 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 448 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 449 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 508 Query: 481 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 509 tggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatcg 568 Query: 541 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 569 aggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctca 628 Query: 601 tcttcaaaggattct 615 ||||||||||||||| Sbjct: 629 tcttcaaaggattct 643 >gi|21331869|gb|BQ487250.1|BQ487250 1091052D07.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 608 Score = 1104 bits (557), Expect = 0.0 Identities = 594/608 (97%), Gaps = 1/608 (0%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 61 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 120 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacgg-t 239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacgggt 240 Query: 240 ttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatg 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 ttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatg 300 Query: 300 gtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactaga 359 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 gggttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactaga 360 Query: 360 ccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaac 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 ccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaac 420 Query: 420 ccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttc 479 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 421 ccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggttgggcttc 480 Query: 480 ttggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttagggatc 539 | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 481 tgggcgtccctccacttccaccctccttngcagccatagtgaacaccgttcttagggatc 540 Query: 540 gaggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctc 599 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 541 gaggcgccccgggggtgaacatgcctggggtaacgctttccgaacccaaccacgtagctc 600 Query: 600 atcttcaa 607 |||||||| Sbjct: 601 atcttcaa 608 >gi|6431791|gb|AW171995.1|AW171995 618047B12.y1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 420 Score = 827 bits (417), Expect = 0.0 Identities = 419/420 (99%) Strand = Plus / Minus Query: 103 tacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaacactaat 162 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 420 tacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaacactaat 361 Query: 163 ctaaatctaaataaataaagcagtatacaaaagaatcagataccataccataccataccc 222 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 360 ctaaatctaaataaataaagcagtatacaaaagaatcagataccataccataccataccc 301 Query: 223 ccacaggccgtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcg 282 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 300 ccacaggccgtcncggtttccatggagccggcggcggcggaggcgaagggaacatgggcg 241 Query: 283 gtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccgacaaagcta 342 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 240 gtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccgacaaagcta 181 Query: 343 ccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcc 402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 180 ccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcc 121 Query: 403 tgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacctgctatgg 462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120 tgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacctgctatgg 61 Query: 463 tattagggtttggcttcttggcgtccctccacttccaccctcctttgcagccatagtgaa 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 60 tattagggtttggcttcttggcgtccctccacttccaccctcctttgcagccatagtgaa 1 >gi|24764164|gb|CA399331.1|CA399331 EL01N0317D04.g Endosperm_3 Zea mays cDNA, mRNA sequence Length = 525 Score = 779 bits (393), Expect = 0.0 Identities = 473/502 (94%), Gaps = 14/502 (2%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 38 cccaggaaatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 97 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| |||||| |||||||||||||||||||| Sbjct: 98 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggtgctacatactgttagatctc 157 Query: 121 catgattgtgatggtagcagtacggcgagagggaacactaatctaaatctaaataaataa 180 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 158 catgattgtgatggtagcagtacggcgagagggaacact------aatctaaataaataa 211 Query: 181 agcagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtt 240 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 212 agcagtatacaaaagaatcag-----ataccataccatacccccacaggccgtcacggtt 266 Query: 241 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 267 tccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatgg 326 Query: 301 tgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagac 360 |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 327 tgttcttgtccacc---ccgtggccttcacccgacaaagctaccaatgcggcgactagac 383 Query: 361 cagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacc 420 |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| Sbjct: 384 cagcgttgcccgccagcgttgcttcagtgtagttgtagttactgcgggcgtctttgaacc 443 Query: 421 cgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttggcttct 480 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 444 cgtcatggcggtcggggccagcaaccatgggacctgctatggtattagggtttggcttct 503 Query: 481 tggcgtccctccacttccaccc 502 ||| |||||||||||||||||| Sbjct: 504 tggggtccctccacttccaccc 525 >gi|60351728|gb|DN218701.1|DN218701 MEST1070_B11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 734 Score = 517 bits (261), Expect = e-145 Identities = 350/379 (92%), Gaps = 3/379 (0%) Strand = Plus / Plus Query: 235 acggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaga 294 ||||||||||||| || || |||||||||||||||||||||||||| || |||||||||| Sbjct: 207 acggtttccatggggctggtggcggcggaggcgaagggaacatgggtggcactgcagaga 266 Query: 295 acatggtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcga 354 |||||||||||||||||||||| ||||| |||||||||||||||||||| || |||| Sbjct: 267 acatggtgttcttgtccacccca---tggccttcacccgacaaagctaccaacgctgcga 323 Query: 355 ctagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctt 414 |||||||||| ||||||||||||||||||||||||||||| || ||| ||||| |||||| Sbjct: 324 ctagaccagcattgcccgccagcgttgcttcagtgtagttataattcttgcggacatctt 383 Query: 415 tgaacccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttg 474 |||||||||||||||| |||||||||||||||||||| ||| ||||| |||| ||||||| Sbjct: 384 tgaacccgtcatggcgatcggggccagcaaccatggcccctactatgatattggggtttg 443 Query: 475 gcttcttggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttag 534 ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 444 gcttcttggtgtccctccacttccaccctcctttgcatccatagtgaacaccgttcttag 503 Query: 535 ggatcgaggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgt 594 ||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||| | Sbjct: 504 ggatcgaggcgccccggtggtgaacatgcttggggtaatggtttccgaacccaaccacat 563 Query: 595 agctcatcttcaaaggatt 613 ||||||||||||| ||||| Sbjct: 564 agctcatcttcaatggatt 582 >gi|71308746|gb|DR790610.1|DR790610 ZM_BFb0009K12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 738 Score = 517 bits (261), Expect = e-145 Identities = 350/379 (92%), Gaps = 3/379 (0%) Strand = Plus / Plus Query: 235 acggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaga 294 ||||||||||||| || || |||||||||||||||||||||||||| || |||||||||| Sbjct: 206 acggtttccatggggctggtggcggcggaggcgaagggaacatgggtggcactgcagaga 265 Query: 295 acatggtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcga 354 |||||||||||||||||||||| ||||| |||||||||||||||||||| || |||| Sbjct: 266 acatggtgttcttgtccacccca---tggccttcacccgacaaagctaccaacgctgcga 322 Query: 355 ctagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctt 414 |||||||||| ||||||||||||||||||||||||||||| || ||| ||||| |||||| Sbjct: 323 ctagaccagcattgcccgccagcgttgcttcagtgtagttataattcttgcggacatctt 382 Query: 415 tgaacccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttg 474 |||||||||||||||| |||||||||||||||||||| ||| ||||| |||| ||||||| Sbjct: 383 tgaacccgtcatggcgatcggggccagcaaccatggcccctactatgatattggggtttg 442 Query: 475 gcttcttggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttag 534 ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 443 gcttcttggtgtccctccacttccaccctcctttgcatccatagtgaacaccgttcttag 502 Query: 535 ggatcgaggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgt 594 ||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||| | Sbjct: 503 ggatcgaggcgccccggtggtgaacatgcttggggtaatggtttccgaacccaaccacat 562 Query: 595 agctcatcttcaaaggatt 613 ||||||||||||| ||||| Sbjct: 563 agctcatcttcaatggatt 581 >gi|74241493|gb|DT649407.1|DT649407 ZM_BFb0112B16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 778 Score = 502 bits (253), Expect = e-140 Identities = 348/379 (91%), Gaps = 3/379 (0%) Strand = Plus / Plus Query: 235 acggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaga 294 ||||||||||||| || || |||||||||||||||||||||||||| || |||||| | | Sbjct: 235 acggtttccatggggctgggggcggcggaggcgaagggaacatgggtggcactgcaaaaa 294 Query: 295 acatggtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcga 354 |||||||||||||||||||||| ||||| |||||||||||||||||||| || |||| Sbjct: 295 acatggtgttcttgtccacccca---tggccttcacccgacaaagctaccaacgctgcga 351 Query: 355 ctagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctt 414 |||||||||| ||||||||||||||||||||||||||||| || ||| ||||| |||||| Sbjct: 352 ctagaccagcattgcccgccagcgttgcttcagtgtagttataattcttgcggacatctt 411 Query: 415 tgaacccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttg 474 |||||||||||||||| |||||||||||||||||||| ||| ||||| |||| ||||||| Sbjct: 412 tgaacccgtcatggcgatcggggccagcaaccatggcccctactatgatattggggtttg 471 Query: 475 gcttcttggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttag 534 ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 472 gcttcttggtgtccctccacttccaccctcctttgcatccatagtgaacaccgttcttag 531 Query: 535 ggatcgaggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgt 594 ||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||| | Sbjct: 532 ggatcgaggcgccccggtggtgaacatgcttggggtaatggtttccgaacccaaccacat 591 Query: 595 agctcatcttcaaaggatt 613 ||||||||||||| ||||| Sbjct: 592 agctcatcttcaatggatt 610 >gi|22542815|gb|BU093253.1|BU093253 1091058B12.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 573 Score = 486 bits (245), Expect = e-135 Identities = 346/379 (91%), Gaps = 3/379 (0%) Strand = Plus / Plus Query: 235 acggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaga 294 ||||||||||||| || || |||||||||||||||||||||||||| || |||||||||| Sbjct: 188 acggtttccatggggctggtggcggcggaggcgaagggaacatgggtggcactgcagaga 247 Query: 295 acatggtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcga 354 |||||||||||||||||||||| ||||| |||||||||||||||||||| || |||| Sbjct: 248 acatggtgttcttgtccacccca---tggccttcacccgacaaagctaccaacgctgcga 304 Query: 355 ctagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctt 414 |||||||||| ||||||||||||||||||||||||||||| || ||| ||||| |||||| Sbjct: 305 ctagaccagcattgcccgccagcgttgcttcagtgtagttataattcttgcggacatctt 364 Query: 415 tgaacccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttg 474 |||||||||||||||| |||||||||||||||||||| ||| ||||| ||| ||||| | Sbjct: 365 tgaacccgtcatggcgatcggggccagcaaccatggcccctactatgatatgggggttgg 424 Query: 475 gcttcttggcgtccctccacttccaccctcctttgcagccatagtgaacaccgttcttag 534 |||||| || ||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 425 gcttctgggtgtccctccacttccaccctccttggcatccatagtgaacaccgttcttag 484 Query: 535 ggatcgaggcgccccggtggtgaacatgcctggggtaacgctttccgaacccaaccacgt 594 ||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||| | Sbjct: 485 ggatcgaggcgccccggtggtgaacatgcttggggtaatggtttccgaacccaaccacat 544 Query: 595 agctcatcttcaaaggatt 613 ||||||||||||| ||||| Sbjct: 545 agctcatcttcaatggatt 563 >gi|21216531|gb|AY111941.1| Zea mays CL68270_1 mRNA sequence Length = 634 Score = 416 bits (210), Expect = e-114 Identities = 210/210 (100%) Strand = Plus / Plus Query: 275 catgggcggtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccga 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 272 catgggcggtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccga 331 Query: 335 caaagctaccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagtt 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 332 caaagctaccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagtt 391 Query: 395 gtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacc 454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 392 gtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacc 451 Query: 455 tgctatggtattagggtttggcttcttggc 484 |||||||||||||||||||||||||||||| Sbjct: 452 tgctatggtattagggtttggcttcttggc 481 Score = 210 bits (106), Expect = 2e-52 Identities = 106/106 (100%) Strand = Plus / Plus Query: 510 cagccatagtgaacaccgttcttagggatcgaggcgccccggtggtgaacatgcctgggg 569 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 507 cagccatagtgaacaccgttcttagggatcgaggcgccccggtggtgaacatgcctgggg 566 Query: 570 taacgctttccgaacccaaccacgtagctcatcttcaaaggattct 615 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 567 taacgctttccgaacccaaccacgtagctcatcttcaaaggattct 612 Score = 123 bits (62), Expect = 3e-26 Identities = 62/62 (100%) Strand = Plus / Plus Query: 4 aggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacattgc 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacattgc 60 Query: 64 ac 65 || Sbjct: 61 ac 62 Score = 111 bits (56), Expect = 1e-22 Identities = 56/56 (100%) Strand = Plus / Plus Query: 100 agctacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaa 155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 97 agctacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaa 152 Score = 93.7 bits (47), Expect = 2e-17 Identities = 57/62 (91%) Strand = Plus / Plus Query: 183 cagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtttc 242 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 180 cagtatacaaaagaatcagataccataccataccatannnnnacaggccgtcacggtttc 239 Query: 243 ca 244 || Sbjct: 240 ca 241 >gi|21216531|gb|AY111941.1| Zea mays CL68270_1 mRNA sequence Length = 634 Score = 416 bits (210), Expect = e-114 Identities = 210/210 (100%) Strand = Plus / Plus Query: 275 catgggcggtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccga 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 272 catgggcggtactgcagagaacatggtgttcttgtccaccccgccgtggccgtcacccga 331 Query: 335 caaagctaccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagtt 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 332 caaagctaccaatgcggcgactagaccagcgttgcccgccagcgttgcttcagtgtagtt 391 Query: 395 gtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacc 454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 392 gtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaaccatggcacc 451 Query: 455 tgctatggtattagggtttggcttcttggc 484 |||||||||||||||||||||||||||||| Sbjct: 452 tgctatggtattagggtttggcttcttggc 481 Score = 210 bits (106), Expect = 2e-52 Identities = 106/106 (100%) Strand = Plus / Plus Query: 510 cagccatagtgaacaccgttcttagggatcgaggcgccccggtggtgaacatgcctgggg 569 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 507 cagccatagtgaacaccgttcttagggatcgaggcgccccggtggtgaacatgcctgggg 566 Query: 570 taacgctttccgaacccaaccacgtagctcatcttcaaaggattct 615 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 567 taacgctttccgaacccaaccacgtagctcatcttcaaaggattct 612 Score = 123 bits (62), Expect = 3e-26 Identities = 62/62 (100%) Strand = Plus / Plus Query: 4 aggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacattgc 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacattgc 60 Query: 64 ac 65 || Sbjct: 61 ac 62 Score = 111 bits (56), Expect = 1e-22 Identities = 56/56 (100%) Strand = Plus / Plus Query: 100 agctacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaa 155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 97 agctacatactgttagatctccatgattgtgatggtagcagtacggcgagagggaa 152 Score = 93.7 bits (47), Expect = 2e-17 Identities = 57/62 (91%) Strand = Plus / Plus Query: 183 cagtatacaaaagaatcagataccataccataccatacccccacaggccgtcacggtttc 242 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 180 cagtatacaaaagaatcagataccataccataccatannnnnacaggccgtcacggtttc 239 Query: 243 ca 244 || Sbjct: 240 ca 241 >gi|50329137|gb|CO524263.1|CO524263 3530_1_160_1_E11.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 286 Score = 325 bits (164), Expect = 4e-87 Identities = 253/282 (89%), Gaps = 3/282 (1%) Strand = Plus / Plus Query: 235 acggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcagaga 294 ||||||||||||| || || |||||||||||| ||||||||||||| || |||||| | | Sbjct: 8 acggtttccatggggctgggggcggcggaggcaaagggaacatgggtggcactgcaaaaa 67 Query: 295 acatggtgttcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcga 354 |||||| ||||||||||||||| ||||| |||||||||||||||||||| || |||| Sbjct: 68 acatggggttcttgtccacccca---tggccttcacccgacaaagctaccaacgctgcga 124 Query: 355 ctagaccagcgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctt 414 ||| |||||| ||||||||||||||||||||||||||||| || ||| ||||| |||||| Sbjct: 125 ctaaaccagcattgcccgccagcgttgcttcagtgtagttataattcttgcggacatctt 184 Query: 415 tgaacccgtcatggcggtcggggccagcaaccatggcacctgctatggtattagggtttg 474 |||||||||||||||| |||||||||||||||||||| ||| ||||| |||| ||||||| Sbjct: 185 tgaacccgtcatggcgatcggggccagcaaccatggcccctactatgatattggggtttg 244 Query: 475 gcttcttggcgtccctccacttccaccctcctttgcagccat 516 ||||||||| ||||||||||||||||||||||||||| |||| Sbjct: 245 gcttcttggggtccctccacttccaccctcctttgcatccat 286 >gi|12973793|gb|BG268656.1|BG268656 1000206E04.x2 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 159 Score = 315 bits (159), Expect = 4e-84 Identities = 159/159 (100%) Strand = Plus / Plus Query: 304 tcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagaccag 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 tcttgtccaccccgccgtggccgtcacccgacaaagctaccaatgcggcgactagaccag 60 Query: 364 cgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacccgt 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cgttgcccgccagcgttgcttcagtgtagttgtagttcctgcgggcatctttgaacccgt 120 Query: 424 catggcggtcggggccagcaaccatggcacctgctatgg 462 ||||||||||||||||||||||||||||||||||||||| Sbjct: 121 catggcggtcggggccagcaaccatggcacctgctatgg 159 >gi|86467497|gb|DY233867.1|DY233867 ZM_BFb0243L07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 256 Score = 220 bits (111), Expect = 2e-55 Identities = 139/151 (92%) Strand = Plus / Plus Query: 1 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 106 cccaggatatcagttactgaccccgagatccatgcaaaacgtagtactagtcctttacat 165 Query: 61 tgcacggcaaaatataaaaacaatgnnnnnnnngaccggagctacatactgttagatctc 120 ||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 166 tgcacggcaaaatataaaaacaatgaaaaaaaagaccggagctacatactgttagatctc 225 Query: 121 catgattgtgatggtagcagtacggcgagag 151 ||||| |||||||| | ||||||||| |||| Sbjct: 226 catgaatgtgatgggaacagtacggcaagag 256 >gi|32846285|gb|CD985966.1|CD985966 QAN16f12.yg QAN Zea mays cDNA clone QAN16f12, mRNA sequence Length = 417 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 185 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 126 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 125 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 66 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 65 ttgcacccata 55 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Minus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 326 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 271 >gi|32847775|gb|CD987456.1|CD987456 QAO1a06.yg QAO Zea mays cDNA clone QAO1a06, mRNA sequence Length = 417 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 234 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 293 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 294 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 353 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 354 ttgcacccata 364 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 93 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 148 >gi|32848452|gb|CD988133.1|CD988133 QAO9c02.yg QAO Zea mays cDNA clone QAO9c02, mRNA sequence Length = 436 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 234 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 293 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 294 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 353 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 354 ttgcacccata 364 >gi|32849905|gb|CD989586.1|CD989586 QAT3h08.yg QAT Zea mays cDNA clone QAT3h08, mRNA sequence Length = 416 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 233 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 292 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 293 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 352 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 353 ttgcacccata 363 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 92 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 147 >gi|32850358|gb|CD990039.1|CD990039 QAV2d09.yg QAV Zea mays cDNA clone QAV2d09, mRNA sequence Length = 370 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 234 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 293 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 294 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 353 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 354 ttgcacccata 364 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 93 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 148 >gi|32938675|gb|CF043494.1|CF043494 QCJ18b10.yg QCJ Zea mays cDNA clone QCJ18b10, mRNA sequence Length = 536 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 517 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 458 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 457 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 398 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 397 ttgcacccata 387 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 328 tttccgaaacccacaacgtagctcatcttcaa 297 >gi|32939292|gb|CF044111.1|CF044111 QCJ25d11.yg QCJ Zea mays cDNA clone QCJ25d11, mRNA sequence Length = 535 Score = 69.9 bits (35), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 517 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 458 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 457 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 398 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 397 ttgcacccata 387 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 328 tttccgaaacccacaacgtagctcatcttcaa 297 >gi|32849937|gb|CD989618.1|CD989618 QAT4d01.yg QAT Zea mays cDNA clone QAT4d01, mRNA sequence Length = 390 Score = 65.9 bits (33), Expect = 6e-09 Identities = 102/125 (81%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 234 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 293 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 294 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 353 Query: 507 ttgca 511 ||||| Sbjct: 354 ttgca 358 >gi|13490652|gb|BG517416.1|BG517416 947062C10.y1 947 - 2 week shoot from Barkan lab Zea mays cDNA, mRNA sequence Length = 418 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 173 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 114 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 113 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 54 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 53 ttgcacccata 43 >gi|24768931|gb|CA404060.1|CA404060 EL01N0511D04.g Endosperm_4 Zea mays cDNA, mRNA sequence Length = 740 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 486 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 545 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 546 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 605 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 606 ttgcacccata 616 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Plus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 675 tttccgaaacccacaacgtagctcatcttcaa 706 >gi|31353920|gb|CD438277.1|CD438277 EL01N0511D04.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 894 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 486 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 427 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 426 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 367 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 366 ttgcacccata 356 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 297 tttccgaaacccacaacgtagctcatcttcaa 266 >gi|33467240|gb|CF244289.1|CF244289 3530_1_28_1_D03.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 741 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 501 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 560 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 561 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 620 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 621 ttgcacccata 631 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Plus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 690 tttccgaaacccacaacgtagctcatcttcaa 721 >gi|37393645|gb|CF634088.1|CF634088 zmrww00_0A10-008-b10.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 822 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 492 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 551 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 552 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 611 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 612 ttgcacccata 622 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Plus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 681 tttccgaaacccacaacgtagctcatcttcaa 712 >gi|60339973|gb|DN206946.1|DN206946 MEST841_C08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 712 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 523 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 582 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 583 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 642 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 643 ttgcacccata 653 >gi|60354843|gb|DN221816.1|DN221816 MEST1120_D03.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 707 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 523 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 582 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 583 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 642 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 643 ttgcacccata 653 >gi|67010311|gb|CO439060.1|CO439060 MZCCL10001D11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 747 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | |||||| | | ||| |||||||| ||| Sbjct: 499 gtgtagttgtagttcgtgcggacatctttgtagccgtcacgcctgtcagggccagccacc 440 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | ||||||||| || | |||||| Sbjct: 439 attgctccaacaaggatgttagggtttgccttcttcgtgtccctccatttgtaacctcct 380 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 379 ttgcatccata 369 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 310 tttccgaaacccacaacgtagctcatcttcaa 279 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 604 gcagagaagatggtgttcttgtc 582 >gi|67023594|gb|CO452343.1|CO452343 MZCCL10177A05.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 867 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | |||||| | | ||| |||||||| ||| Sbjct: 389 gtgtagttgtagttcgtgcggacatctttgtagccgtcacgcctgtcagggccagccacc 330 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | ||||||||| || | |||||| Sbjct: 329 attgctccaacaaggatgttagggtttgccttcttcgtgtccctccatttgtaacctcct 270 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 269 ttgcatccata 259 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 494 gcagagaagatggtgttcttgtc 472 >gi|71428264|gb|DR809314.1|DR809314 ZM_BFb0036H09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 722 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 492 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 551 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 552 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 611 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 612 ttgcacccata 622 >gi|74239514|gb|DT647428.1|DT647428 ZM_BFb0108G12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 861 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | |||||| | | ||| |||||||| ||| Sbjct: 644 gtgtagttgtagttcgtgcggacatctttgtagccgtcacgcctgtcagggccagccacc 585 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | ||||||||| || | |||||| Sbjct: 584 attgctccaacaaggatgttagggtttgccttcttcgtgtccctccatttgtaacctcct 525 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 524 ttgcatccata 514 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 455 tttccgaaacccacaacgtagctcatcttcaa 424 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 749 gcagagaagatggtgttcttgtc 727 >gi|84976768|gb|DW475190.1|DW475190 0241 Zea mays central cell cDNA library Zea mays cDNA clone CC0241, mRNA sequence Length = 625 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | |||||| | | ||| |||||||| ||| Sbjct: 228 gtgtagttgtagttcgtgcggacatctttgtagccgtcacgcctgtcagggccagccacc 169 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | ||||||||| || | |||||| Sbjct: 168 attgctccaacaaggatgttagggtttgccttcttcgtgtccctccatttgtaacctcct 109 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 108 ttgcatccata 98 >gi|54652638|gb|BT017857.1| Zea mays clone EL01N0511D04.c mRNA sequence Length = 894 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 486 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 427 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 426 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 367 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 366 ttgcacccata 356 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 297 tttccgaaacccacaacgtagctcatcttcaa 266 >gi|21207273|gb|AY104195.1| Zea mays PCO094435 mRNA sequence Length = 2019 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 1463 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 1404 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 1403 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 1344 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 1343 ttgcacccata 1333 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 1274 tttccgaaacccacaacgtagctcatcttcaa 1243 >gi|85540233|gb|BT023982.1| Zea mays clone EL01N0414A03 mRNA sequence Length = 1870 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 1397 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 1338 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 1337 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 1278 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 1277 ttgcacccata 1267 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 1208 tttccgaaacccacaacgtagctcatcttcaa 1177 >gi|85540233|gb|BT023982.1| Zea mays clone EL01N0414A03 mRNA sequence Length = 1870 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 1397 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 1338 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 1337 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 1278 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 1277 ttgcacccata 1267 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 1208 tttccgaaacccacaacgtagctcatcttcaa 1177 >gi|54652638|gb|BT017857.1| Zea mays clone EL01N0511D04.c mRNA sequence Length = 894 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 486 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 427 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 426 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 367 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 366 ttgcacccata 356 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 297 tttccgaaacccacaacgtagctcatcttcaa 266 >gi|21207273|gb|AY104195.1| Zea mays PCO094435 mRNA sequence Length = 2019 Score = 61.9 bits (31), Expect = 9e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 1463 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 1404 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 1403 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 1344 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 1343 ttgcacccata 1333 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 1274 tttccgaaacccacaacgtagctcatcttcaa 1243 >gi|67024772|gb|CO453521.1|CO453521 MZCCL10193F12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 911 Score = 58.0 bits (29), Expect = 1e-06 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | |||||| | | ||| |||||||| ||| Sbjct: 796 gtgtagttgtagttcgtgcggacatctttgtagccgtcacgcctgtcagggccagccacc 737 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| ||||| | ||||||||| || | |||||| Sbjct: 736 attgctccancaaggatgttagggtttgcnttcttcgtgtccctccatttgtaacctcct 677 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 676 ttgcatccata 666 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 607 tttccgaaacccacaacgtagctcatcttcaa 576 >gi|6020730|gb|AW065538.1|AW065538 614059H06.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 627 Score = 54.0 bits (27), Expect = 2e-05 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| | |||||| | || || | | |||||||||||| ||| Sbjct: 564 gtgtagttgtagttcgtgcggacgtctttgtagccatcgcgcctgtcggggccagccacc 505 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 504 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 445 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 444 ttgcacccata 434 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 375 tttccgaaacccacaacgtagctcatcttcaa 344 >gi|6859920|gb|AW355914.1|AW355914 707015H12.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 649 Score = 54.0 bits (27), Expect = 2e-05 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| | |||||| | || || | | |||||||||||| ||| Sbjct: 265 gtgtagttgtagttcgtgcggacgtctttgtagccatcgcgcctgtcggggccagccacc 206 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 205 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 146 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 145 ttgcacccata 135 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 76 tttccgaaacccacaacgtagctcatcttcaa 45 >gi|12045747|gb|BF727886.1|BF727886 1000054D09.x3 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 491 Score = 54.0 bits (27), Expect = 2e-05 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| | |||||| | || || | | |||||||||||| ||| Sbjct: 212 gtgtagttgtagttcgtgcggacgtctttgtagccatcgcgcctgtcggggccagccacc 153 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 152 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 93 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 92 ttgcacccata 82 >gi|13149353|gb|BG319675.1|BG319675 Zm03_07e07_A Zm03_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm03_07e07, mRNA sequence Length = 822 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 515 ccgaacccaaccacgtagctcatcttc 541 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gagaacatggtgttcttgtc 310 |||||||||||||||||||| Sbjct: 216 gagaacatggtgttcttgtc 235 >gi|37380273|gb|CF626933.1|CF626933 zmrws05_0B20-004-h06.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 663 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 54.0 bits (27), Expect = 2e-05 Identities = 66/79 (83%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 ||||||||||||||||||| Sbjct: 213 agaacatggtgttcttgtc 231 >gi|37380768|gb|CF627218.1|CF627218 zmrws05_0B20-008-d12.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 620 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 511 ccgaacccaaccacgtagctcatcttc 537 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|37380948|gb|CF627322.1|CF627322 zmrws05_0B20-009-h01.s2 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 600 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 485 ccgaacccaaccacgtagctcatcttc 511 Score = 54.0 bits (27), Expect = 2e-05 Identities = 66/79 (83%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 126 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 185 Query: 292 agaacatggtgttcttgtc 310 ||||||||||||||||||| Sbjct: 186 agaacatggtgttcttgtc 204 >gi|37396834|gb|CF635711.1|CF635711 zmrww00_0A20-013-f06.s2 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 802 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 494 ccgaacccaaccacgtagctcatcttc 520 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 135 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 194 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 195 aaaacatggtgttcttgtc 213 >gi|37397108|gb|CF635849.1|CF635849 zmrww00_0B10-001-c04.s1 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 510 Score = 54.0 bits (27), Expect = 2e-05 Identities = 66/79 (83%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 122 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 181 Query: 292 agaacatggtgttcttgtc 310 ||||||||||||||||||| Sbjct: 182 agaacatggtgttcttgtc 200 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagc 597 ||||||||||||||||||| Sbjct: 481 ccgaacccaaccacgtagc 499 >gi|40335079|gb|CK369149.1|CK369149 zmrws055_0B21-004-h06.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 724 Score = 54.0 bits (27), Expect = 2e-05 Identities = 66/79 (83%) Strand = Plus / Minus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 572 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 513 Query: 292 agaacatggtgttcttgtc 310 ||||||||||||||||||| Sbjct: 512 agaacatggtgttcttgtc 494 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Minus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 213 ccgaacccaaccacgtagctcatcttc 187 >gi|50324782|gb|CO519908.1|CO519908 3530_1_131_1_B03.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 644 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 542 ccgaacccaaccacgtagctcatcttc 568 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 183 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 242 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 243 aaaacatggtgttcttgtc 261 >gi|67014779|gb|CO443528.1|CO443528 MZCCL10062D12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 854 Score = 54.0 bits (27), Expect = 2e-05 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 485 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 426 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || | || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 425 attgatccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 366 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 365 ttgcacccata 355 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 296 tttccgaaacccacaacgtagctcatcttcaa 265 >gi|71430048|gb|DR811098.1|DR811098 ZM_BFb0039C16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 783 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 485 ccgaacccaaccacgtagctcatcttc 511 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 126 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 185 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 186 aaaacatggtgttcttgtc 204 >gi|71431449|gb|DR812499.1|DR812499 ZM_BFb0041D16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 634 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|71436025|gb|DR817075.1|DR817075 ZM_BFb0050D23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 638 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 535 ccgaacccaaccacgtagctcatcttc 561 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 176 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 235 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 236 aaaacatggtgttcttgtc 254 >gi|71446595|gb|DR827645.1|DR827645 ZM_BFb0070P09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 818 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Minus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 681 ccgaacccaaccacgtagctcatcttc 655 >gi|71758473|gb|DR956410.1|DR956410 ZM_BFb0052N19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 708 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 54.0 bits (27), Expect = 2e-05 Identities = 66/79 (83%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 ||||||||||||||||||| Sbjct: 213 agaacatggtgttcttgtc 231 >gi|74235589|gb|DT643503.1|DT643503 ZM_BFb0102I08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 700 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|76015967|gb|DT943137.1|DT943137 ZM_BFb0128O14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 652 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|78081453|gb|DV509865.1|DV509865 ZM_BFb0189D12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 615 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|78114458|gb|DV532847.1|DV532847 ZM_BFb0223L05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 741 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 509 ccgaacccaaccacgtagctcatcttc 535 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 150 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 209 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 210 aaaacatggtgttcttgtc 228 >gi|78180864|gb|DV551237.1|DV551237 1000054-D09.GAD10-F UGI-Reseq Zea mays cDNA, mRNA sequence Length = 718 Score = 54.0 bits (27), Expect = 2e-05 Identities = 105/131 (80%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| | |||||| | || || | | |||||||||||| ||| Sbjct: 243 gtgtagttgtagttcgtgcggacgtctttgtagccatcgcgcctgtcggggccagccacc 184 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccacttccaccctcct 506 || || || | | | | |||||||||| |||||| | |||||||||||| | |||||| Sbjct: 183 attgctccgacaaggatgttagggtttgccttctttgtgtccctccacttgtaacctcct 124 Query: 507 ttgcagccata 517 ||||| ||||| Sbjct: 123 ttgcacccata 113 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 54 tttccgaaacccacaacgtagctcatcttcaa 23 >gi|91052738|gb|EB163156.1|EB163156 ZM_BFb0303P18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 714 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|91052739|gb|EB163157.1|EB163157 ZM_BFb0303P18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 713 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Minus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 666 ccgaacccaaccacgtagctcatcttc 640 >gi|91055179|gb|EB165597.1|EB165597 ZM_BFb0341I07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 646 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 516 ccgaacccaaccacgtagctcatcttc 542 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 157 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 216 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 217 aaaacatggtgttcttgtc 235 >gi|91877342|gb|EB407299.1|EB407299 ZM_BFb0319G15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 644 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|93013167|gb|EB638687.1|EB638687 ZM_BFb0326A13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 684 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|93016768|gb|EB642288.1|EB642288 ZM_BFb0332I14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 637 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Plus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 512 ccgaacccaaccacgtagctcatcttc 538 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|93016769|gb|EB642289.1|EB642289 ZM_BFb0332I14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 832 Score = 54.0 bits (27), Expect = 2e-05 Identities = 27/27 (100%) Strand = Plus / Minus Query: 579 ccgaacccaaccacgtagctcatcttc 605 ||||||||||||||||||||||||||| Sbjct: 666 ccgaacccaaccacgtagctcatcttc 640 >gi|18177276|gb|BM378486.1|BM378486 MEST564-A07.univ ISUM7 Zea mays cDNA clone MEST564-A07 3', mRNA sequence Length = 607 Score = 52.0 bits (26), Expect = 8e-05 Identities = 89/110 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 491 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 550 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccactt 496 || || || | | | | |||||||||| |||||| | |||||||||||| Sbjct: 551 attgctccgacaaggatgttagggtttgccttctttgtgtccctccactt 600 >gi|21828651|gb|BQ703335.1|BQ703335 946108D02.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 576 Score = 52.0 bits (26), Expect = 8e-05 Identities = 89/110 (80%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 463 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 522 Query: 447 atggcacctgctatggtattagggtttggcttcttggcgtccctccactt 496 || || || | | | | |||||||||| |||||| | |||||||||||| Sbjct: 523 attgctccgacaaggatgttagggtttgccttctttgtgtccctccactt 572 >gi|32927528|gb|CF032340.1|CF032340 QCE1e12.yg QCE Zea mays cDNA clone QCE1e12, mRNA sequence Length = 535 Score = 52.0 bits (26), Expect = 8e-05 Identities = 53/62 (85%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 432 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 491 Query: 447 at 448 || Sbjct: 492 at 493 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 291 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 346 >gi|32927544|gb|CF032356.1|CF032356 QCE1g09.yg QCE Zea mays cDNA clone QCE1g09, mRNA sequence Length = 534 Score = 52.0 bits (26), Expect = 8e-05 Identities = 53/62 (85%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 432 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 491 Query: 447 at 448 || Sbjct: 492 at 493 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 291 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 346 >gi|32927676|gb|CF032488.1|CF032488 QCE3f02.yg QCE Zea mays cDNA clone QCE3f02, mRNA sequence Length = 519 Score = 52.0 bits (26), Expect = 8e-05 Identities = 53/62 (85%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 432 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 491 Query: 447 at 448 || Sbjct: 492 at 493 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 291 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 346 >gi|32927847|gb|CF032659.1|CF032659 QCE6c05.yg QCE Zea mays cDNA clone QCE6c05, mRNA sequence Length = 523 Score = 52.0 bits (26), Expect = 8e-05 Identities = 53/62 (85%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || ||| | | |||||||||||| ||| Sbjct: 433 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccacc 492 Query: 447 at 448 || Sbjct: 493 at 494 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 292 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 347 >gi|13490923|gb|BG517687.1|BG517687 947070B01.y1 947 - 2 week shoot from Barkan lab Zea mays cDNA, mRNA sequence Length = 549 Score = 50.1 bits (25), Expect = 3e-04 Identities = 46/53 (86%) Strand = Plus / Minus Query: 465 ttagggtttggcttcttggcgtccctccacttccaccctcctttgcagccata 517 |||||||||| |||||| | |||||||||||| | ||||||||||| ||||| Sbjct: 156 ttagggtttgccttctttgtgtccctccacttgtaacctcctttgcacccata 104 Score = 44.1 bits (22), Expect = 0.021 Identities = 28/30 (93%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttg 416 ||||||||||||||| ||||| |||||||| Sbjct: 236 gtgtagttgtagttcgtgcggacatctttg 207 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 46 tttccgaaacccacaacgtagctcatcttcaa 15 >gi|37384531|gb|CF629347.1|CF629347 zmrws48_0A10-016-c07.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 594 Score = 50.1 bits (25), Expect = 3e-04 Identities = 37/41 (90%) Strand = Plus / Plus Query: 270 gggaacatgggcggtactgcagagaacatggtgttcttgtc 310 |||||||| ||||| || || |||||||||||||||||||| Sbjct: 514 gggaacattggcggcacggcggagaacatggtgttcttgtc 554 >gi|37384859|gb|CF629529.1|CF629529 zmrws48_0A20-002-d12.s2 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 540 Score = 50.1 bits (25), Expect = 3e-04 Identities = 37/41 (90%) Strand = Plus / Plus Query: 270 gggaacatgggcggtactgcagagaacatggtgttcttgtc 310 |||||||| ||||| || || |||||||||||||||||||| Sbjct: 337 gggaacattggcggcacggcggagaacatggtgttcttgtc 377 >gi|37391948|gb|CF633219.1|CF633219 zmrws48_0B20-013-a11.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 580 Score = 50.1 bits (25), Expect = 3e-04 Identities = 37/41 (90%) Strand = Plus / Plus Query: 270 gggaacatgggcggtactgcagagaacatggtgttcttgtc 310 |||||||| ||||| || || |||||||||||||||||||| Sbjct: 337 gggaacattggcggcacggcggagaacatggtgttcttgtc 377 >gi|40335617|gb|CK369687.1|CK369687 zmrws485_0A21-002-d12.s0 zmrws485 Zea mays cDNA 5', mRNA sequence Length = 507 Score = 50.1 bits (25), Expect = 3e-04 Identities = 37/41 (90%) Strand = Plus / Minus Query: 270 gggaacatgggcggtactgcagagaacatggtgttcttgtc 310 |||||||| ||||| || || |||||||||||||||||||| Sbjct: 211 gggaacataggcggcacggcggagaacatggtgttcttgtc 171 >gi|37398064|gb|CF636341.1|CF636341 zmrww00_0B10-007-f09.s4 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 242 Score = 48.1 bits (24), Expect = 0.001 Identities = 66/80 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtcc 311 | |||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtcc 232 >gi|71765912|gb|DR963849.1|DR963849 ZM_BFb0082P21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 571 Score = 48.1 bits (24), Expect = 0.001 Identities = 24/24 (100%) Strand = Plus / Plus Query: 582 aacccaaccacgtagctcatcttc 605 |||||||||||||||||||||||| Sbjct: 488 aacccaaccacgtagctcatcttc 511 >gi|5901174|gb|AW042274.1|AW042274 614026D12.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 568 Score = 46.1 bits (23), Expect = 0.005 Identities = 35/39 (89%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtca 425 ||||||||||||||| ||||| |||||||| | |||||| Sbjct: 50 gtgtagttgtagttcgtgcggacatctttgtagccgtca 12 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 155 gcagagaagatggtgttcttgtc 133 >gi|6194458|gb|AW146562.1|AW146562 614073E07.y3 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 373 Score = 46.1 bits (23), Expect = 0.005 Identities = 35/39 (89%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtca 425 ||||||||||||||| ||||| |||||||| | |||||| Sbjct: 78 gtgtagttgtagttcgtgcggacatctttgtagccgtca 40 >gi|32927600|gb|CF032412.1|CF032412 QCE2e07.yg QCE Zea mays cDNA clone QCE2e07, mRNA sequence Length = 521 Score = 46.1 bits (23), Expect = 0.005 Identities = 47/55 (85%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccag 441 ||||||||||||||| ||||| |||||||| | || ||| | | ||||||||||| Sbjct: 432 gtgtagttgtagttcgtgcggacatctttgtagccatcacgcctgtcggggccag 486 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 291 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 346 >gi|44901557|gb|CK828102.1|CK828102 zmrww00_0A21-014-a01.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 456 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 176 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 235 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 236 aaaacatggtgttcttgtc 254 >gi|45567834|gb|CK985769.1|CK985769 zmrsub1_0A20-011-g02.s4 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 376 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 150 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 209 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 210 aaaacatggtgttcttgtc 228 >gi|67026010|gb|CO454759.1|CO454759 MZCCL10212C07.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 584 Score = 46.1 bits (23), Expect = 0.005 Identities = 35/39 (89%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtca 425 ||||||||||||||| ||||| |||||||| | |||||| Sbjct: 143 gtgtagttgtagttcgtgcggacatctttgtagccgtca 105 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 248 gcagagaagatggtgttcttgtc 226 >gi|88757747|gb|DY541888.1|DY541888 ZM_BFb0367B23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 401 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 181 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 240 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 241 aaaacatggtgttcttgtc 259 >gi|91049844|gb|EB160262.1|EB160262 ZM_BFb0298A04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 349 Score = 46.1 bits (23), Expect = 0.005 Identities = 65/79 (82%) Strand = Plus / Plus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 153 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 212 Query: 292 agaacatggtgttcttgtc 310 | ||||||||||||||||| Sbjct: 213 aaaacatggtgttcttgtc 231 >gi|16379856|gb|BI993181.1|BI993181 1020074B03.x3 1020 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 513 Score = 44.1 bits (22), Expect = 0.021 Identities = 28/30 (93%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttg 416 ||||||||||||||| ||||| |||||||| Sbjct: 460 gtgtagttgtagttcgtgcggacatctttg 489 >gi|16918963|gb|BM073975.1|BM073975 MEST78-E04.T3 ISUM4-TN Zea mays cDNA clone MEST78-E04 3', mRNA sequence Length = 550 Score = 44.1 bits (22), Expect = 0.021 Identities = 52/62 (83%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 486 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 545 Query: 447 at 448 || Sbjct: 546 at 547 >gi|32927356|gb|CF032168.1|CF032168 QCE15b04.yg QCE Zea mays cDNA clone QCE15b04, mRNA sequence Length = 505 Score = 44.1 bits (22), Expect = 0.021 Identities = 28/30 (93%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttg 416 ||||||||||||||| ||||| |||||||| Sbjct: 453 gtgtagttgtagttcgtgcggacatctttg 482 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 312 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 367 >gi|33466434|gb|CF243483.1|CF243483 3530_1_21_1_E01.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 783 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 522 gccggcggcggcggaggcgaag 501 >gi|37425514|gb|CF650500.1|CF650500 3530_1_88_1_B03.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 405 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 293 ggtttccaaggagccggcggcggcgg 318 >gi|50326569|gb|CO521695.1|CO521695 3530_1_143_1_C02.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 559 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 346 ggtttccaaggagccggcggcggcgg 371 >gi|50326608|gb|CO521734.1|CO521734 3530_1_143_1_E05.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 695 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 509 gccggcggcggcggaggcgaag 488 >gi|50327104|gb|CO522230.1|CO522230 3530_1_146_1_F07.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 803 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 332 ggtttccaaggagccggcggcggcgg 357 >gi|50327241|gb|CO522367.1|CO522367 3530_1_147_1_F02.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 789 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 338 ggtttccaaggagccggcggcggcgg 363 >gi|50330631|gb|CO525757.1|CO525757 3530_1_171_1_B09.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 522 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 508 gccggcggcggcggaggcgaag 487 >gi|50332007|gb|CO527133.1|CO527133 3530_1_17_1_E01.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 790 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 522 gccggcggcggcggaggcgaag 501 >gi|60399081|gb|DN231895.1|DN231895 MEST1080_A09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 624 Score = 44.1 bits (22), Expect = 0.021 Identities = 52/62 (83%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 535 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 594 Query: 447 at 448 || Sbjct: 595 at 596 >gi|67014587|gb|CO443336.1|CO443336 MZCCL10056A08.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 596 Score = 44.1 bits (22), Expect = 0.021 Identities = 52/62 (83%) Strand = Plus / Minus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 102 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 43 Query: 447 at 448 || Sbjct: 42 at 41 >gi|67014905|gb|CO443654.1|CO443654 MZCCL10048A09.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 895 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 429 gccggcggcggcggaggcgaag 408 >gi|71299558|gb|DR785788.1|DR785788 ZM_BFb0002H07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 854 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|71307347|gb|DR789865.1|DR789865 ZM_BFb0008J13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 792 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 120 ggtttccaaggagccggcggcggcgg 145 >gi|71311766|gb|DR792330.1|DR792330 ZM_BFb0012C08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 847 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 346 ggtttccaaggagccggcggcggcgg 371 >gi|71423703|gb|DR806132.1|DR806132 ZM_BFb0031O17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 828 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|71430206|gb|DR811256.1|DR811256 ZM_BFb0039G03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 812 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 534 gccggcggcggcggaggcgaag 513 >gi|71435019|gb|DR816069.1|DR816069 ZM_BFb0047A11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 771 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 530 gccggcggcggcggaggcgaag 509 >gi|71436080|gb|DR817130.1|DR817130 ZM_BFb0050F08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 760 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|71440687|gb|DR821737.1|DR821737 ZM_BFb0061E21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 750 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 535 gccggcggcggcggaggcgaag 514 >gi|71769306|gb|DR967243.1|DR967243 ZM_BFb0088A11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 856 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 535 gccggcggcggcggaggcgaag 514 >gi|74232717|gb|DT640631.1|DT640631 ZM_BFb0098F11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 886 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 533 gccggcggcggcggaggcgaag 512 >gi|74233533|gb|DT641447.1|DT641447 ZM_BFb0099I06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 809 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 338 ggtttccaaggagccggcggcggcgg 363 >gi|74236601|gb|DT644515.1|DT644515 ZM_BFb0104A15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 927 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 537 gccggcggcggcggaggcgaag 516 >gi|76012385|gb|DT939555.1|DT939555 ZM_BFb0121P19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 800 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 321 ggtttccaaggagccggcggcggcgg 346 >gi|76013280|gb|DT940450.1|DT940450 ZM_BFb0123E19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 868 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 518 gccggcggcggcggaggcgaag 497 >gi|76020041|gb|DT947211.1|DT947211 ZM_BFb0135E19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 714 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 338 ggtttccaaggagccggcggcggcgg 363 >gi|76020527|gb|DT947697.1|DT947697 ZM_BFb0136B12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 762 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 534 gccggcggcggcggaggcgaag 513 >gi|76020893|gb|DT948063.1|DT948063 ZM_BFb0136K07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 749 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 338 ggtttccaaggagccggcggcggcgg 363 >gi|76287010|gb|DV026578.1|DV026578 ZM_BFb0147K19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 757 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 535 gccggcggcggcggaggcgaag 514 >gi|76918904|gb|DV167501.1|DV167501 ZM_BFb0165K06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 875 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 346 ggtttccaaggagccggcggcggcgg 371 >gi|78082312|gb|DV510724.1|DV510724 ZM_BFb0190I08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 725 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 529 gccggcggcggcggaggcgaag 508 >gi|78083740|gb|DV512133.1|DV512133 ZM_BFb0192K15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 720 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 516 gccggcggcggcggaggcgaag 495 >gi|78085312|gb|DV513705.1|DV513705 ZM_BFb0195A15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 666 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 534 gccggcggcggcggaggcgaag 513 >gi|78089120|gb|DV517508.1|DV517508 ZM_BFb0201A24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 499 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 484 gccggcggcggcggaggcgaag 463 >gi|78111953|gb|DV530349.1|DV530349 ZM_BFb0220B16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 571 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 535 gccggcggcggcggaggcgaag 514 >gi|78112281|gb|DV530675.1|DV530675 ZM_BFb0220I17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 686 Score = 44.1 bits (22), Expect = 0.021 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcgaag 270 |||||||||||||||||||||| Sbjct: 510 gccggcggcggcggaggcgaag 489 >gi|78113946|gb|DV532335.1|DV532335 ZM_BFb0222P12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 721 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 321 ggtttccaaggagccggcggcggcgg 346 >gi|86474751|gb|DY241121.1|DY241121 ZM_BFb0261F07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 767 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 347 ggtttccaaggagccggcggcggcgg 372 >gi|88756787|gb|DY540928.1|DY540928 ZM_BFb0358J21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 744 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|89758009|gb|DY687352.1|DY687352 ZM_BFb0276O17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 543 Score = 44.1 bits (22), Expect = 0.021 Identities = 52/62 (83%) Strand = Plus / Plus Query: 387 gtgtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaacc 446 ||||||||||||||| ||||| |||||||| | || || | | |||||||||||| ||| Sbjct: 433 gtgtagttgtagttcgtgcggacatctttgtagccatcgcgcctgtcggggccagccacc 492 Query: 447 at 448 || Sbjct: 493 at 494 >gi|89762420|gb|DY690011.1|DY690011 ZM_BFb0287A07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 854 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|91056069|gb|EB166487.1|EB166487 ZM_BFb0348I16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 858 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 338 ggtttccaaggagccggcggcggcgg 363 >gi|91868699|gb|EB400121.1|EB400121 ZM_BFb0304P06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 754 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Plus Query: 237 ggtttccatggagccggcggcggcgg 262 |||||||| ||||||||||||||||| Sbjct: 348 ggtttccaaggagccggcggcggcgg 373 >gi|6654292|gb|AW267697.1|AW267697 687088H10.x1 687 - Early embryo from Delaware Zea mays cDNA, mRNA sequence Length = 427 Score = 42.1 bits (21), Expect = 0.081 Identities = 50/60 (83%) Strand = Plus / Plus Query: 389 gtagttgtagttcctgcgggcatctttgaacccgtcatggcggtcggggccagcaaccat 448 ||||||| ||||| ||||| |||||||| | || ||| | | |||||||||||| ||||| Sbjct: 290 gtagttgnagttcgtgcggacatctttgtagccatcacgcctgtcggggccagccaccat 349 >gi|20803054|gb|BQ294104.1|BQ294104 1091026C07.y2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 557 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 atgattgtgatggtagcagt 141 |||||||||||||||||||| Sbjct: 33 atgattgtgatggtagcagt 52 >gi|21891489|gb|BQ744702.1|BQ744702 946108D02.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 546 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 513 tttccgaaacccacaacgtagctcatcttcaa 482 >gi|26457071|gb|CA828654.1|CA828654 1114031E04.y2 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 656 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 atgattgtgatggtagcagt 141 |||||||||||||||||||| Sbjct: 44 atgattgtgatggtagcagt 63 >gi|31558489|gb|CD527701.1|CD527701 3529_1_122_1_D01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 631 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Minus Query: 496 tccaccctcctttgcagcca 515 |||||||||||||||||||| Sbjct: 607 tccaccctcctttgcagcca 588 >gi|32850717|gb|CD990398.1|CD990398 QAW3d09.yg QAW Zea mays cDNA clone QAW3d09, mRNA sequence Length = 334 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 329 tttccgaaacccacaacgtagctcatcttcaa 298 >gi|32927901|gb|CF032713.1|CF032713 QCE7a03.yg QCE Zea mays cDNA clone QCE7a03, mRNA sequence Length = 497 Score = 40.1 bits (20), Expect = 0.32 Identities = 47/56 (83%) Strand = Plus / Plus Query: 252 ggcggcggcggaggcgaagggaacatgggcggtactgcagagaacatggtgttctt 307 ||||||||||| |||| |||||||| || || | |||||||| ||||||||||| Sbjct: 291 ggcggcggcgggggcgttgggaacatcggaggaatcgcagagaagatggtgttctt 346 >gi|32931527|gb|CF036339.1|CF036339 QCG30a06.yg QCG Zea mays cDNA clone QCG30a06, mRNA sequence Length = 657 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 atgattgtgatggtagcagt 141 |||||||||||||||||||| Sbjct: 206 atgattgtgatggtagcagt 187 >gi|40337331|gb|CK371401.1|CK371401 zmrww005_0B10-007-f09.s0 zmrww005 Zea mays cDNA 5', mRNA sequence Length = 269 Score = 40.1 bits (20), Expect = 0.32 Identities = 65/80 (81%) Strand = Plus / Minus Query: 232 gtcacggtttccatggagccggcggcggcggaggcgaagggaacatgggcggtactgcag 291 ||||||| ||||||| | |||||||||||| | | |||||||| ||||| || || | Sbjct: 96 gtcacggcttccatgatgacggcggcggcggcgtggccgggaacattggcggcacggcgg 37 Query: 292 agaacatggtgttcttgtcc 311 ||||||||| | |||||||| Sbjct: 36 agaacatggaggtcttgtcc 17 >gi|67017289|gb|CO446038.1|CO446038 MZCCL10118F11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 860 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 747 tttccgaaacccacaacgtagctcatcttcaa 716 >gi|67022056|gb|CO450805.1|CO450805 MZCCL10155D04.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 725 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Minus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 641 tttccgaaacccacaacgtagctcatcttcaa 610 >gi|76288341|gb|DV027909.1|DV027909 ZM_BFb0149K08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 772 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 ataccataccataccatacc 221 |||||||||||||||||||| Sbjct: 87 ataccataccataccatacc 106 >gi|78077137|gb|DV505571.1|DV505571 ZM_BFb0182P06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 824 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 ataccataccataccatacc 221 |||||||||||||||||||| Sbjct: 30 ataccataccataccatacc 49 >gi|78121165|gb|DV539549.1|DV539549 ZM_BFb0233H08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 650 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 ataccataccataccatacc 221 |||||||||||||||||||| Sbjct: 96 ataccataccataccatacc 115 >gi|88754821|gb|DY538962.1|DY538962 ZM_BFb0297C10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 434 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 agccggcggcggcggaggcg 267 |||||||||||||||||||| Sbjct: 93 agccggcggcggcggaggcg 74 >gi|91870878|gb|EB401127.1|EB401127 ZM_BFb0306P05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 773 Score = 40.1 bits (20), Expect = 0.32 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 ataccataccataccatacc 221 |||||||||||||||||||| Sbjct: 82 ataccataccataccatacc 101 >gi|91206523|gb|AC184871.1| Zea mays chromosome UNK clone CH201-163O12; ZMMBBc0163O12, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 174612 Score = 40.1 bits (20), Expect = 0.32 Identities = 29/32 (90%) Strand = Plus / Plus Query: 576 tttccgaacccaaccacgtagctcatcttcaa 607 |||||||| || || ||||||||||||||||| Sbjct: 10843 tttccgaaacccacaacgtagctcatcttcaa 10874 >gi|5915595|gb|AW053236.1|AW053236 614073E07.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 477 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 288 gcagagaacatggtgttcttgtc 310 |||||||| |||||||||||||| Sbjct: 355 gcagagaagatggtgttcttgtc 377 >gi|13150844|gb|BG321166.1|BG321166 Zm04_05a07_R Zm04_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm04_05a07, mRNA sequence Length = 464 Score = 38.2 bits (19), Expect = 1.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 250 ccggcggcggcggaggcgaaggg 272 |||||||||||||||||| |||| Sbjct: 359 ccggcggcggcggaggcggaggg 337 >gi|20811068|gb|BQ295546.1|BQ295546 1091037C10.y2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 531 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 122 atgattgtgatggtagcag 140 ||||||||||||||||||| Sbjct: 1 atgattgtgatggtagcag 19 >gi|26456545|gb|CA828128.1|CA828128 1114024B11.y2 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 147 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 122 atgattgtgatggtagcag 140 ||||||||||||||||||| Sbjct: 47 atgattgtgatggtagcag 65 >gi|30031795|gb|CB833646.1|CB833646 3529_1_83_1_A04.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 392 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 110 ccggcggcggcggaggcga 128 >gi|30031812|gb|CB833663.1|CB833663 3529_1_83_1_B03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 517 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 177 gccggcggcggcggaggcg 159 >gi|32799970|gb|CD952206.1|CD952206 SBB_103 GeneTag2 Zea mays cDNA, mRNA sequence Length = 541 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 244 atggagccggcggcggcgg 262 ||||||||||||||||||| Sbjct: 492 atggagccggcggcggcgg 474 >gi|32906863|gb|CF011676.1|CF011676 QBK10h04.xg QBK Zea mays cDNA clone QBK10h04, mRNA sequence Length = 729 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 251 cggcggcggcggaggcgaa 269 ||||||||||||||||||| Sbjct: 48 cggcggcggcggaggcgaa 30 >gi|37417434|gb|CF646370.1|CF646370 3530_1_112_1_H03.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 385 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 13 ccggcggcggcggaggcga 31 >gi|37418732|gb|CF647038.1|CF647038 3530_1_37_1_H04.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 331 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 263 gccggcggcggcggaggcg 245 >gi|50326127|gb|CO521253.1|CO521253 3530_1_140_1_D10.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 766 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 698 gccggcggcggcggaggcg 716 >gi|50326128|gb|CO521254.1|CO521254 3530_1_140_1_D10.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 670 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 544 gccggcggcggcggaggcg 526 >gi|50327086|gb|CO522212.1|CO522212 3530_1_146_1_E09.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 726 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|50327087|gb|CO522213.1|CO522213 3530_1_146_1_E09.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 665 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 118 gccggcggcggcggaggcg 100 >gi|67014653|gb|CO443402.1|CO443402 MZCCL10056G10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 812 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 596 gccggcggcggcggaggcg 578 >gi|67019974|gb|CO448723.1|CO448723 MZCCL10131D01.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 807 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 430 gccggcggcggcggaggcg 412 >gi|67027655|gb|CO456404.1|CO456404 MZCCS15005H10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 848 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 251 cggcggcggcggaggcgaa 269 ||||||||||||||||||| Sbjct: 97 cggcggcggcggaggcgaa 79 >gi|71302523|gb|DR787380.1|DR787380 ZM_BFb0004M15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 722 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 551 gccggcggcggcggaggcg 533 >gi|71319861|gb|DR796687.1|DR796687 ZM_BFb0018H06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 835 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 117 gccggcggcggcggaggcg 99 >gi|71327068|gb|DR800176.1|DR800176 ZM_BFb0023H07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 749 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 101 gccggcggcggcggaggcg 119 >gi|71429846|gb|DR810896.1|DR810896 ZM_BFb0038N21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 456 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 95 gccggcggcggcggaggcg 113 >gi|71433543|gb|DR814593.1|DR814593 ZM_BFb0044F03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 828 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 553 gccggcggcggcggaggcg 535 >gi|71439229|gb|DR820279.1|DR820279 ZM_BFb0058F12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 775 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 513 ccggcggcggcggaggcga 531 >gi|71446594|gb|DR827644.1|DR827644 ZM_BFb0070P08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 785 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 60 ccggcggcggcggaggcga 78 >gi|71768220|gb|DR966157.1|DR966157 ZM_BFb0086G07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 823 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 95 gccggcggcggcggaggcg 113 >gi|71769718|gb|DR967655.1|DR967655 ZM_BFb0088J18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 778 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 736 gccggcggcggcggaggcg 754 >gi|71769719|gb|DR967656.1|DR967656 ZM_BFb0088J18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 738 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 536 gccggcggcggcggaggcg 518 >gi|71771280|gb|DR969217.1|DR969217 ZM_BFb0090N19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 781 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 595 ccggcggcggcggaggcga 613 >gi|71772142|gb|DR970079.1|DR970079 ZM_BFb0092B24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 823 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 101 gccggcggcggcggaggcg 119 >gi|71773349|gb|DR971253.1|DR971253 ZM_BFb0093N21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 739 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|74232889|gb|DT640803.1|DT640803 ZM_BFb0098J06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 806 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 536 gccggcggcggcggaggcg 518 >gi|74233933|gb|DT641847.1|DT641847 ZM_BFb0100B13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 878 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|74233934|gb|DT641848.1|DT641848 ZM_BFb0100B13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 674 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 553 gccggcggcggcggaggcg 535 >gi|74234614|gb|DT642528.1|DT642528 ZM_BFb0101B09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 883 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|74234615|gb|DT642529.1|DT642529 ZM_BFb0101B09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 810 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 553 gccggcggcggcggaggcg 535 >gi|74238189|gb|DT646103.1|DT646103 ZM_BFb0106H06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 717 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 684 gccggcggcggcggaggcg 702 >gi|74238190|gb|DT646104.1|DT646104 ZM_BFb0106H06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 822 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 713 gccggcggcggcggaggcg 695 >gi|74242342|gb|DT650256.1|DT650256 ZM_BFb0113L01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 779 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 636 gccggcggcggcggaggcg 618 >gi|74244292|gb|DT652206.1|DT652206 ZM_BFb0118C02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 891 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 75 gccggcggcggcggaggcg 57 >gi|76010491|gb|DT937661.1|DT937661 ZM_BFb0117D12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 825 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|76010492|gb|DT937662.1|DT937662 ZM_BFb0117D12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 806 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 790 gccggcggcggcggaggcg 772 >gi|76012256|gb|DT939426.1|DT939426 ZM_BFb0121K05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 788 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 551 gccggcggcggcggaggcg 533 >gi|76012643|gb|DT939813.1|DT939813 ZM_BFb0122F15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 852 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|76012644|gb|DT939814.1|DT939814 ZM_BFb0122F15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 799 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 541 gccggcggcggcggaggcg 523 >gi|76014415|gb|DT941585.1|DT941585 ZM_BFb0125N12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 602 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 464 gccggcggcggcggaggcg 482 >gi|76015034|gb|DT942204.1|DT942204 ZM_BFb0127D07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 827 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 253 gcggcggcggaggcgaagg 271 ||||||||||||||||||| Sbjct: 52 gcggcggcggaggcgaagg 34 >gi|76020692|gb|DT947862.1|DT947862 ZM_BFb0136F17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 831 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|76020693|gb|DT947863.1|DT947863 ZM_BFb0136F17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 732 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 541 gccggcggcggcggaggcg 523 >gi|76283477|gb|DV023045.1|DV023045 ZM_BFb0142I01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 482 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 128 ccggcggcggcggaggcga 146 >gi|76919754|gb|DV167852.1|DV167852 ZM_BFb0166D03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 813 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|76929269|gb|DV171937.1|DV171937 ZM_BFb0172P18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 711 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|76930300|gb|DV172324.1|DV172324 ZM_BFb0173M20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 755 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 630 gccggcggcggcggaggcg 612 >gi|78073756|gb|DV502190.1|DV502190 ZM_BFb0173M20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 755 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 630 gccggcggcggcggaggcg 612 >gi|78074538|gb|DV502972.1|DV502972 ZM_BFb0178B04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 665 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 543 gccggcggcggcggaggcg 561 >gi|78076246|gb|DV504680.1|DV504680 ZM_BFb0181K16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 739 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|78076247|gb|DV504681.1|DV504681 ZM_BFb0181K16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 851 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 553 gccggcggcggcggaggcg 535 >gi|78076974|gb|DV505408.1|DV505408 ZM_BFb0182L13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 851 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|78076975|gb|DV505409.1|DV505409 ZM_BFb0182L13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 702 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 529 gccggcggcggcggaggcg 511 >gi|78081636|gb|DV510048.1|DV510048 ZM_BFb0189H17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 781 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 98 ccggcggcggcggaggcga 116 >gi|78081833|gb|DV510245.1|DV510245 ZM_BFb0189M11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 768 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 685 gccggcggcggcggaggcg 703 >gi|78081834|gb|DV510246.1|DV510246 ZM_BFb0189M11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 716 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 710 gccggcggcggcggaggcg 692 >gi|78087054|gb|DV515447.1|DV515447 ZM_BFb0198A12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 714 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 530 gccggcggcggcggaggcg 512 >gi|78087343|gb|DV515736.1|DV515736 ZM_BFb0198H05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 683 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 530 gccggcggcggcggaggcg 512 >gi|78115240|gb|DV533628.1|DV533628 ZM_BFb0224M22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 855 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 94 ccggcggcggcggaggcga 112 >gi|78115993|gb|DV534381.1|DV534381 ZM_BFb0225P06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 640 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 99 ccggcggcggcggaggcga 117 >gi|84970326|gb|DW468676.1|DW468676 ZM_BFb0172P18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 711 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|86466821|gb|DY233191.1|DY233191 ZM_BFb0242K13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 800 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|86468770|gb|DY235140.1|DY235140 ZM_BFb0245L14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 493 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 105 gccggcggcggcggaggcg 123 >gi|86469552|gb|DY235922.1|DY235922 ZM_BFb0246O08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 613 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 531 gccggcggcggcggaggcg 513 >gi|86470590|gb|DY236960.1|DY236960 ZM_BFb0253K21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 447 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 114 gccggcggcggcggaggcg 96 >gi|89248319|gb|DY620105.1|DY620105 ZM_BFb0278I08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 478 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 117 gccggcggcggcggaggcg 99 >gi|89249942|gb|DY621728.1|DY621728 ZM_BFb0285K24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 671 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 543 gccggcggcggcggaggcg 561 >gi|89755958|gb|DY686180.1|DY686180 ZM_BFb0274E01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 710 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 190 gccggcggcggcggaggcg 172 >gi|91872441|gb|EB402398.1|EB402398 ZM_BFb0309D02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 753 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 551 gccggcggcggcggaggcg 533 >gi|91873372|gb|EB403329.1|EB403329 ZM_BFb0310L10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 714 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 686 gccggcggcggcggaggcg 704 >gi|91873373|gb|EB403330.1|EB403330 ZM_BFb0310L10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 756 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 604 gccggcggcggcggaggcg 586 >gi|91878323|gb|EB408280.1|EB408280 ZM_BFb0320P22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 323 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 107 ccggcggcggcggaggcga 125 >gi|93013716|gb|EB639236.1|EB639236 ZM_BFb0326O03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 803 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 253 gcggcggcggaggcgaagg 271 ||||||||||||||||||| Sbjct: 27 gcggcggcggaggcgaagg 9 >gi|93015371|gb|EB640891.1|EB640891 ZM_BFb0330C04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 733 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 109 ccggcggcggcggaggcga 127 >gi|93015694|gb|EB641214.1|EB641214 ZM_BFb0330K06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 677 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 590 gccggcggcggcggaggcg 572 >gi|93017044|gb|EB642564.1|EB642564 ZM_BFb0332P12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 714 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggcg 267 ||||||||||||||||||| Sbjct: 535 gccggcggcggcggaggcg 517 >gi|21212172|gb|AY108884.1| Zea mays PCO064378 mRNA sequence Length = 1261 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 102 ccggcggcggcggaggcga 120 >gi|47102550|gb|BV153093.1| PZA02282-74838-Mo17 Zea mays Mo17 Zea mays STS genomic, sequence tagged site Length = 287 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 202 ataccataccataccatac 220 ||||||||||||||||||| Sbjct: 192 ataccataccataccatac 174 >gi|21212172|gb|AY108884.1| Zea mays PCO064378 mRNA sequence Length = 1261 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 250 ccggcggcggcggaggcga 268 ||||||||||||||||||| Sbjct: 102 ccggcggcggcggaggcga 120 >gi|92110175|gb|AC185312.1| Zea mays chromosome UNK clone CH201-321N9; ZMMBBc0321N09, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 149133 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 203 taccataccataccatacc 221 ||||||||||||||||||| Sbjct: 148162 taccataccataccatacc 148144 >gi|90568153|gb|AC183941.1| Zea mays chromosome UNK clone CH201-9B10; ZMMBBc0009B10, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 216944 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 203 taccataccataccatacc 221 ||||||||||||||||||| Sbjct: 103939 taccataccataccatacc 103957 Score = 36.2 bits (18), Expect = 5.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 245 tggagccggcggcggcgg 262 |||||||||||||||||| Sbjct: 211136 tggagccggcggcggcgg 211119 >gi|58082471|gb|AC155612.2| Zea mays strain B73 clone ZMMBBc0286H14, *** SEQUENCING IN PROGRESS ***, 30 unordered pieces Length = 189608 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 203 taccataccataccatacc 221 ||||||||||||||||||| Sbjct: 185605 taccataccataccatacc 185623 >gi|409620|gb|T12682.1|T12682 zEST00051-5 Maize Leaf, Stratagene #937005 Zea mays cDNA clone csuh00051 5' end, mRNA sequence Length = 243 Score = 36.2 bits (18), Expect = 5.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 254 cggcggcggaggcgaagg 271 |||||||||||||||||| Sbjct: 152 cggcggcggaggcgaagg 135 >gi|4609652|gb|AI600491.1|AI600491 486075F03.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 275 Score = 36.2 bits (18), Expect = 5.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 249 gccggcggcggcggaggc 266 |||||||||||||||||| Sbjct: 124 gccggcggcggcggaggc 107 >gi|5152836|gb|AI759134.1|AI759134 605085E09.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 497 Score = 36.2 bits (18), Expect = 5.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 245 tggagccggcggcggcgg 262 |||||||||||||||||| Sbjct: 454 tggagccggcggcggcgg 437 >gi|5819347|gb|AI987553.1|AI987553 614055E06.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 483 Score = 36.2 bits (18), Expect = 5.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 248 agccggcggcggcggagg 265 |||||||||||||||||| Sbjct: 317 agccggcggcggcggagg 334 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 365,174 Number of Sequences: 836351 Number of extensions: 365174 Number of successful extensions: 50337 Number of sequences better than 10.0: 400 Number of HSP's better than 10.0 without gapping: 398 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 49513 Number of HSP's gapped (non-prelim): 755 length of query: 615 length of database: 669,372,029 effective HSP length: 19 effective length of query: 596 effective length of database: 653,481,360 effective search space: 389474890560 effective search space used: 389474890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)