BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 3067450.2.1 (724 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|14717505|gb|BI245155.1|BI245155 949024A07.x1 949 - Juvenile l... 1126 0.0 gi|45847135|gb|CN071078.1|CN071078 1021007E06.x3 1021 - Unigene ... 948 0.0 gi|37374491|gb|CF623609.1|CF623609 zmrws05_0A10-010-b06.s4 zmrws... 902 0.0 gi|78021886|gb|DV490273.1|DV490273 1000028-B07.T7-1 UGI-Reseq Ze... 852 0.0 gi|12968587|gb|BG265533.1|BG265533 1000028E12.x1 1000 - Unigene ... 771 0.0 gi|5714285|gb|AI944270.1|AI944270 614039H03.x1 614 - root cDNA l... 613 e-173 gi|12968563|gb|BG265509.1|BG265509 1000028B07.x4 1000 - Unigene ... 551 e-155 gi|32790665|gb|CD942901.1|CD942901 RCF_53 GeneTag1 Zea mays cDNA... 351 8e-95 gi|31558507|gb|CD527719.1|CD527719 3529_1_122_1_E07.y_1 3529 - 2... 82 1e-13 gi|14242952|gb|BG840182.2|BG840182 MEST8-C04.T3 ISUM3-TL Zea may... 78 2e-12 gi|14245101|gb|BG873683.1|BG873683 MEST8-C04.T7-1 ISUM3-TL Zea m... 78 2e-12 gi|16918384|gb|BM073722.1|BM073722 MEST73-A08.T3 ISUM4-TN Zea ma... 78 2e-12 gi|18178788|gb|BM379998.1|BM379998 MEST513-F04.univ ISUM6 Zea ma... 78 2e-12 gi|31911242|gb|CD651826.1|CD651826 3529_1_140_1_E06.x_1 3529 - 2... 78 2e-12 gi|71318982|gb|DR796240.1|DR796240 ZM_BFb0017M08.f ZM_BFb Zea ma... 78 2e-12 gi|71319840|gb|DR796671.1|DR796671 ZM_BFb0018G21.f ZM_BFb Zea ma... 78 2e-12 gi|71446177|gb|DR827227.1|DR827227 ZM_BFb0070F19.f ZM_BFb Zea ma... 78 2e-12 gi|71767292|gb|DR965229.1|DR965229 ZM_BFb0085B05.f ZM_BFb Zea ma... 78 2e-12 gi|71772534|gb|DR970465.1|DR970465 ZM_BFb0092L10.f ZM_BFb Zea ma... 78 2e-12 gi|76282495|gb|DV022063.1|DV022063 ZM_BFb0141B06.f ZM_BFb Zea ma... 78 2e-12 gi|78078800|gb|DV507212.1|DV507212 ZM_BFb0185E12.f ZM_BFb Zea ma... 78 2e-12 gi|78078878|gb|DV507290.1|DV507290 ZM_BFb0185G08.f ZM_BFb Zea ma... 78 2e-12 gi|78081460|gb|DV509872.1|DV509872 ZM_BFb0189D16.f ZM_BFb Zea ma... 78 2e-12 gi|83278940|gb|DV942948.1|DV942948 1000137-H06.T7-1 UGI-Reseq Ze... 78 2e-12 gi|71318984|gb|DR796241.1|DR796241 ZM_BFb0017M08.r ZM_BFb Zea ma... 74 3e-11 gi|71319842|gb|DR796672.1|DR796672 ZM_BFb0018G21.r ZM_BFb Zea ma... 74 3e-11 gi|71430405|gb|DR811455.1|DR811455 ZM_BFb0039K17.r ZM_BFb Zea ma... 74 3e-11 gi|71437245|gb|DR818295.1|DR818295 ZM_BFb0053A19.r ZM_BFb Zea ma... 74 3e-11 gi|71439848|gb|DR820898.1|DR820898 ZM_BFb0059O06.r ZM_BFb Zea ma... 74 3e-11 gi|71446178|gb|DR827228.1|DR827228 ZM_BFb0070F19.r ZM_BFb Zea ma... 74 3e-11 gi|71447528|gb|DR828578.1|DR828578 ZM_BFb0073J05.r ZM_BFb Zea ma... 74 3e-11 gi|71767293|gb|DR965230.1|DR965230 ZM_BFb0085B05.r ZM_BFb Zea ma... 74 3e-11 gi|71772535|gb|DR970466.1|DR970466 ZM_BFb0092L10.r ZM_BFb Zea ma... 74 3e-11 gi|76288542|gb|DV028110.1|DV028110 ZM_BFb0149P04.r ZM_BFb Zea ma... 74 3e-11 gi|78078801|gb|DV507213.1|DV507213 ZM_BFb0185E12.r ZM_BFb Zea ma... 74 3e-11 gi|78078879|gb|DV507291.1|DV507291 ZM_BFb0185G08.r ZM_BFb Zea ma... 74 3e-11 gi|91875289|gb|EB405246.1|EB405246 ZM_BFb0315B22.r ZM_BFb Zea ma... 74 3e-11 gi|71760483|gb|DR958420.1|DR958420 ZM_BFb0059O06.f ZM_BFb Zea ma... 72 1e-10 gi|89251139|gb|DY622925.1|DY622925 ZM_BFb0293A02.r ZM_BFb Zea ma... 72 1e-10 gi|14997326|gb|BI319303.1|BI319303 949035C01.x1 949 - Juvenile l... 70 4e-10 gi|15426915|gb|BI542737.1|BI542737 949072A08.x2 949 - Juvenile l... 70 4e-10 gi|76282932|gb|DV022500.1|DV022500 ZM_BFb0141L01.f ZM_BFb Zea ma... 70 4e-10 gi|76282933|gb|DV022501.1|DV022501 ZM_BFb0141L01.r ZM_BFb Zea ma... 70 4e-10 gi|21216141|gb|AY111551.1| Zea mays CL10273_1 mRNA sequence 70 4e-10 gi|21216141|gb|AY111551.1| Zea mays CL10273_1 mRNA sequence 70 4e-10 gi|56461989|gb|CK986287.1|CK986287 WSEST0055 water stress specif... 68 2e-09 gi|15427187|gb|BI543009.1|BI543009 949072A08.y1 949 - Juvenile l... 66 7e-09 gi|31998550|gb|CD662129.1|CD662129 3529_1_140_1_E06.y_1 3529 - 2... 66 7e-09 gi|78105223|gb|DV523641.1|DV523641 ZM_BFb0209P04.r ZM_BFb Zea ma... 66 7e-09 gi|4572814|gb|AI586463.1|AI586463 486051D10.x2 486 - leaf primor... 64 3e-08 gi|4680851|gb|AI629521.1|AI629521 486102B03.x1 486 - leaf primor... 64 3e-08 gi|14243855|gb|BG841509.2|BG841509 MEST22-D12.T3 ISUM4-TN Zea ma... 64 3e-08 gi|32941167|gb|CF045986.1|CF045986 QCK1e12.yg QCK Zea mays cDNA ... 64 3e-08 gi|71762216|gb|DR960153.1|DR960153 ZM_BFb0073J05.f ZM_BFb Zea ma... 64 3e-08 gi|76012180|gb|DT939350.1|DT939350 ZM_BFb0121G21.r ZM_BFb Zea ma... 64 3e-08 gi|76282496|gb|DV022064.1|DV022064 ZM_BFb0141B06.r ZM_BFb Zea ma... 64 3e-08 gi|78081461|gb|DV509873.1|DV509873 ZM_BFb0189D16.r ZM_BFb Zea ma... 64 3e-08 gi|93012136|gb|EB637656.1|EB637656 ZM_BFb0323L22.r ZM_BFb Zea ma... 64 3e-08 gi|4647079|gb|AI622154.1|AI622154 486036C10.x1 486 - leaf primor... 62 1e-07 gi|6095546|gb|AW120213.1|AW120213 614086G02.y1 614 - root cDNA l... 62 1e-07 gi|13126566|gb|BG317136.1|BG317136 947025G05.x2 947 - 2 week sho... 62 1e-07 gi|16377744|gb|BI992097.1|BI992097 1020056E02.x1 1020 - Unigene ... 62 1e-07 gi|16917259|gb|BM073205.1|BM073205 MEST62-E09.T3 ISUM4-TN Zea ma... 62 1e-07 gi|37400925|gb|CF637823.1|CF637823 zmrww00_0B20-010-c10.s0 zmrww... 62 1e-07 gi|60339001|gb|DN205974.1|DN205974 MEST826_C08.T7-1 UGA-ZmSAM-XZ... 62 1e-07 gi|60344173|gb|DN211146.1|DN211146 MEST920_A10.T7-1 UGA-ZmSAM-XZ... 62 1e-07 gi|60353806|gb|DN220779.1|DN220779 MEST1101_C11.T7-1 UGA-ZmSAM-X... 62 1e-07 gi|60354176|gb|DN221149.1|DN221149 MEST1108_G03.T7-1 UGA-ZmSAM-X... 62 1e-07 gi|60395541|gb|DN228411.1|DN228411 MEST1219_D04.T7-1 UGA-ZmSAM-X... 62 1e-07 gi|60398612|gb|DN231428.1|DN231428 MEST1139_A06.T7-1 UGA-ZmSAM-X... 62 1e-07 gi|60400518|gb|DN233325.1|DN233325 MEST863_C05.T7-1 UGA-ZmSAM-XZ... 62 1e-07 gi|60400863|gb|DN233670.1|DN233670 MEST1093_G10.T7-1 UGA-ZmSAM-X... 62 1e-07 gi|76011246|gb|DT938416.1|DT938416 ZM_BFb0118L07.f ZM_BFb Zea ma... 62 1e-07 gi|86473110|gb|DY239480.1|DY239480 ZM_BFb0258B14.f ZM_BFb Zea ma... 62 1e-07 gi|21211011|gb|AY107933.1| Zea mays PCO142167 mRNA sequence 62 1e-07 gi|21211011|gb|AY107933.1| Zea mays PCO142167 mRNA sequence 62 1e-07 gi|5740343|gb|AI948033.1|AI948033 603033C08.x1 603 - stressed ro... 60 4e-07 gi|13150795|gb|BG321117.1|BG321117 Zm04_01g01_A Zm04_AAFC_ECORC_... 60 4e-07 gi|14244242|gb|BG842234.2|BG842234 MEST28-E02.T3 ISUM4-TN Zea ma... 60 4e-07 gi|14245171|gb|BG873753.1|BG873753 MEST42-B10.T3 ISUM4-TN Zea ma... 60 4e-07 gi|16918162|gb|BM073609.1|BM073609 MEST71-A11.T3 ISUM4-TN Zea ma... 60 4e-07 gi|16918220|gb|BM073637.1|BM073637 MEST71-E06.T3 ISUM4-TN Zea ma... 60 4e-07 gi|16925799|gb|BM078867.1|BM078867 MEST125-C10.T3 ISUM4-TN Zea m... 60 4e-07 gi|16927009|gb|BM080072.1|BM080072 MEST103-G05.T3 ISUM4-TN Zea m... 60 4e-07 gi|16927215|gb|BM080284.1|BM080284 MEST106-E03.T3 ISUM4-TN Zea m... 60 4e-07 gi|16927323|gb|BM080392.1|BM080392 MEST107-H02.T3 ISUM4-TN Zea m... 60 4e-07 gi|16927615|gb|BM080684.1|BM080684 MEST112-A04.T3 ISUM4-TN Zea m... 60 4e-07 gi|18177931|gb|BM379141.1|BM379141 MEST500-C03.univ ISUM6 Zea ma... 60 4e-07 gi|18178067|gb|BM379277.1|BM379277 MEST503-C08.univ ISUM6 Zea ma... 60 4e-07 gi|18178196|gb|BM379406.1|BM379406 MEST505-B07.univ ISUM6 Zea ma... 60 4e-07 gi|18178753|gb|BM379963.1|BM379963 MEST513-B03.univ ISUM6 Zea ma... 60 4e-07 gi|18178985|gb|BM380195.1|BM380195 MEST516-D09.univ ISUM6 Zea ma... 60 4e-07 gi|24934203|gb|CA452421.1|CA452421 Rxo#1_E03 subtracted cDNA lib... 60 4e-07 gi|28983046|gb|BQ538472.2|BQ538472 MEST601-B03.T3 ISUM4-TN Zea m... 60 4e-07 gi|32919168|gb|CF023980.1|CF023980 QBS12g05.xg QBS Zea mays cDNA... 60 4e-07 gi|32919309|gb|CF024121.1|CF024121 QBS1b01.xg QBS Zea mays cDNA ... 60 4e-07 gi|37376716|gb|CF624913.1|CF624913 zmrws05_0A20-010-g05.s4 zmrws... 60 4e-07 gi|37382886|gb|CF628414.1|CF628414 zmrws48_0A10-005-f02.s3 zmrws... 60 4e-07 gi|60351836|gb|DN218809.1|DN218809 MEST1072_E05.T7-1 UGA-ZmSAM-X... 60 4e-07 gi|60357413|gb|DN224386.1|DN224386 MEST1157_H12.T7-1 UGA-ZmSAM-X... 60 4e-07 gi|71762182|gb|DR960119.1|DR960119 ZM_BFb0073H11.f ZM_BFb Zea ma... 60 4e-07 gi|78074469|gb|DV502903.1|DV502903 ZM_BFb0174O20.f ZM_BFb Zea ma... 60 4e-07 gi|78080832|gb|DV509244.1|DV509244 ZM_BFb0188D19.f ZM_BFb Zea ma... 60 4e-07 gi|78104756|gb|DV523174.1|DV523174 ZM_BFb0209E14.f ZM_BFb Zea ma... 60 4e-07 gi|89760256|gb|DY688746.1|DY688746 ZM_BFb0284B18.f ZM_BFb Zea ma... 60 4e-07 gi|21208169|gb|AY105091.1| Zea mays PCO138435 mRNA sequence 60 4e-07 gi|21208169|gb|AY105091.1| Zea mays PCO138435 mRNA sequence 60 4e-07 gi|16919927|gb|BM074424.1|BM074424 MEST86-B06.T3 ISUM4-TN Zea ma... 56 6e-06 gi|22490218|gb|BU050141.1|BU050141 1111020D01.y1 1111 - Unigene ... 56 6e-06 gi|87153310|gb|DY398099.1|DY398099 III-952-5C-D01.M13-R UGIII-Re... 56 6e-06 gi|14244833|gb|BG842771.2|BG842771 MEST39-H06.T3 ISUM4-TN Zea ma... 54 3e-05 gi|45847321|gb|CN071264.1|CN071264 1021010A11.x1 1021 - Unigene ... 54 3e-05 gi|71758528|gb|DR956465.1|DR956465 ZM_BFb0053A19.f ZM_BFb Zea ma... 54 3e-05 gi|18179412|gb|BM380622.1|BM380622 MEST522-F04.univ ISUM6 Zea ma... 52 1e-04 gi|18180516|gb|BM381726.1|BM381726 MEST539-B12.univ ISUM6 Zea ma... 52 1e-04 gi|6194755|gb|AW146859.1|AW146859 614088G05.y1 614 - root cDNA l... 50 4e-04 gi|32919279|gb|CF024091.1|CF024091 QBS13g08.xg QBS Zea mays cDNA... 50 4e-04 gi|14202318|gb|BG835995.1|BG835995 Zm06_06e10_A Zm06_AAFC_ECORC_... 48 0.002 gi|16921383|gb|BM075125.1|BM075125 MEST350-F03.T3 ISUM5-RN Zea m... 48 0.002 gi|37396660|gb|CF635623.1|CF635623 zmrww00_0A20-012-f02.s4 zmrww... 48 0.002 gi|12971740|gb|BG267634.1|BG267634 1000135B04.x1 1000 - Unigene ... 44 0.024 gi|18176891|gb|BM378101.1|BM378101 MEST349-A09.T3 ISUM5-RN Zea m... 44 0.024 gi|18176921|gb|BM378131.1|BM378131 MEST145-F06.T3 ISUM5-RN Zea m... 44 0.024 gi|18177079|gb|BM378289.1|BM378289 MEST401-G05.univ ISUM5-RN Zea... 44 0.024 gi|18179446|gb|BM380656.1|BM380656 MEST523-B01.univ ISUM6 Zea ma... 44 0.024 gi|32864158|gb|CF003840.1|CF003840 QBH23d09.xg QBH Zea mays cDNA... 44 0.024 gi|60399950|gb|DN232757.1|DN232757 MEST837_G08.T7-1 UGA-ZmSAM-XZ... 44 0.024 gi|89274357|gb|AC183513.1| Zea mays chromosome UNK clone CH201-2... 44 0.024 gi|4647699|gb|AI622774.1|AI622774 486106E09.x1 486 - leaf primor... 42 0.096 gi|4647700|gb|AI622775.1|AI622775 486106E09.x2 486 - leaf primor... 42 0.096 gi|5740160|gb|AI947850.1|AI947850 603029F07.x1 603 - stressed ro... 42 0.096 gi|15352979|gb|BI502590.1|BI502590 949072A08.x1 949 - Juvenile l... 42 0.096 gi|16927167|gb|BM080236.1|BM080236 MEST105-H03.T3 ISUM4-TN Zea m... 42 0.096 gi|19769784|gb|BQ034505.1|BQ034505 1091003B01.x2 1091 - Immature... 42 0.096 gi|22549130|gb|BU101331.1|BU101331 946153C11.x1 946 - tassel pri... 42 0.096 gi|22935391|gb|BU571666.1|BU571666 946183H06.x1 946 - tassel pri... 42 0.096 gi|28931304|gb|CB334665.1|CB334665 3529_1_40_1_A01.y_1 3529 - 2 ... 42 0.096 gi|30032023|gb|CB833874.1|CB833874 3529_1_84_1_G12.y_1 3529 - 2 ... 42 0.096 gi|29945046|gb|CB815441.1|CB815441 3529_1_73_1_D10.x_1 3529 - 2 ... 42 0.096 gi|29947405|gb|CB816640.1|CB816640 3529_1_84_1_G12.x_1 3529 - 2 ... 42 0.096 gi|33102426|gb|CF062386.1|CF062386 QCT8f07.yg QCT Zea mays cDNA ... 42 0.096 gi|37388432|gb|CF631425.1|CF631425 zmrws48_0B10-009-a04.s3 zmrws... 42 0.096 gi|40334276|gb|CK368346.1|CK368346 zmrws055_0A20-001-d11.s0 zmrw... 42 0.096 gi|45567928|gb|CK985817.1|CK985817 zmrsub1_0B10-010-d06.s0 zmrsu... 42 0.096 gi|45846925|gb|CN070868.1|CN070868 1021004E06.x2 1021 - Unigene ... 42 0.096 gi|60344617|gb|DN211590.1|DN211590 MEST926_H10.T7-1 UGA-ZmSAM-XZ... 42 0.096 gi|60348835|gb|DN215808.1|DN215808 MEST978_H10.T7-1 UGA-ZmSAM-XZ... 42 0.096 gi|78543728|gb|DV621226.1|DV621226 IV-1091-401A-H03.T7-1 UGIV-10... 42 0.096 gi|78543795|gb|DV621293.1|DV621293 IV-1091-401B-B05.T7-1 UGIV-10... 42 0.096 gi|78544182|gb|DV621680.1|DV621680 IV-1091-405C-A06.T7-1 UGIV-10... 42 0.096 gi|83278246|gb|DV942254.1|DV942254 1000146-C08.T7-1 UGI-Reseq Ze... 42 0.096 gi|91869444|gb|EB400388.1|EB400388 ZM_BFb0305H20.r ZM_BFb Zea ma... 42 0.096 gi|21211991|gb|AY108765.1| Zea mays PCO088803 mRNA sequence 42 0.096 gi|21211991|gb|AY108765.1| Zea mays PCO088803 mRNA sequence 42 0.096 gi|14243460|gb|BG841139.2|BG841139 MEST18-A10.T3 ISUM4-TN Zea ma... 40 0.38 gi|32792300|gb|CD944536.1|CD944536 RDK_15 GeneTag1 Zea mays cDNA... 40 0.38 gi|32825786|gb|CD965487.1|CD965487 SEK_168 GeneTag2 Zea mays cDN... 40 0.38 gi|37375813|gb|CF624375.1|CF624375 zmrws05_0A20-003-a05.s4 zmrws... 40 0.38 gi|37377707|gb|CF625483.1|CF625483 zmrws05_0A21-001-d11.s4 zmrws... 40 0.38 gi|78090763|gb|DV519137.1|DV519137 ZM_BFb0203G24.f ZM_BFb Zea ma... 40 0.38 gi|78090764|gb|DV519138.1|DV519138 ZM_BFb0203G24.r ZM_BFb Zea ma... 40 0.38 gi|83278180|gb|DV942188.1|DV942188 1000141-A09.T7-1 UGI-Reseq Ze... 40 0.38 gi|404069|gb|L14063.1|MZEOMT Zea mays O-methyltransferase mRNA, ... 40 0.38 gi|21214492|gb|AY110291.1| Zea mays CL2555_1 mRNA sequence 40 0.38 gi|404069|gb|L14063.1|MZEOMT Zea mays O-methyltransferase mRNA, ... 40 0.38 gi|21214492|gb|AY110291.1| Zea mays CL2555_1 mRNA sequence 40 0.38 gi|71427858|gb|DR808908.1|DR808908 ZM_BFb0035N20.r ZM_BFb Zea ma... 38 1.5 gi|74244502|gb|DT652416.1|DT652416 ZM_BFb0118L07.r ZM_BFb Zea ma... 38 1.5 gi|78105222|gb|DV523640.1|DV523640 ZM_BFb0209P04.f ZM_BFb Zea ma... 38 1.5 gi|89274344|gb|AC183510.1| Zea mays chromosome UNK clone ZMMBBb-... 38 1.5 gi|88687869|gb|AC182836.1| Zea mays chromosome UNK clone CH201-1... 38 1.5 gi|14244162|gb|BG841833.2|BG841833 MEST27-A11.T3 ISUM4-TN Zea ma... 36 5.9 gi|18181552|gb|BM382762.1|BM382762 MEST554-D06.univ ISUM6 Zea ma... 36 5.9 gi|32850331|gb|CD990012.1|CD990012 QAV2b01.yg QAV Zea mays cDNA ... 36 5.9 gi|40303782|gb|CK348169.1|CK348169 zmrsub1_0X10-001-f06.s4 zmrsu... 36 5.9 gi|71425668|gb|DR806818.1|DR806818 ZM_BFb0032O04.f ZM_BFb Zea ma... 36 5.9 gi|71446842|gb|DR827892.1|DR827892 ZM_BFb0071J17.r ZM_BFb Zea ma... 36 5.9 gi|71447607|gb|DR828657.1|DR828657 ZM_BFb0073M16.r ZM_BFb Zea ma... 36 5.9 gi|71761531|gb|DR959468.1|DR959468 ZM_BFb0071J17.f ZM_BFb Zea ma... 36 5.9 gi|76931794|gb|DV172857.1|DV172857 ZM_BFb0175J17.r ZM_BFb Zea ma... 36 5.9 gi|78091199|gb|DV519573.1|DV519573 ZM_BFb0204A22.r ZM_BFb Zea ma... 36 5.9 gi|78115778|gb|DV534166.1|DV534166 ZM_BFb0225K03.r ZM_BFb Zea ma... 36 5.9 gi|86473028|gb|DY239398.1|DY239398 ZM_BFb0257O13.r ZM_BFb Zea ma... 36 5.9 gi|88749535|gb|DY533676.1|DY533676 ZM_BFb0264H09.f ZM_BFb Zea ma... 36 5.9 gi|92901083|gb|AC185480.1| Zea mays chromosome 4 clone CH201-194... 36 5.9 gi|92900965|gb|AC185478.1| Zea mays chromosome 4 clone CH201-203... 36 5.9 gi|92900781|gb|AC185470.1| Zea mays chromosome 4 clone CH201-266... 36 5.9 gi|92899711|gb|AC185421.1| Zea mays chromosome 4 clone CH201-527... 36 5.9 gi|92110167|gb|AC185304.1| Zea mays chromosome UNK clone CH201-3... 36 5.9 gi|91630515|gb|AC185128.1| Zea mays chromosome UNK clone CH201-1... 36 5.9 gi|91206507|gb|AC184855.1| Zea mays chromosome UNK clone CH201-2... 36 5.9 gi|90855895|gb|AC184144.1| Zea mays chromosome UNK clone CH201-1... 36 5.9 gi|88687865|gb|AC182832.1| Zea mays chromosome UNK clone CH201-1... 36 5.9 gi|88687860|gb|AC182827.1| Zea mays chromosome UNK clone CH201-1... 36 5.9 gi|85861424|gb|AC177914.1| Zea mays chromosome UNK clone CH201-1... 36 5.9 gi|58082453|gb|AC155594.2| Zea mays strain B73 clone ZMMBBc0213M... 36 5.9 gi|58082426|gb|AC155567.2| Zea mays strain B73 clone ZMMBBc0172N... 36 5.9 gi|58082342|gb|AC155482.2| Zea mays strain B73 clone ZMMBBc0009M... 36 5.9 gi|57862998|gb|AC155477.1| Zea mays strain B73 clone ZMMBBc0003D... 36 5.9 gi|58082326|gb|AC155465.2| Zea mays strain B73 clone ZMMBBb0518K... 36 5.9 gi|62123049|gb|AC150741.3| Zea mays chromosome 9L clone ZMMBBc01... 36 5.9 >gi|14717505|gb|BI245155.1|BI245155 949024A07.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 640 Score = 1126 bits (568), Expect = 0.0 Identities = 594/602 (98%), Gaps = 3/602 (0%) Strand = Plus / Plus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 42 gccaaagcattcaacatgtaggtga---ggccgccggctgaggaagctggattatatttc 98 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 99 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 158 Query: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 159 aaccagcttcaaagatgacgtttctccattcctgctcatctctctcaaggccgttgacga 218 Query: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 219 tcataaagaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 278 Query: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 279 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 338 Query: 423 tcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccact 482 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 339 tcttgcagttctttagtatcgtgacacactcagtgtcaccccagtcgtgcatgatccact 398 Query: 483 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 458 Query: 543 gcccagcgcaagcgggagcggttgcgaccacgtgtgcaaggtccagcacggtgcactgta 602 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 459 gcccagcgcaagcgggagcggttgcgaccacgtgtgcaaggtccagcacggtgcactgta 518 Query: 603 tggcagggaacgccgcagagatggcctgcgccgccgcgccatgcccgccgccaacgtcga 662 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 519 tggcagggaacgccgcagagatggcctgcgccgccgcgccatgcccgccgccaacgtcga 578 Query: 663 ccagggagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgtccatgagga 722 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 579 ccagggagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgtccatgagga 638 Query: 723 ag 724 || Sbjct: 639 ag 640 >gi|45847135|gb|CN071078.1|CN071078 1021007E06.x3 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 515 Score = 948 bits (478), Expect = 0.0 Identities = 508/516 (98%), Gaps = 4/516 (0%) Strand = Plus / Plus Query: 131 attcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttcaggggtat 190 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1 attcaacatgtaggtga---ggccgccggctgaggaagctggattatatttcaggggtat 57 Query: 191 agctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagct 250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 58 agctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagct 117 Query: 251 tcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacgatcataaaa 310 |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118 tcaaagatgacgttcctccattcctgctcatctctctcaaggccgttgacgatcataaag 177 Query: 311 aagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctgcaccaacc 370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 178 aagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctgcaccaacc 237 Query: 371 acggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcag 430 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 238 acggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcag 297 Query: 431 ttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaag 490 |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 298 ttctttagtatcgtgacacactcagtgtcaccccagtcgtgcatgatccacttgaggaag 357 Query: 491 acagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctgagcccagcg 550 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 358 acagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctgagcccagcg 417 Query: 551 caagcgggagcggttgcg-accacgtgtgcaaggtccagcacggtgcactgtatggcagg 609 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 418 caagcgggagcggttgcgaaccacgtgtgcaaggtccagcacggtgcactgtatggcagg 477 Query: 610 gaacgccgcagagatggcctgcgccgccgcgccatg 645 |||||||||||||||||||||||||||||||||||| Sbjct: 478 gaacgccgcagagatggcctgcgccgccgcgccatg 513 >gi|37374491|gb|CF623609.1|CF623609 zmrws05_0A10-010-b06.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 652 Score = 902 bits (455), Expect = 0.0 Identities = 478/485 (98%), Gaps = 3/485 (0%) Strand = Plus / Plus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 171 gccaaagcattcaacatgtaggtga---ggccgccggctgaggaagctggattatatttc 227 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 228 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 287 Query: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 aaccagcttcaaagatgacgttcctccattcctgctcatctctctcaaggccgttgacga 347 Query: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 348 tcataaagaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 407 Query: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 408 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 467 Query: 423 tcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccact 482 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 468 tcttgcagttctttagtatcgtgacacactcagtgtcaccccagtcgtgcatgatccact 527 Query: 483 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 528 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 587 Query: 543 gcccagcgcaagcgggagcggttgcgaccacgtgtgcaaggtccagcacggtgcactgta 602 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 588 gcccagcgcaagcgggagcggttgcgaccacgtgtgcaaggtccagcacggtgcactgta 647 Query: 603 tggca 607 ||||| Sbjct: 648 tggca 652 Score = 135 bits (68), Expect = 9e-30 Identities = 68/68 (100%) Strand = Plus / Plus Query: 2 aacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatacc 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 50 aacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatacc 109 Query: 62 aatttatt 69 |||||||| Sbjct: 110 aatttatt 117 >gi|78021886|gb|DV490273.1|DV490273 1000028-B07.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 662 Score = 852 bits (430), Expect = 0.0 Identities = 439/442 (99%) Strand = Plus / Plus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 210 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 269 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 270 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 329 Query: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 330 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 389 Query: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 390 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 449 Query: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 450 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 509 Query: 423 tcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccact 482 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 510 tcttgcagttctttagtatcgtgacacactcagtgtcaccccagtcgtgcatgatccact 569 Query: 483 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 570 tgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaacgaagctga 629 Query: 543 gcccagcgcaagcgggagcggt 564 |||| ||||||||||||||||| Sbjct: 630 gcccggcgcaagcgggagcggt 651 Score = 137 bits (69), Expect = 2e-30 Identities = 69/69 (100%) Strand = Plus / Plus Query: 1 aaacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 88 aaacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatac 147 Query: 61 caatttatt 69 ||||||||| Sbjct: 148 caatttatt 156 >gi|12968587|gb|BG265533.1|BG265533 1000028E12.x1 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 523 Score = 771 bits (389), Expect = 0.0 Identities = 398/401 (99%) Strand = Plus / Plus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 123 gccaaagcattcaacatttatttgatgaggccgccggctgaggaagctggattatatttc 182 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 Query: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 Query: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 Query: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 Query: 423 tcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccact 482 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 423 tcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatccact 482 Query: 483 tgaggaagacagcattcgctggcggaatggcctcaaacatg 523 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 483 tgaggaagacagcattcgctggcggaatggcctcaaacatg 523 Score = 137 bits (69), Expect = 2e-30 Identities = 69/69 (100%) Strand = Plus / Plus Query: 1 aaacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aaacacttgcatacatgcatacataaaccatccttttagtgagtatataactatatatac 60 Query: 61 caatttatt 69 ||||||||| Sbjct: 61 caatttatt 69 >gi|5714285|gb|AI944270.1|AI944270 614039H03.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 420 Score = 613 bits (309), Expect = e-173 Identities = 312/313 (99%) Strand = Plus / Plus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 108 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 167 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 168 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 227 Query: 243 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 228 aaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacga 287 Query: 303 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 tcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctg 347 Query: 363 caccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctt 422 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 348 caccaaccacggtatctactattatcaccttgccgcctgcatctcggggaggtatagctt 407 Query: 423 tcttgcagttctt 435 ||||||||||||| Sbjct: 408 tcttgcagttctt 420 Score = 107 bits (54), Expect = 2e-21 Identities = 54/54 (100%) Strand = Plus / Plus Query: 16 tgcatacataaaccatccttttagtgagtatataactatatataccaatttatt 69 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 tgcatacataaaccatccttttagtgagtatataactatatataccaatttatt 54 >gi|12968563|gb|BG265509.1|BG265509 1000028B07.x4 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 395 Score = 551 bits (278), Expect = e-155 Identities = 281/282 (99%) Strand = Plus / Plus Query: 124 ccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttca 183 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 114 ccaaagctttcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttca 173 Query: 184 ggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaa 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 174 ggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaa 233 Query: 244 accagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacgat 303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 accagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttgacgat 293 Query: 304 cataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctgc 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 294 cataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggccctgc 353 Query: 364 accaaccacggtatctactattatcaccttgccgcctgcatc 405 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 354 accaaccacggtatctactattatcaccttgccgcctgcatc 395 Score = 103 bits (52), Expect = 3e-20 Identities = 52/52 (100%) Strand = Plus / Plus Query: 18 catacataaaccatccttttagtgagtatataactatatataccaatttatt 69 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 8 catacataaaccatccttttagtgagtatataactatatataccaatttatt 59 >gi|32790665|gb|CD942901.1|CD942901 RCF_53 GeneTag1 Zea mays cDNA, mRNA sequence Length = 234 Score = 351 bits (177), Expect = 8e-95 Identities = 214/225 (95%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 123 gccaaagcattcaacatgtaggtgatgaggccgccggctgaggaagctggattatatttc 182 ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| Sbjct: 225 gccaaagcattcaacatgtaggtgatgagcccgccgcctgaggaagctggattatatttc 166 Query: 183 aggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactga 242 ||||||||||||||||||||||||||||||||||| |||||| |||| ||||||| |||| Sbjct: 165 aggggtatagctcgatgattgatcgaacacctaaacctggtaggattctgtagtccctga 106 Query: 243 aaccagcttcaaag-atgatgttcctccattcctgctcatctctctcaaggccgttgacg 301 | |||||||||||| |||||||||||||||||||||||||||||||||||||||||| || Sbjct: 105 agccagcttcaaagaatgatgttcctccattcctgctcatctctctcaaggccgttgccg 46 Query: 302 atcataaaaaagagatcagacatgacctgtgtctctttgttctta 346 | |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 45 accataaagaagagatcagacatgacctgtgtctctttgttctta 1 >gi|31558507|gb|CD527719.1|CD527719 3529_1_122_1_E07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 468 Score = 81.8 bits (41), Expect = 1e-13 Identities = 89/105 (84%) Strand = Plus / Minus Query: 620 gagatggcctgcgccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccc 679 |||||||||||||| |||||||| | || ||||| |||||||||||||||| ||||||| Sbjct: 403 gagatggcctgcgcggccgcgccgagacctccgccgacgtcgaccagggagcttatcccc 344 Query: 680 tgaaacacgtcgccgcactccctgacggcgatgtccatgaggaag 724 || || |||| |||||||| || |||||||||||||| |||| Sbjct: 343 tggaagacgtgcgcgcactccttgctggcgatgtccatgatgaag 299 >gi|14242952|gb|BG840182.2|BG840182 MEST8-C04.T3 ISUM3-TL Zea mays cDNA clone MEST8-C04 3', mRNA sequence Length = 462 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 233 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 292 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 293 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 352 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 353 ggtggaatgctctcaaacatgtcgccagcaa 383 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 43 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 102 >gi|14245101|gb|BG873683.1|BG873683 MEST8-C04.T7-1 ISUM3-TL Zea mays cDNA clone MEST8-C04 5', mRNA sequence Length = 674 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 471 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 412 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 411 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 352 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 351 ggtggaatgctctcaaacatgtcgccagcaa 321 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 222 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 163 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 162 ccgcactccttgacgacgatgtccatgacgaag 130 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 661 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 602 >gi|16918384|gb|BM073722.1|BM073722 MEST73-A08.T3 ISUM4-TN Zea mays cDNA clone MEST73-A08 3', mRNA sequence Length = 603 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 372 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 431 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 432 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 491 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 492 ggtggaatgctctcaaacatgtcgccagcaa 522 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 182 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 241 >gi|18178788|gb|BM379998.1|BM379998 MEST513-F04.univ ISUM6 Zea mays cDNA clone MEST513-F04 3', mRNA sequence Length = 555 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 358 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 417 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 418 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 477 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 478 ggtggaatgctctcaaacatgtcgccagcaa 508 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 168 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 227 >gi|31911242|gb|CD651826.1|CD651826 3529_1_140_1_E06.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 636 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 281 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 340 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 341 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 400 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 401 ggtggaatgctctcaaacatgtcgccagcaa 431 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 530 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 589 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 590 ccgcactccttgacgacgatgtccatgacgaag 622 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 91 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 150 >gi|71318982|gb|DR796240.1|DR796240 ZM_BFb0017M08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 685 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 298 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 357 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 358 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 417 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 418 ggtggaatgctctcaaacatgtcgccagcaa 448 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 547 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 606 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 607 ccgcactccttgacgacgatgtccatgacgaag 639 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 108 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 167 >gi|71319840|gb|DR796671.1|DR796671 ZM_BFb0018G21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 624 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 353 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 412 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 413 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 472 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 473 ggtggaatgctctcaaacatgtcgccagcaa 503 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 163 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 222 >gi|71446177|gb|DR827227.1|DR827227 ZM_BFb0070F19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 709 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 340 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 399 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 400 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 459 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 460 ggtggaatgctctcaaacatgtcgccagcaa 490 Score = 75.8 bits (38), Expect = 7e-12 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 589 gccgccgcgccaagccctccggcgacgtcgacnagggagcttagaccccggaagacgtcg 648 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 649 ccgcactccttgacgacgatgtccatgacgaag 681 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 150 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 209 >gi|71767292|gb|DR965229.1|DR965229 ZM_BFb0085B05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 741 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 353 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 412 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 413 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 472 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 473 ggtggaatgctctcaaacatgtcgccagcaa 503 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 602 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 661 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 662 ccgcactccttgacgacgatgtccatgacgaag 694 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 163 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 222 >gi|71772534|gb|DR970465.1|DR970465 ZM_BFb0092L10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 815 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 372 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 431 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 432 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 491 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 492 ggtggaatgctctcaaacatgtcgccagcaa 522 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 621 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 680 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 681 ccgcactccttgacgacgatgtccatgacgaag 713 Score = 71.9 bits (36), Expect = 1e-10 Identities = 54/60 (90%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||||||| ||||||||| ||||||| || || |||||||| Sbjct: 182 ctcgatgatggatcgaacacctaaaacgggtatgattttgtagtcgctaaatccagcttc 241 >gi|76282495|gb|DV022063.1|DV022063 ZM_BFb0141B06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 744 Score = 77.8 bits (39), Expect = 2e-12 Identities = 72/83 (86%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| ||| Sbjct: 429 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgc 488 Query: 473 atgatccacttgaggaagacagc 495 || |||||||||||||||||||| Sbjct: 489 ataatccacttgaggaagacagc 511 Score = 63.9 bits (32), Expect = 3e-08 Identities = 68/80 (85%) Strand = Plus / Plus Query: 645 gcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctga 704 |||||||| | |||||||| ||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 661 gcccgccggcgacgtcgacgagggagctgatcccctcaaagacgccgccgcactccctga 720 Query: 705 cggcgatgtccatgaggaag 724 | ||| |||||||| |||| Sbjct: 721 ccacgacgtccatgatgaag 740 Score = 46.1 bits (23), Expect = 0.006 Identities = 35/39 (89%) Strand = Plus / Plus Query: 358 ccctgcaccaaccacggtatctactattatcaccttgcc 396 |||||| ||||||||| |||| | ||||||||||||||| Sbjct: 380 ccctgctccaaccacgatatccagtattatcaccttgcc 418 >gi|78078800|gb|DV507212.1|DV507212 ZM_BFb0185E12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 789 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 298 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 357 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 358 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 417 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 418 ggtggaatgctctcaaacatgtcgccagcaa 448 Score = 65.9 bits (33), Expect = 7e-09 Identities = 78/93 (83%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || ||||| Sbjct: 547 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcc 606 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 607 ccgcactccttgacgacgatgtccatgacgaag 639 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 108 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 167 >gi|78078878|gb|DV507290.1|DV507290 ZM_BFb0185G08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 715 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 298 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 357 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 358 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 417 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 418 ggtggaatgctctcaaacatgtcgccagcaa 448 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 547 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 606 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 607 ccgcactccttgacgacgatgtccatgacgaag 639 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 108 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 167 >gi|78081460|gb|DV509872.1|DV509872 ZM_BFb0189D16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 581 Score = 77.8 bits (39), Expect = 2e-12 Identities = 72/83 (86%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| ||| Sbjct: 429 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgc 488 Query: 473 atgatccacttgaggaagacagc 495 || |||||||||||||||||||| Sbjct: 489 ataatccacttgaggaagacagc 511 Score = 46.1 bits (23), Expect = 0.006 Identities = 35/39 (89%) Strand = Plus / Plus Query: 358 ccctgcaccaaccacggtatctactattatcaccttgcc 396 |||||| ||||||||| |||| | ||||||||||||||| Sbjct: 380 ccctgctccaaccacgatatccagtattatcaccttgcc 418 >gi|83278940|gb|DV942948.1|DV942948 1000137-H06.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 759 Score = 77.8 bits (39), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 327 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 386 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 387 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 446 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 447 ggtggaatgctctcaaacatgtcgccagcaa 477 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 576 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 635 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 636 ccgcactccttgacgacgatgtccatgacgaag 668 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 137 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 196 >gi|71318984|gb|DR796241.1|DR796241 ZM_BFb0017M08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 849 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 618 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 559 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 558 ccgcactccttgacgacgatgtccatgacgaag 526 Score = 60.0 bits (30), Expect = 4e-07 Identities = 99/122 (81%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| ||| ||| |||| || |||||||| || Sbjct: 838 aggtatagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatg 779 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| || ||||| || | || || |||||| |||||||||||||||||| Sbjct: 778 caaaacccacttaagaaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 719 Query: 532 aa 533 || Sbjct: 718 aa 717 >gi|71319842|gb|DR796672.1|DR796672 ZM_BFb0018G21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 762 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 639 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 580 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 579 ccgcactccttgacgacgatgtccatgacgaag 547 >gi|71430405|gb|DR811455.1|DR811455 ZM_BFb0039K17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 769 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 639 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 580 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 579 ccgcactccttgacgacgatgtccatgacgaag 547 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 757 ctcaaacatgtcgccagcaa 738 >gi|71437245|gb|DR818295.1|DR818295 ZM_BFb0053A19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 866 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 637 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 578 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 577 ccgcactccttgacgacgatgtccatgacgaag 545 Score = 67.9 bits (34), Expect = 2e-09 Identities = 100/122 (81%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| ||| ||| |||| || |||||||| || Sbjct: 857 aggtatagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatg 798 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| |||||||| || | || || |||||| |||||||||||||||||| Sbjct: 797 caaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 738 Query: 532 aa 533 || Sbjct: 737 aa 736 >gi|71439848|gb|DR820898.1|DR820898 ZM_BFb0059O06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 868 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 636 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 577 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 576 ccgcactccttgacgacgatgtccatgacgaag 544 Score = 67.9 bits (34), Expect = 2e-09 Identities = 100/122 (81%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| ||| ||| |||| || |||||||| || Sbjct: 856 aggtatagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatg 797 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| |||||||| || | || || |||||| |||||||||||||||||| Sbjct: 796 caaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 737 Query: 532 aa 533 || Sbjct: 736 aa 735 >gi|71446178|gb|DR827228.1|DR827228 ZM_BFb0070F19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 870 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 639 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 580 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 579 ccgcactccttgacgacgatgtccatgacgaag 547 Score = 67.9 bits (34), Expect = 2e-09 Identities = 100/122 (81%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| ||| ||| |||| || |||||||| || Sbjct: 859 aggtatagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatg 800 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| |||||||| || | || || |||||| |||||||||||||||||| Sbjct: 799 caaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 740 Query: 532 aa 533 || Sbjct: 739 aa 738 >gi|71447528|gb|DR828578.1|DR828578 ZM_BFb0073J05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 848 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 636 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 577 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 576 ccgcactccttgacgacgatgtccatgacgaag 544 Score = 52.0 bits (26), Expect = 1e-04 Identities = 92/114 (80%) Strand = Plus / Minus Query: 420 ctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatcc 479 ||||||| |||||||| || ||| ||| ||| |||| || |||||||| |||| | || Sbjct: 848 ctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaaccc 789 Query: 480 acttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagcaa 533 |||| |||||||| || | || || |||||| |||||||||||||||||||| Sbjct: 788 acttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagcaa 735 >gi|71767293|gb|DR965230.1|DR965230 ZM_BFb0085B05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 796 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 627 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 568 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 567 ccgcactccttgacgacgatgtccatgacgaag 535 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 745 ctcaaacatgtcgccagcaa 726 >gi|71772535|gb|DR970466.1|DR970466 ZM_BFb0092L10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 825 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 630 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 571 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 570 ccgcactccttgacgacgatgtccatgacgaag 538 Score = 42.1 bits (21), Expect = 0.096 Identities = 60/73 (82%) Strand = Plus / Minus Query: 461 ccccagtcgtgcatgatccacttgaggaagacagcattcgctggcggaatggcctcaaac 520 |||||||| |||| | |||||| |||||||| || | || || |||||| ||||||| Sbjct: 801 ccccagtcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaac 742 Query: 521 atgtcgccagcaa 533 ||||||||||||| Sbjct: 741 atgtcgccagcaa 729 >gi|76288542|gb|DV028110.1|DV028110 ZM_BFb0149P04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 750 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 637 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 578 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 577 ccgcactccttgacgacgatgtccatgacgaag 545 >gi|78078801|gb|DV507213.1|DV507213 ZM_BFb0185E12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 894 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 618 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 559 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 558 ccgcactccttgacgacgatgtccatgacgaag 526 Score = 67.9 bits (34), Expect = 2e-09 Identities = 100/122 (81%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| ||| ||| |||| || |||||||| || Sbjct: 838 aggtatagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatg 779 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| |||||||| || | || || |||||| |||||||||||||||||| Sbjct: 778 caaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 719 Query: 532 aa 533 || Sbjct: 718 aa 717 >gi|78078879|gb|DV507291.1|DV507291 ZM_BFb0185G08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 848 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 618 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 559 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 558 ccgcactccttgacgacgatgtccatgacgaag 526 Score = 54.0 bits (27), Expect = 3e-05 Identities = 98/122 (80%) Strand = Plus / Minus Query: 412 aggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtg 471 ||||||||||||||| |||||||| || ||| | ||| |||| || |||||||| || Sbjct: 838 aggtatagctttcttacagttcttgagtatctgnatacaatcagcatcgccccagtcatg 779 Query: 472 catgatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgccagc 531 || | |||||| |||||||| || | || || |||||| |||||||||||||||||| Sbjct: 778 caaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagc 719 Query: 532 aa 533 || Sbjct: 718 aa 717 >gi|91875289|gb|EB405246.1|EB405246 ZM_BFb0315B22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 794 Score = 73.8 bits (37), Expect = 3e-11 Identities = 79/93 (84%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 634 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 575 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 574 ccgcactccttgacgacgatgtccatgacgaag 542 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 753 ctcaaacatgtcgccagcaa 734 >gi|71760483|gb|DR958420.1|DR958420 ZM_BFb0059O06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 690 Score = 71.9 bits (36), Expect = 1e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| || ||| | || |||||| Sbjct: 591 gccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcg 650 Query: 692 ccgcactccctgacggcgatgtccatga 719 ||||||||| ||||| |||||||||||| Sbjct: 651 ccgcactccttgacgacgatgtccatga 678 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||| ||||||||||| |||||||| || ||| Sbjct: 342 attatcacctttcctcctgcatccctggaagggatagctttcttacagttcttgagtatc 401 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 402 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 461 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 462 ggtggaatgctctcaaacatgtcgccagcaa 492 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 152 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 211 >gi|89251139|gb|DY622925.1|DY622925 ZM_BFb0293A02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 683 Score = 71.9 bits (36), Expect = 1e-10 Identities = 78/92 (84%) Strand = Plus / Minus Query: 633 ccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgc 692 ||||||||||| |||| ||| | |||||||| ||||||| || ||| | || ||||||| Sbjct: 635 ccgccgcgccaagccctccggcgacgtcgacaagggagcttagaccccggaagacgtcgc 576 Query: 693 cgcactccctgacggcgatgtccatgaggaag 724 |||||||| ||||| |||||||||||| |||| Sbjct: 575 cgcactccttgacgacgatgtccatgacgaag 544 >gi|14997326|gb|BI319303.1|BI319303 949035C01.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 625 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 286 attatcacctttcctcctgcatccctagaaggtatagctttcttacagttcttaagtatc 345 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 346 ttgatgcaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 405 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 406 ggtggaatgctctcaaacatgtcgccagcaa 436 Score = 63.9 bits (32), Expect = 3e-08 Identities = 74/88 (84%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| | ||| | || |||||| Sbjct: 535 gccgccgcgccaagccctccggcgacgtcgacaagggagctcaaaccccggaagacgtcg 594 Query: 692 ccgcactccctgacggcgatgtccatga 719 ||||||||| ||||| |||||||||||| Sbjct: 595 ccgcactccttgacgacgatgtccatga 622 Score = 58.0 bits (29), Expect = 2e-06 Identities = 50/57 (87%) Strand = Plus / Plus Query: 197 atgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttca 253 ||||| ||||||||||||| ||| ||||||||| ||||||| || || ||||||||| Sbjct: 100 atgatggatcgaacacctagaacaggtatgattttgtagtcgctaaacccagcttca 156 >gi|15426915|gb|BI542737.1|BI542737 949072A08.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 483 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 209 attatcacctttcctcctgcatccctagaaggtatagctttcttacagttcttaagtatc 268 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 269 ttgatgcaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 328 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 329 ggtggaatgctctcaaacatgtcgccagcaa 359 Score = 58.0 bits (29), Expect = 2e-06 Identities = 50/57 (87%) Strand = Plus / Plus Query: 197 atgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttca 253 ||||| ||||||||||||| ||| ||||||||| ||||||| || || ||||||||| Sbjct: 23 atgatggatcgaacacctagaacaggtatgattttgtagtcgctaaacccagcttca 79 >gi|76282932|gb|DV022500.1|DV022500 ZM_BFb0141L01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 479 Score = 69.9 bits (35), Expect = 4e-10 Identities = 53/59 (89%) Strand = Plus / Plus Query: 197 atgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttcaaa 255 ||||| ||||||||||||||||| ||||||||| ||||||| || || ||||||||||| Sbjct: 143 atgatggatcgaacacctaaaacaggtatgattttgtagtccctaaacccagcttcaaa 201 Score = 54.0 bits (27), Expect = 3e-05 Identities = 120/151 (79%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | ||||||||||||||| |||||||| || ||| Sbjct: 329 attatcacctttcctcctgcatccctaaaaggtatagctttcttacagttcttaagtatc 388 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| ||||| || || | || Sbjct: 389 ttgatgcaatcagcatcgccccagtcatgcaaaacccacttaaggaaaacggcgtctgcc 448 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 449 ggtggaatgctctcaaacatgtcgccagcaa 479 >gi|76282933|gb|DV022501.1|DV022501 ZM_BFb0141L01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 479 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 151 attatcacctttcctcctgcatccctagaaggtatagctttcttacagttcttaagtatc 92 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 91 ttgatgcaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 32 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 31 ggtggaatgctctcaaacatgtcgccagcaa 1 Score = 58.0 bits (29), Expect = 2e-06 Identities = 50/57 (87%) Strand = Plus / Minus Query: 197 atgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttca 253 ||||| ||||||||||||| ||| ||||||||| ||||||| || || ||||||||| Sbjct: 337 atgatggatcgaacacctagaacaggtatgattttgtagtcgctaaacccagcttca 281 >gi|21216141|gb|AY111551.1| Zea mays CL10273_1 mRNA sequence Length = 505 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 328 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 387 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 388 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 447 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| ||||||||||| |||||||| Sbjct: 448 ggtggaatgctctcaaacatgtggccagcaa 478 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 138 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 197 >gi|21216141|gb|AY111551.1| Zea mays CL10273_1 mRNA sequence Length = 505 Score = 69.9 bits (35), Expect = 4e-10 Identities = 122/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 328 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 387 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 388 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 447 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| ||||||||||| |||||||| Sbjct: 448 ggtggaatgctctcaaacatgtggccagcaa 478 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 138 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 197 >gi|56461989|gb|CK986287.1|CK986287 WSEST0055 water stress specific subtracted cDNA library of maize seedlings Zea mays cDNA clone E7, mRNA sequence Length = 501 Score = 67.9 bits (34), Expect = 2e-09 Identities = 73/86 (84%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||||||| |||| |||||| ||||| | ||| Sbjct: 292 attattacctttccacctgcatcccgtggaggtatggcttgcttgcaattcttcaatatc 351 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 352 ttgacacactcatcgtcaccccagtc 377 >gi|15427187|gb|BI543009.1|BI543009 949072A08.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 618 Score = 65.9 bits (33), Expect = 7e-09 Identities = 78/93 (83%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| | ||| | || |||||| Sbjct: 602 gccgccgcgccaagccctccggcgacgtcgacaagggagctcagaccccggaagacgtcg 543 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 542 ccgcactccttgacgacgatgtccatgacgaag 510 >gi|31998550|gb|CD662129.1|CD662129 3529_1_140_1_E06.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 581 Score = 65.9 bits (33), Expect = 7e-09 Identities = 78/93 (83%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| |||||| || ||| | || |||||| Sbjct: 563 gccgccgcgccaagccctccggcgacgtcgacaagggagtttagaccccggaagacgtcg 504 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 503 ccgcactccttgacgacgatgtccatgacgaag 471 >gi|78105223|gb|DV523641.1|DV523641 ZM_BFb0209P04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 821 Score = 65.9 bits (33), Expect = 7e-09 Identities = 78/93 (83%) Strand = Plus / Minus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| ||||||| | ||| | || |||||| Sbjct: 639 gccgccgcgccaagccctccggcgacgtcgacaagggagctcagaccccggaagacgtcg 580 Query: 692 ccgcactccctgacggcgatgtccatgaggaag 724 ||||||||| ||||| |||||||||||| |||| Sbjct: 579 ccgcactccttgacgacgatgtccatgacgaag 547 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 757 ctcaaacatgtcgccagcaa 738 >gi|4572814|gb|AI586463.1|AI586463 486051D10.x2 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 411 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 101 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 160 Score = 60.0 bits (30), Expect = 4e-07 Identities = 90/110 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||||||||||||||| |||||||| || ||| Sbjct: 291 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 350 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagac 492 ||| ||| |||| || |||||||| |||| | |||||| |||||||| Sbjct: 351 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagac 400 >gi|4680851|gb|AI629521.1|AI629521 486102B03.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 321 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 175 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 234 >gi|14243855|gb|BG841509.2|BG841509 MEST22-D12.T3 ISUM4-TN Zea mays cDNA clone MEST22-D12 3', mRNA sequence Length = 335 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 83 ctcgatgatggatcgaacacctataacgggtatgattttgtagtcgctaaatccagcttc 142 >gi|32941167|gb|CF045986.1|CF045986 QCK1e12.yg QCK Zea mays cDNA clone QCK1e12, mRNA sequence Length = 413 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| ||||||||||||| ||| ||||||||| ||||||| || || |||||||| Sbjct: 150 ctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatccagcttc 209 Score = 42.1 bits (21), Expect = 0.096 Identities = 45/53 (84%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 ||||| ||||| || |||||||| | | ||||||||||||||| |||||||| Sbjct: 340 attatgacctttcctcctgcatccctggaaggtatagctttcttacagttctt 392 >gi|71762216|gb|DR960153.1|DR960153 ZM_BFb0073J05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 599 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 ||||||||| |||| |||||||||||| ||||||||| ||||||| || || |||||||| Sbjct: 139 ctcgatgatggatcaaacacctaaaacgggtatgattttgtagtcgctaaatccagcttc 198 Score = 61.9 bits (31), Expect = 1e-07 Identities = 121/151 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||| ||||||||||| |||||||| || ||| Sbjct: 329 attatcacctttcctcctgcatccctggaaggaatagctttcttacagttcttgagtatc 388 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||||||| |||| | |||||| ||||| || || | || Sbjct: 389 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaaaacggcgtctgcc 448 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 449 gggggaatgctctcaaacatgtcgccagcaa 479 >gi|76012180|gb|DT939350.1|DT939350 ZM_BFb0121G21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 852 Score = 63.9 bits (32), Expect = 3e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 645 gcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctga 704 |||||||| | |||||||| ||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 643 gcccgccggcgacgtcgacgagggagctgatcccctcaaagacgccgccgcactccctga 584 Query: 705 cggcgatgtccatgaggaag 724 | ||| |||||||| |||| Sbjct: 583 ccacgacgtccatgatgaag 564 Score = 60.0 bits (30), Expect = 4e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 458 tcaccccagtcgtgcatgatccacttgaggaagacagc 495 ||||||||||| ||||| |||||||||||||||||||| Sbjct: 831 tcaccccagtcatgcataatccacttgaggaagacagc 794 >gi|76282496|gb|DV022064.1|DV022064 ZM_BFb0141B06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 804 Score = 63.9 bits (32), Expect = 3e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 645 gcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctga 704 |||||||| | |||||||| ||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 646 gcccgccggcgacgtcgacgagggagctgatcccctcaaagacgccgccgcactccctga 587 Query: 705 cggcgatgtccatgaggaag 724 | ||| |||||||| |||| Sbjct: 586 ccacgacgtccatgatgaag 567 >gi|78081461|gb|DV509873.1|DV509873 ZM_BFb0189D16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 799 Score = 63.9 bits (32), Expect = 3e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 645 gcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctga 704 |||||||| | |||||||| ||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 641 gcccgccggcgacgtcgacgagggagctgatcccctcaaagacgccgccgcactccctga 582 Query: 705 cggcgatgtccatgaggaag 724 | ||| |||||||| |||| Sbjct: 581 ccacgacgtccatgatgaag 562 >gi|93012136|gb|EB637656.1|EB637656 ZM_BFb0323L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 844 Score = 63.9 bits (32), Expect = 3e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 646 cccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctgac 705 ||||||||| |||||||| ||||||| |||||||| || ||| |||||||||||||||| Sbjct: 685 cccgccgccgacgtcgacgagggagctgatcccctggaagacggcgccgcactccctgac 626 >gi|4647079|gb|AI622154.1|AI622154 486036C10.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 665 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 482 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 541 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 542 ataatcgacttgaggaagacagc 564 >gi|6095546|gb|AW120213.1|AW120213 614086G02.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 576 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Minus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 128 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 69 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 68 ataatcgacttgaggaagacagc 46 >gi|13126566|gb|BG317136.1|BG317136 947025G05.x2 947 - 2 week shoot from Barkan lab Zea mays cDNA, mRNA sequence Length = 607 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 298 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 357 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 358 ataatcgacttgaggaagacagc 380 >gi|16377744|gb|BI992097.1|BI992097 1020056E02.x1 1020 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 411 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 253 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 312 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 313 ataatcgacttgaggaagacagc 335 >gi|16917259|gb|BM073205.1|BM073205 MEST62-E09.T3 ISUM4-TN Zea mays cDNA clone MEST62-E09 3', mRNA sequence Length = 561 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 463 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 522 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 523 ataatcgacttgaggaagacagc 545 >gi|37400925|gb|CF637823.1|CF637823 zmrww00_0B20-010-c10.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 696 Score = 61.9 bits (31), Expect = 1e-07 Identities = 64/75 (85%) Strand = Plus / Plus Query: 650 ccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctgacggcg 709 ||||| |||||||||||||||| ||||||||| || |||| |||||||| || |||| Sbjct: 19 ccgccgacgtcgaccagggagcttatcccctggaagacgtgcgcgcactccttgctggcg 78 Query: 710 atgtccatgaggaag 724 |||||||||| |||| Sbjct: 79 atgtccatgatgaag 93 >gi|60339001|gb|DN205974.1|DN205974 MEST826_C08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 561 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 340 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 399 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 400 ataatcgacttgaggaagacagc 422 >gi|60344173|gb|DN211146.1|DN211146 MEST920_A10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 702 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 467 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 526 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 527 ataatcgacttgaggaagacagc 549 >gi|60353806|gb|DN220779.1|DN220779 MEST1101_C11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 649 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 448 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 507 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 508 ataatcgacttgaggaagacagc 530 >gi|60354176|gb|DN221149.1|DN221149 MEST1108_G03.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 681 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 496 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 555 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 556 ataatcgacttgaggaagacagc 578 >gi|60395541|gb|DN228411.1|DN228411 MEST1219_D04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 668 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 267 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 326 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 327 ataatcgacttgaggaagacagc 349 >gi|60398612|gb|DN231428.1|DN231428 MEST1139_A06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 687 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 338 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 397 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 398 ataatcgacttgaggaagacagc 420 >gi|60400518|gb|DN233325.1|DN233325 MEST863_C05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 601 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Minus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 280 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 221 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 220 ataatcgacttgaggaagacagc 198 >gi|60400863|gb|DN233670.1|DN233670 MEST1093_G10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 637 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Minus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 492 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 433 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 432 ataatcgacttgaggaagacagc 410 >gi|76011246|gb|DT938416.1|DT938416 ZM_BFb0118L07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 808 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 441 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 500 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 501 ataatcgacttgaggaagacagc 523 >gi|86473110|gb|DY239480.1|DY239480 ZM_BFb0258B14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 484 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 388 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 447 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 448 ataatcgacttgaggaagacagc 470 >gi|21211011|gb|AY107933.1| Zea mays PCO142167 mRNA sequence Length = 710 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Minus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 354 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 295 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 294 ataatcgacttgaggaagacagc 272 >gi|21211011|gb|AY107933.1| Zea mays PCO142167 mRNA sequence Length = 710 Score = 61.9 bits (31), Expect = 1e-07 Identities = 70/83 (84%) Strand = Plus / Minus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgc 472 ||||| || |||||||||||||| || ||| ||||||| || | ||||||||||| || Sbjct: 354 ggtatggccttcttgcagttcttcagtatcttgacacagtcggcatcaccccagtcatgt 295 Query: 473 atgatccacttgaggaagacagc 495 || ||| |||||||||||||||| Sbjct: 294 ataatcgacttgaggaagacagc 272 >gi|5740343|gb|AI948033.1|AI948033 603033C08.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 542 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 299 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 358 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 359 ttgacacactcatcgtcaccccagtc 384 >gi|13150795|gb|BG321117.1|BG321117 Zm04_01g01_A Zm04_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm04_01g01, mRNA sequence Length = 700 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 309 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 368 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 369 ttgacacactcatcgtcaccccagtc 394 >gi|14244242|gb|BG842234.2|BG842234 MEST28-E02.T3 ISUM4-TN Zea mays cDNA clone MEST28-E02 3', mRNA sequence Length = 636 Score = 60.0 bits (30), Expect = 4e-07 Identities = 93/114 (81%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 434 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 493 Query: 475 gatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgcc 528 |||||||||||||||||| | || || | ||||||| ||| ||||||||||| Sbjct: 494 aatccacttgaggaagacaacgtttgccgacggaatgctctcgaacatgtcgcc 547 >gi|14245171|gb|BG873753.1|BG873753 MEST42-B10.T3 ISUM4-TN Zea mays cDNA clone MEST42-B10 3', mRNA sequence Length = 635 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 477 ttgacacactcatcgtcaccccagtc 502 >gi|16918162|gb|BM073609.1|BM073609 MEST71-A11.T3 ISUM4-TN Zea mays cDNA clone MEST71-A11 3', mRNA sequence Length = 704 Score = 60.0 bits (30), Expect = 4e-07 Identities = 93/114 (81%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 487 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 546 Query: 475 gatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgcc 528 |||||||||||||||||| | || || | ||||||| ||| ||||||||||| Sbjct: 547 aatccacttgaggaagacaacgtttgccgacggaatgctctcgaacatgtcgcc 600 >gi|16918220|gb|BM073637.1|BM073637 MEST71-E06.T3 ISUM4-TN Zea mays cDNA clone MEST71-E06 3', mRNA sequence Length = 693 Score = 60.0 bits (30), Expect = 4e-07 Identities = 93/114 (81%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 486 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 545 Query: 475 gatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgcc 528 |||||||||||||||||| | || || | ||||||| ||| ||||||||||| Sbjct: 546 aatccacttgaggaagacaacgtttgccgacggaatgctctcgaacatgtcgcc 599 >gi|16925799|gb|BM078867.1|BM078867 MEST125-C10.T3 ISUM4-TN Zea mays cDNA clone MEST125-C10 3', mRNA sequence Length = 580 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 361 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 420 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 421 ttgacacactcatcgtcaccccagtc 446 >gi|16927009|gb|BM080072.1|BM080072 MEST103-G05.T3 ISUM4-TN Zea mays cDNA clone MEST103-G05 3', mRNA sequence Length = 592 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 360 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 419 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 420 ttgacacactcatcgtcaccccagtc 445 >gi|16927215|gb|BM080284.1|BM080284 MEST106-E03.T3 ISUM4-TN Zea mays cDNA clone MEST106-E03 3', mRNA sequence Length = 589 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 359 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 418 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 419 ttgacacactcatcgtcaccccagtc 444 >gi|16927323|gb|BM080392.1|BM080392 MEST107-H02.T3 ISUM4-TN Zea mays cDNA clone MEST107-H02 3', mRNA sequence Length = 592 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 360 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 419 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 420 ttgacacactcatcgtcaccccagtc 445 >gi|16927615|gb|BM080684.1|BM080684 MEST112-A04.T3 ISUM4-TN Zea mays cDNA clone MEST112-A04 3', mRNA sequence Length = 593 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 361 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 420 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 421 ttgacacactcatcgtcaccccagtc 446 >gi|18177931|gb|BM379141.1|BM379141 MEST500-C03.univ ISUM6 Zea mays cDNA clone MEST500-C03 3', mRNA sequence Length = 560 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 362 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 421 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 422 ttgacacactcatcgtcaccccagtc 447 >gi|18178067|gb|BM379277.1|BM379277 MEST503-C08.univ ISUM6 Zea mays cDNA clone MEST503-C08 3', mRNA sequence Length = 586 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 368 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 427 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 428 ttgacacactcatcgtcaccccagtc 453 >gi|18178196|gb|BM379406.1|BM379406 MEST505-B07.univ ISUM6 Zea mays cDNA clone MEST505-B07 3', mRNA sequence Length = 660 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 458 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 517 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 518 ttgacacactcatcgtcaccccagtc 543 >gi|18178753|gb|BM379963.1|BM379963 MEST513-B03.univ ISUM6 Zea mays cDNA clone MEST513-B03 3', mRNA sequence Length = 585 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 367 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 426 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 427 ttgacacactcatcgtcaccccagtc 452 >gi|18178985|gb|BM380195.1|BM380195 MEST516-D09.univ ISUM6 Zea mays cDNA clone MEST516-D09 3', mRNA sequence Length = 566 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 358 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 417 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 418 ttgacacactcatcgtcaccccagtc 443 >gi|24934203|gb|CA452421.1|CA452421 Rxo#1_E03 subtracted cDNA library of maize inbred line B73 infected with Xanthomonas oryzae pv. oryzicola strain BLS222 Zea mays cDNA clone Rxo#1_E03, mRNA sequence Length = 532 Score = 60.0 bits (30), Expect = 4e-07 Identities = 93/114 (81%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 411 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 470 Query: 475 gatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcgcc 528 |||||||||||||||||| | || || | ||||||| ||| ||||||||||| Sbjct: 471 aatccacttgaggaagacaacgtttgccgacggaatgctctcgaacatgtcgcc 524 >gi|28983046|gb|BQ538472.2|BQ538472 MEST601-B03.T3 ISUM4-TN Zea mays cDNA clone MEST601-B03 3', mRNA sequence Length = 466 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 277 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 336 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 337 ttgacacactcatcgtcaccccagtc 362 >gi|32919168|gb|CF023980.1|CF023980 QBS12g05.xg QBS Zea mays cDNA clone QBS12g05, mRNA sequence Length = 610 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 418 attattaccttccctcctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 359 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 358 ttgacacactcatcgtcaccccagtc 333 >gi|32919309|gb|CF024121.1|CF024121 QBS1b01.xg QBS Zea mays cDNA clone QBS1b01, mRNA sequence Length = 497 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 153 attattaccttccctcctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 94 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 93 ttgacacactcatcgtcaccccagtc 68 >gi|37376716|gb|CF624913.1|CF624913 zmrws05_0A20-010-g05.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 572 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 343 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 402 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 403 ttgacacactcatcgtcaccccagtc 428 >gi|37382886|gb|CF628414.1|CF628414 zmrws48_0A10-005-f02.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 473 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 368 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 427 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 428 ttgacacactcatcgtcaccccagtc 453 >gi|60351836|gb|DN218809.1|DN218809 MEST1072_E05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 579 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 330 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 389 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 390 ttgacacactcatcgtcaccccagtc 415 >gi|60357413|gb|DN224386.1|DN224386 MEST1157_H12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 748 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 393 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 452 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 453 ttgacacactcatcgtcaccccagtc 478 >gi|71762182|gb|DR960119.1|DR960119 ZM_BFb0073H11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 722 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 328 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 387 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 388 ttgacacactcatcgtcaccccagtc 413 >gi|78074469|gb|DV502903.1|DV502903 ZM_BFb0174O20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 692 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 343 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 402 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 403 ttgacacactcatcgtcaccccagtc 428 >gi|78080832|gb|DV509244.1|DV509244 ZM_BFb0188D19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 710 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 343 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 402 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 403 ttgacacactcatcgtcaccccagtc 428 >gi|78104756|gb|DV523174.1|DV523174 ZM_BFb0209E14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 771 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 373 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 432 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 433 ttgacacactcatcgtcaccccagtc 458 >gi|89760256|gb|DY688746.1|DY688746 ZM_BFb0284B18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 694 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 328 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 387 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 388 ttgacacactcatcgtcaccccagtc 413 >gi|21208169|gb|AY105091.1| Zea mays PCO138435 mRNA sequence Length = 1381 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 1022 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 963 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 962 ttgacacactcatcgtcaccccagtc 937 >gi|21208169|gb|AY105091.1| Zea mays PCO138435 mRNA sequence Length = 1381 Score = 60.0 bits (30), Expect = 4e-07 Identities = 72/86 (83%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 1022 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 963 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 962 ttgacacactcatcgtcaccccagtc 937 >gi|16919927|gb|BM074424.1|BM074424 MEST86-B06.T3 ISUM4-TN Zea mays cDNA clone MEST86-B06 3', mRNA sequence Length = 595 Score = 56.0 bits (28), Expect = 6e-06 Identities = 91/112 (81%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 473 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 532 Query: 475 gatccacttgaggaagacagcattcgctggcggaatggcctcaaacatgtcg 526 |||||||||||||||||| | || || | ||||||| ||| ||||||||| Sbjct: 533 aatccacttgaggaagacaacgtttgccgacggaatgctctcgaacatgtcg 584 >gi|22490218|gb|BU050141.1|BU050141 1111020D01.y1 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 552 Score = 56.0 bits (28), Expect = 6e-06 Identities = 85/104 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || || || ||||||| ||||| |||| |||||||||||| || ||| Sbjct: 404 attatcaccttccctcccgccgctcgtgggggtatggcttgcttgcagttcttcagtatc 463 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgag 486 |||||||||| ||| | ||||||||| | ||||||||||| Sbjct: 464 ctgacacactcgtcgtcgctccagtcgtgaagaatccacttgag 507 >gi|87153310|gb|DY398099.1|DY398099 III-952-5C-D01.M13-R UGIII-Reseq Zea mays cDNA, mRNA sequence Length = 603 Score = 56.0 bits (28), Expect = 6e-06 Identities = 85/104 (81%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || || || ||||||| ||||| |||| |||||||||||| || ||| Sbjct: 406 attatcaccttccctcccgccgctcgtgggggtatggcttgcttgcagttcttcagtatc 465 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgag 486 |||||||||| ||| | ||||||||| | ||||||||||| Sbjct: 466 ctgacacactcgtcgtcgctccagtcgtgaagaatccacttgag 509 >gi|14244833|gb|BG842771.2|BG842771 MEST39-H06.T3 ISUM4-TN Zea mays cDNA clone MEST39-H06 3', mRNA sequence Length = 531 Score = 54.0 bits (27), Expect = 3e-05 Identities = 66/79 (83%) Strand = Plus / Plus Query: 415 tatagctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcat 474 |||||| |||||||||||||| || ||| | || || || | ||||||||||| |||| Sbjct: 434 tatagccttcttgcagttcttcagtatcttcacgcattcggcatcaccccagtcatgcag 493 Query: 475 gatccacttgaggaagaca 493 |||||||||||||||||| Sbjct: 494 aatccacttgaggaagaca 512 >gi|45847321|gb|CN071264.1|CN071264 1021010A11.x1 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 399 Score = 54.0 bits (27), Expect = 3e-05 Identities = 45/51 (88%) Strand = Plus / Plus Query: 203 gatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttca 253 ||||||||||||| ||| ||||||||| ||||||| || || ||||||||| Sbjct: 74 gatcgaacacctagaacaggtatgattttgtagtcgctaaacccagcttca 124 Score = 52.0 bits (26), Expect = 1e-04 Identities = 116/146 (79%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | |||||||||||||| |||||||| || ||| Sbjct: 254 attatcacctttcctcctgcatccctagagggtatagctttcttacagttcttaagtatc 313 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| |||||||| || | || Sbjct: 314 ttgatgcaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 373 Query: 503 ggcggaatggcctcaaacatgtcgcc 528 || |||||| ||||||||||||||| Sbjct: 374 gggggaatgctctcaaacatgtcgcc 399 >gi|71758528|gb|DR956465.1|DR956465 ZM_BFb0053A19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 665 Score = 54.0 bits (27), Expect = 3e-05 Identities = 120/151 (79%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | | ||| ||||||||||| |||||||| || ||| Sbjct: 345 attatcacctttcctcctgcatccctggaagggatagctttcttacagttcttgagtatc 404 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| ||| |||| || |||| ||| |||| | |||||| | |||||| || | || Sbjct: 405 ttgaaacaatcagcatcccccccgtcatgcaaaacccacttaaagaagacggcgtctgcc 464 Query: 503 ggcggaatggcctcaaacatgtcgccagcaa 533 || |||||| |||||||||||||||||||| Sbjct: 465 gggggaatgctctcaaacatgtcgccagcaa 495 Score = 48.1 bits (24), Expect = 0.002 Identities = 51/60 (85%) Strand = Plus / Plus Query: 193 ctcgatgattgatcgaacacctaaaactggtatgattatgtagtcactgaaaccagcttc 252 |||||||| |||| |||||||||||| || |||||| ||||||| || || |||||||| Sbjct: 155 ctcgatgaaggatccaacacctaaaacggggatgattttgtagtccctaaatccagcttc 214 Score = 42.1 bits (21), Expect = 0.096 Identities = 57/69 (82%) Strand = Plus / Plus Query: 632 gccgccgcgccatgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcg 691 |||||||||||| |||| ||| | |||||||| | ||||| || ||| | || |||||| Sbjct: 594 gccgccgcgccaagccctccggcgacgtcgacaaaggagcttagaccccggaagacgtcg 653 Query: 692 ccgcactcc 700 ||||||||| Sbjct: 654 ccgcactcc 662 >gi|18179412|gb|BM380622.1|BM380622 MEST522-F04.univ ISUM6 Zea mays cDNA clone MEST522-F04 3', mRNA sequence Length = 483 Score = 52.0 bits (26), Expect = 1e-04 Identities = 71/86 (82%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || ||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 285 attattaccttcccacctgcatgccgtggagatatggcttgcttgcaattcttcaatatc 344 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 345 ttgacacactcatcgtcaccccagtc 370 >gi|18180516|gb|BM381726.1|BM381726 MEST539-B12.univ ISUM6 Zea mays cDNA clone MEST539-B12 3', mRNA sequence Length = 511 Score = 52.0 bits (26), Expect = 1e-04 Identities = 71/86 (82%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| |||||| ||| |||| |||||| ||||| | ||| Sbjct: 404 attattaccttcccacctgcatcccgtggaaatatggcttgcttgcaattcttcaatatc 463 Query: 443 gtgacacactcagagtcaccccagtc 468 ||||||||||| |||||||||||| Sbjct: 464 ttgacacactcatcgtcaccccagtc 489 >gi|6194755|gb|AW146859.1|AW146859 614088G05.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 315 Score = 50.1 bits (25), Expect = 4e-04 Identities = 28/29 (96%) Strand = Plus / Minus Query: 410 ggaggtatagctttcttgcagttctttag 438 ||||||||||||||||| ||||||||||| Sbjct: 131 ggaggtatagctttcttacagttctttag 103 >gi|32919279|gb|CF024091.1|CF024091 QBS13g08.xg QBS Zea mays cDNA clone QBS13g08, mRNA sequence Length = 461 Score = 50.1 bits (25), Expect = 4e-04 Identities = 46/53 (86%) Strand = Plus / Minus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 ||||| ||||| || |||||||| ||||||||||| |||| |||||| ||||| Sbjct: 54 attattacctttccacctgcatcccgtggaggtatggcttgcttgcaattctt 2 >gi|14202318|gb|BG835995.1|BG835995 Zm06_06e10_A Zm06_AAFC_ECORC_Fusarium_graminearum_inoculated_corn_ear tip Zea mays cDNA clone Zm06_06e10, mRNA sequence Length = 547 Score = 48.1 bits (24), Expect = 0.002 Identities = 84/104 (80%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || || || ||||||| ||||| |||| ||| |||||||| || ||| Sbjct: 337 attatcaccttccctcccgcggctcgtgggggtatggcttgctttcagttcttcagtatc 396 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgag 486 |||||||||| ||| | ||||||||| | ||||||||||| Sbjct: 397 ctgacacactcgtcgtcgctccagtcgtgaagaatccacttgag 440 >gi|16921383|gb|BM075125.1|BM075125 MEST350-F03.T3 ISUM5-RN Zea mays cDNA clone MEST350-F03 3', mRNA sequence Length = 488 Score = 48.1 bits (24), Expect = 0.002 Identities = 69/84 (82%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| || |||| ||| |||| |||||| ||||| | ||| Sbjct: 342 attattaccttcccacctgcatcccgaggagatatggcttgcttgcaattcttcaatatc 401 Query: 443 gtgacacactcagagtcaccccag 466 ||||||||||| |||||||||| Sbjct: 402 ttgacacactcatcgtcaccccag 425 >gi|37396660|gb|CF635623.1|CF635623 zmrww00_0A20-012-f02.s4 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 455 Score = 48.1 bits (24), Expect = 0.002 Identities = 60/72 (83%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||| ||||| || |||||||| ||||||| ||| |||| |||||| ||||| | ||| Sbjct: 368 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 427 Query: 443 gtgacacactca 454 ||||||||||| Sbjct: 428 ttgacacactca 439 >gi|12971740|gb|BG267634.1|BG267634 1000135B04.x1 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 454 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Plus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 369 cctgctccaaccacgatatccagtattatcaccttgcc 406 Score = 36.2 bits (18), Expect = 5.9 Identities = 33/38 (86%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacaca 450 ||||| || |||||||||||||| || ||| ||||||| Sbjct: 417 ggtatggccttcttgcagttcttcagtatcttgacaca 454 >gi|18176891|gb|BM378101.1|BM378101 MEST349-A09.T3 ISUM5-RN Zea mays cDNA clone MEST349-A09 3', mRNA sequence Length = 453 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Minus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 41 cctgctccaaccacgatatccagtattatcaccttgcc 4 >gi|18176921|gb|BM378131.1|BM378131 MEST145-F06.T3 ISUM5-RN Zea mays cDNA clone MEST145-F06 3', mRNA sequence Length = 454 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Minus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 41 cctgctccaaccacgatatccagtattatcaccttgcc 4 >gi|18177079|gb|BM378289.1|BM378289 MEST401-G05.univ ISUM5-RN Zea mays cDNA clone MEST401-G05 3', mRNA sequence Length = 470 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Minus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 57 cctgctccaaccacgatatccagtattatcaccttgcc 20 >gi|18179446|gb|BM380656.1|BM380656 MEST523-B01.univ ISUM6 Zea mays cDNA clone MEST523-B01 3', mRNA sequence Length = 534 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Plus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 439 cctgctccaaccacgatatccagtattatcaccttgcc 476 Score = 36.2 bits (18), Expect = 5.9 Identities = 33/38 (86%) Strand = Plus / Plus Query: 413 ggtatagctttcttgcagttctttagaatcgtgacaca 450 ||||| || |||||||||||||| || ||| ||||||| Sbjct: 487 ggtatggccttcttgcagttcttcagtatcttgacaca 524 >gi|32864158|gb|CF003840.1|CF003840 QBH23d09.xg QBH Zea mays cDNA clone QBH23d09, mRNA sequence Length = 110 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Minus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 100 cctgctccaaccacgatatccagtattatcaccttgcc 63 >gi|60399950|gb|DN232757.1|DN232757 MEST837_G08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 355 Score = 44.1 bits (22), Expect = 0.024 Identities = 34/38 (89%) Strand = Plus / Plus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| ||||||||| |||| | ||||||||||||||| Sbjct: 300 cctgctccaaccacgatatccagtattatcaccttgcc 337 >gi|89274357|gb|AC183513.1| Zea mays chromosome UNK clone CH201-257L12; ZMMBBc0257L12, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces Length = 183750 Score = 44.1 bits (22), Expect = 0.024 Identities = 22/22 (100%) Strand = Plus / Plus Query: 6 cttgcatacatgcatacataaa 27 |||||||||||||||||||||| Sbjct: 145249 cttgcatacatgcatacataaa 145270 >gi|4647699|gb|AI622774.1|AI622774 486106E09.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 561 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 375 cccagtcgtgcaggatccacttgag 399 >gi|4647700|gb|AI622775.1|AI622775 486106E09.x2 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 609 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 413 cccagtcgtgcaggatccacttgag 437 >gi|5740160|gb|AI947850.1|AI947850 603029F07.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 535 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 349 cccagtcgtgcaggatccacttgag 373 >gi|15352979|gb|BI502590.1|BI502590 949072A08.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 117 Score = 42.1 bits (21), Expect = 0.096 Identities = 60/73 (82%) Strand = Plus / Plus Query: 461 ccccagtcgtgcatgatccacttgaggaagacagcattcgctggcggaatggcctcaaac 520 |||||||| |||| | |||||| |||||||| || | || || |||||| ||||||| Sbjct: 29 ccccagtcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaac 88 Query: 521 atgtcgccagcaa 533 ||||||||||||| Sbjct: 89 atgtcgccagcaa 101 >gi|16927167|gb|BM080236.1|BM080236 MEST105-H03.T3 ISUM4-TN Zea mays cDNA clone MEST105-H03 3', mRNA sequence Length = 599 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 641 ccatgcccgccgccaacgtcgacca 665 |||||||| |||||||||||||||| Sbjct: 565 ccatgcccaccgccaacgtcgacca 589 >gi|19769784|gb|BQ034505.1|BQ034505 1091003B01.x2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 448 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 380 cccagtcgtgcaggatccacttgag 404 >gi|22549130|gb|BU101331.1|BU101331 946153C11.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 575 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 378 cccagtcgtgcaggatccacttgag 402 >gi|22935391|gb|BU571666.1|BU571666 946183H06.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 542 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 353 cccagtcgtgcaggatccacttgag 377 >gi|28931304|gb|CB334665.1|CB334665 3529_1_40_1_A01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 590 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 529 cccagtcgtgcaggatccacttgag 505 >gi|30032023|gb|CB833874.1|CB833874 3529_1_84_1_G12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 568 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 38 cccagtcgtgcaggatccacttgag 14 >gi|29945046|gb|CB815441.1|CB815441 3529_1_73_1_D10.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 459 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 411 cccagtcgtgcaggatccacttgag 435 >gi|29947405|gb|CB816640.1|CB816640 3529_1_84_1_G12.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 474 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 426 cccagtcgtgcaggatccacttgag 450 >gi|33102426|gb|CF062386.1|CF062386 QCT8f07.yg QCT Zea mays cDNA clone QCT8f07, mRNA sequence Length = 411 Score = 42.1 bits (21), Expect = 0.096 Identities = 45/53 (84%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 ||||||||||| || || || |||| |||||| ||||| || ||||||||||| Sbjct: 304 attatcacctttccaccggcttctcttggaggaatagcctttttgcagttctt 356 >gi|37388432|gb|CF631425.1|CF631425 zmrws48_0B10-009-a04.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 637 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 641 ccatgcccgccgccaacgtcgacca 665 |||||||| |||||||||||||||| Sbjct: 543 ccatgcccaccgccaacgtcgacca 567 Score = 40.1 bits (20), Expect = 0.38 Identities = 26/28 (92%) Strand = Plus / Plus Query: 444 tgacacactcagagtcaccccagtcgtg 471 ||||||||||| ||||||||||||||| Sbjct: 346 tgacacactcatcgtcaccccagtcgtg 373 >gi|40334276|gb|CK368346.1|CK368346 zmrws055_0A20-001-d11.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 647 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 641 ccatgcccgccgccaacgtcgacca 665 |||||||| |||||||||||||||| Sbjct: 410 ccatgcccaccgccaacgtcgacca 386 Score = 40.1 bits (20), Expect = 0.38 Identities = 26/28 (92%) Strand = Plus / Minus Query: 444 tgacacactcagagtcaccccagtcgtg 471 ||||||||||| ||||||||||||||| Sbjct: 607 tgacacactcatcgtcaccccagtcgtg 580 >gi|45567928|gb|CK985817.1|CK985817 zmrsub1_0B10-010-d06.s0 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 817 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 641 ccatgcccgccgccaacgtcgacca 665 |||||||| |||||||||||||||| Sbjct: 600 ccatgcccaccgccaacgtcgacca 624 Score = 40.1 bits (20), Expect = 0.38 Identities = 26/28 (92%) Strand = Plus / Plus Query: 444 tgacacactcagagtcaccccagtcgtg 471 ||||||||||| ||||||||||||||| Sbjct: 403 tgacacactcatcgtcaccccagtcgtg 430 >gi|45846925|gb|CN070868.1|CN070868 1021004E06.x2 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 618 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 485 cccagtcgtgcaggatccacttgag 509 >gi|60344617|gb|DN211590.1|DN211590 MEST926_H10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 614 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 367 cccagtcgtgcaggatccacttgag 391 >gi|60348835|gb|DN215808.1|DN215808 MEST978_H10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 672 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 386 cccagtcgtgcaggatccacttgag 410 >gi|78543728|gb|DV621226.1|DV621226 IV-1091-401A-H03.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 676 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 496 cccagtcgtgcaggatccacttgag 520 >gi|78543795|gb|DV621293.1|DV621293 IV-1091-401B-B05.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 648 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 493 cccagtcgtgcaggatccacttgag 517 >gi|78544182|gb|DV621680.1|DV621680 IV-1091-405C-A06.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 617 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 395 cccagtcgtgcaggatccacttgag 419 >gi|83278246|gb|DV942254.1|DV942254 1000146-C08.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 422 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Plus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 394 cccagtcgtgcaggatccacttgag 418 >gi|91869444|gb|EB400388.1|EB400388 ZM_BFb0305H20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 785 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 400 cccagtcgtgcaggatccacttgag 376 >gi|21211991|gb|AY108765.1| Zea mays PCO088803 mRNA sequence Length = 704 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 153 cccagtcgtgcaggatccacttgag 129 >gi|21211991|gb|AY108765.1| Zea mays PCO088803 mRNA sequence Length = 704 Score = 42.1 bits (21), Expect = 0.096 Identities = 24/25 (96%) Strand = Plus / Minus Query: 462 cccagtcgtgcatgatccacttgag 486 |||||||||||| |||||||||||| Sbjct: 153 cccagtcgtgcaggatccacttgag 129 >gi|14243460|gb|BG841139.2|BG841139 MEST18-A10.T3 ISUM4-TN Zea mays cDNA clone MEST18-A10 3', mRNA sequence Length = 707 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Plus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 494 gctggtggaatgctctcaaacatgtcgccagc 525 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Plus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 376 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 429 >gi|32792300|gb|CD944536.1|CD944536 RDK_15 GeneTag1 Zea mays cDNA, mRNA sequence Length = 103 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Plus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 32 ctcaaacatgtcgccagcaa 51 >gi|32825786|gb|CD965487.1|CD965487 SEK_168 GeneTag2 Zea mays cDNA, mRNA sequence Length = 103 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Plus Query: 514 ctcaaacatgtcgccagcaa 533 |||||||||||||||||||| Sbjct: 32 ctcaaacatgtcgccagcaa 51 >gi|37375813|gb|CF624375.1|CF624375 zmrws05_0A20-003-a05.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 683 Score = 40.1 bits (20), Expect = 0.38 Identities = 26/28 (92%) Strand = Plus / Plus Query: 444 tgacacactcagagtcaccccagtcgtg 471 ||||||||||| ||||||||||||||| Sbjct: 477 tgacacactcatcgtcaccccagtcgtg 504 >gi|37377707|gb|CF625483.1|CF625483 zmrws05_0A21-001-d11.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 612 Score = 40.1 bits (20), Expect = 0.38 Identities = 26/28 (92%) Strand = Plus / Plus Query: 444 tgacacactcagagtcaccccagtcgtg 471 ||||||||||| ||||||||||||||| Sbjct: 477 tgacacactcatcgtcaccccagtcgtg 504 >gi|78090763|gb|DV519137.1|DV519137 ZM_BFb0203G24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 753 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Plus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 498 gctggtggaatgctctcaaacatgtcgccagc 529 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Plus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 380 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 433 >gi|78090764|gb|DV519138.1|DV519138 ZM_BFb0203G24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 848 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Minus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 803 gctggtggaatgctctcaaacatgtcgccagc 772 >gi|83278180|gb|DV942188.1|DV942188 1000141-A09.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 701 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Plus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 540 gctggtggaatgctctcaaacatgtcgccagc 571 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Plus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 422 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 475 >gi|404069|gb|L14063.1|MZEOMT Zea mays O-methyltransferase mRNA, complete cds Length = 1268 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Minus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 796 gctggtggaatgctctcaaacatgtcgccagc 765 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Minus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 914 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 861 >gi|21214492|gb|AY110291.1| Zea mays CL2555_1 mRNA sequence Length = 1319 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Minus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 796 gctggtggaatgctctcaaacatgtcgccagc 765 >gi|404069|gb|L14063.1|MZEOMT Zea mays O-methyltransferase mRNA, complete cds Length = 1268 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Minus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 796 gctggtggaatgctctcaaacatgtcgccagc 765 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Minus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 914 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 861 >gi|21214492|gb|AY110291.1| Zea mays CL2555_1 mRNA sequence Length = 1319 Score = 40.1 bits (20), Expect = 0.38 Identities = 29/32 (90%) Strand = Plus / Minus Query: 500 gctggcggaatggcctcaaacatgtcgccagc 531 ||||| |||||| |||||||||||||||||| Sbjct: 796 gctggtggaatgctctcaaacatgtcgccagc 765 >gi|71427858|gb|DR808908.1|DR808908 ZM_BFb0035N20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 743 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 266 ctccattcctgctcatctctctc 288 ||||||||||||| ||||||||| Sbjct: 163 ctccattcctgcttatctctctc 185 >gi|74244502|gb|DT652416.1|DT652416 ZM_BFb0118L07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 898 Score = 38.2 bits (19), Expect = 1.5 Identities = 31/35 (88%) Strand = Plus / Minus Query: 461 ccccagtcgtgcatgatccacttgaggaagacagc 495 |||||||| || || ||| |||||||||||||||| Sbjct: 880 ccccagtcatgtataatcgacttgaggaagacagc 846 >gi|78105222|gb|DV523640.1|DV523640 ZM_BFb0209P04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 539 Score = 38.2 bits (19), Expect = 1.5 Identities = 112/143 (78%) Strand = Plus / Plus Query: 383 attatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctttagaatc 442 ||||||||||| || |||||||| | ||| ||||||||||| |||||||| || ||| Sbjct: 353 attatcacctttccccctgcatccctaaaagggatagctttcttacagttcttaagtatc 412 Query: 443 gtgacacactcagagtcaccccagtcgtgcatgatccacttgaggaagacagcattcgct 502 ||| || |||| || |||||||| |||| | |||||| ||||| || || | ||| Sbjct: 413 ttgatgcaatcagcatccccccagtcatgcaaaacccacttaaggaaaacggcgtccgcc 472 Query: 503 ggcggaatggcctcaaacatgtc 525 || |||||| |||||||||||| Sbjct: 473 gggggaatgctctcaaacatgtc 495 >gi|89274344|gb|AC183510.1| Zea mays chromosome UNK clone ZMMBBb-451P14; ZMMBBb0451P14, *** SEQUENCING IN PROGRESS ***, 31 unordered pieces Length = 154841 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 acttgcatacatgcatacataaa 27 ||||||| ||||||||||||||| Sbjct: 19543 acttgcacacatgcatacataaa 19521 >gi|88687869|gb|AC182836.1| Zea mays chromosome UNK clone CH201-170P7, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 144250 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 acttgcatacatgcatacataaa 27 ||||||| ||||||||||||||| Sbjct: 96905 acttgcacacatgcatacataaa 96883 >gi|14244162|gb|BG841833.2|BG841833 MEST27-A11.T3 ISUM4-TN Zea mays cDNA clone MEST27-A11 3', mRNA sequence Length = 540 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Plus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 430 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 483 >gi|18181552|gb|BM382762.1|BM382762 MEST554-D06.univ ISUM6 Zea mays cDNA clone MEST554-D06 3', mRNA sequence Length = 476 Score = 36.2 bits (18), Expect = 5.9 Identities = 33/38 (86%) Strand = Plus / Plus Query: 359 cctgcaccaaccacggtatctactattatcaccttgcc 396 ||||| |||||||| |||| | ||||||||||||||| Sbjct: 433 cctgctccaaccacaatatccagtattatcaccttgcc 470 >gi|32850331|gb|CD990012.1|CD990012 QAV2b01.yg QAV Zea mays cDNA clone QAV2b01, mRNA sequence Length = 376 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Minus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 109 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 56 >gi|40303782|gb|CK348169.1|CK348169 zmrsub1_0X10-001-f06.s4 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 441 Score = 36.2 bits (18), Expect = 5.9 Identities = 45/54 (83%) Strand = Plus / Plus Query: 382 tattatcaccttgccgcctgcatctcgtggaggtatagctttcttgcagttctt 435 |||||||||||| || || || |||| |||||| ||||| || ||||| ||||| Sbjct: 355 tattatcacctttccaccggcttctcttggaggaatagcctttttgcaattctt 408 >gi|71425668|gb|DR806818.1|DR806818 ZM_BFb0032O04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 869 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 520 cgcgccatgcccgccgcc 537 >gi|71446842|gb|DR827892.1|DR827892 ZM_BFb0071J17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 801 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 515 cgcgccatgcccgccgcc 532 >gi|71447607|gb|DR828657.1|DR828657 ZM_BFb0073M16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 787 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 527 cgcgccatgcccgccgcc 544 >gi|71761531|gb|DR959468.1|DR959468 ZM_BFb0071J17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 796 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 795 cgcgccatgcccgccgcc 778 >gi|76931794|gb|DV172857.1|DV172857 ZM_BFb0175J17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 776 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 439 cgcgccatgcccgccgcc 456 >gi|78091199|gb|DV519573.1|DV519573 ZM_BFb0204A22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 863 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 523 cgcgccatgcccgccgcc 540 >gi|78115778|gb|DV534166.1|DV534166 ZM_BFb0225K03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 644 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 429 cgcgccatgcccgccgcc 446 >gi|86473028|gb|DY239398.1|DY239398 ZM_BFb0257O13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 463 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 440 cgcgccatgcccgccgcc 457 >gi|88749535|gb|DY533676.1|DY533676 ZM_BFb0264H09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 698 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 637 cgcgccatgcccgccgcc 654 |||||||||||||||||| Sbjct: 520 cgcgccatgcccgccgcc 537 >gi|92901083|gb|AC185480.1| Zea mays chromosome 4 clone CH201-194C9; ZMMBBc0194C09, *** SEQUENCING IN PROGRESS ***, 26 unordered pieces Length = 176872 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 40742 gtatataactatatatac 40725 >gi|92900965|gb|AC185478.1| Zea mays chromosome 4 clone CH201-203H3; ZMMBBc0203H03, *** SEQUENCING IN PROGRESS ***, 31 unordered pieces Length = 176914 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 53537 cttgcacacatgcatacataaa 53558 >gi|92900781|gb|AC185470.1| Zea mays chromosome 4 clone CH201-266D7; ZMMBBc0266D07, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 175494 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 19875 gtatataactatatatac 19858 >gi|92899711|gb|AC185421.1| Zea mays chromosome 4 clone CH201-527B20; ZMMBBc0527B20, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 167910 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttgcatacatgcataca 23 |||||||||||||||||| Sbjct: 113295 cttgcatacatgcataca 113312 >gi|92110167|gb|AC185304.1| Zea mays chromosome UNK clone CH201-399A2; ZMMBBc0399A02, *** SEQUENCING IN PROGRESS ***, 16 unordered pieces Length = 175453 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 35749 cttgcacacatgcatacataaa 35770 >gi|91630515|gb|AC185128.1| Zea mays chromosome UNK clone CH201-151M18; ZMMBBc0151M18, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 183840 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 62006 cttgcacacatgcatacataaa 62027 >gi|91206507|gb|AC184855.1| Zea mays chromosome UNK clone CH201-252A8; ZMMBBc0252A08, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 179574 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 18875 cttgcacacatgcatacataaa 18854 >gi|90855895|gb|AC184144.1| Zea mays chromosome UNK clone CH201-162B11; ZMMBBc0162B11, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 179409 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 54438 cttgcacacatgcatacataaa 54417 >gi|88687865|gb|AC182832.1| Zea mays chromosome UNK clone CH201-185M8, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 148799 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 6623 cttgcacacatgcatacataaa 6644 >gi|88687860|gb|AC182827.1| Zea mays chromosome UNK clone CH201-188M16, *** SEQUENCING IN PROGRESS ***, 31 unordered pieces Length = 152105 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 7533 gtatataactatatatac 7550 >gi|85861424|gb|AC177914.1| Zea mays chromosome UNK clone CH201-13D11; ZMMBBc0013D11, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces Length = 217586 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttgcatacatgcataca 23 |||||||||||||||||| Sbjct: 192882 cttgcatacatgcataca 192899 >gi|58082453|gb|AC155594.2| Zea mays strain B73 clone ZMMBBc0213M07, *** SEQUENCING IN PROGRESS ***, 33 unordered pieces Length = 191908 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 91119 gtatataactatatatac 91136 >gi|58082426|gb|AC155567.2| Zea mays strain B73 clone ZMMBBc0172N15, *** SEQUENCING IN PROGRESS ***, 14 unordered pieces Length = 178714 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 92554 gtatataactatatatac 92571 >gi|58082342|gb|AC155482.2| Zea mays strain B73 clone ZMMBBc0009M15, *** SEQUENCING IN PROGRESS ***, 38 unordered pieces Length = 203859 Score = 36.2 bits (18), Expect = 5.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 43 gtatataactatatatac 60 |||||||||||||||||| Sbjct: 30450 gtatataactatatatac 30467 >gi|57862998|gb|AC155477.1| Zea mays strain B73 clone ZMMBBc0003D12, *** SEQUENCING IN PROGRESS ***, 2 unordered pieces Length = 99188 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 57721 cttgcacacatgcatacataaa 57700 >gi|58082326|gb|AC155465.2| Zea mays strain B73 clone ZMMBBb0518K03, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 173237 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 22808 cttgcacacatgcatacataaa 22787 >gi|62123049|gb|AC150741.3| Zea mays chromosome 9L clone ZMMBBc0188H21, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces Length = 191261 Score = 36.2 bits (18), Expect = 5.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 6 cttgcatacatgcatacataaa 27 |||||| ||||||||||||||| Sbjct: 137864 cttgcacacatgcatacataaa 137843 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 267,382 Number of Sequences: 836351 Number of extensions: 267382 Number of successful extensions: 24655 Number of sequences better than 10.0: 201 Number of HSP's better than 10.0 without gapping: 201 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24150 Number of HSP's gapped (non-prelim): 475 length of query: 724 length of database: 669,372,029 effective HSP length: 19 effective length of query: 705 effective length of database: 653,481,360 effective search space: 460704358800 effective search space used: 460704358800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)