BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 2943819.2.1 (1121 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|15590132|gb|BI674748.1|BI674748 949066G11.y2 949 - Juvenile l... 999 0.0 gi|72058683|emb|CS138038.1| Sequence 1009 from Patent WO2005047516 981 0.0 gi|32168511|emb|AX756380.1| Sequence 1119 from Patent WO03000905 965 0.0 gi|45847961|gb|CN071904.1|CN071904 1021021G09.x1 1021 - Unigene ... 769 0.0 gi|78023078|gb|DV491465.1|DV491465 1000126-D05.T7-1 UGI-Reseq Ze... 769 0.0 gi|517492|emb|X78846.1|ZM38G1 Z.Mays Zm38 gene, intron 1 759 0.0 gi|5499405|gb|AI855272.1|AI855272 603013E09.x1 603 - stressed ro... 733 0.0 gi|89143148|emb|AM156908.1| Zea mays mRNA for transcription fact... 642 0.0 gi|89143148|emb|AM156908.1| Zea mays mRNA for transcription fact... 642 0.0 gi|21211622|gb|AY108544.1| Zea mays PCO117007 mRNA sequence 609 e-172 gi|21211622|gb|AY108544.1| Zea mays PCO117007 mRNA sequence 609 e-172 gi|19072741|gb|AF474119.1| Zea mays typical P-type R2R3 Myb prot... 513 e-143 gi|78082647|gb|DV511054.1|DV511054 ZM_BFb0191A18.r ZM_BFb Zea ma... 430 e-118 gi|93015011|gb|EB640531.1|EB640531 ZM_BFb0329H19.r ZM_BFb Zea ma... 430 e-118 gi|21211358|gb|AY108280.1| Zea mays PCO132931 mRNA sequence 430 e-118 gi|89143144|emb|AM156906.1| Zea mays mRNA for transcription fact... 430 e-118 gi|72058682|emb|CS138036.1| Sequence 1007 from Patent WO2005047516 430 e-118 gi|72058681|emb|CS138034.1| Sequence 1005 from Patent WO2005047516 430 e-118 gi|21211358|gb|AY108280.1| Zea mays PCO132931 mRNA sequence 430 e-118 gi|89143144|emb|AM156906.1| Zea mays mRNA for transcription fact... 430 e-118 gi|37391154|gb|CF632818.1|CF632818 zmrws48_0B20-008-d04.s0 zmrws... 410 e-112 gi|37394042|gb|CF634290.1|CF634290 zmrww00_0A10-010-e06.s0 zmrww... 410 e-112 gi|40333880|gb|CK367950.1|CK367950 zmrws055_0A10-002-b02.s0 zmrw... 410 e-112 gi|40333882|gb|CK367952.1|CK367952 zmrws055_0A10-002-c02.s0 zmrw... 410 e-112 gi|40337372|gb|CK371442.1|CK371442 zmrww005_0B20-004-b04.s0 zmrw... 410 e-112 gi|37375697|gb|CF624303.1|CF624303 zmrws05_0A11-002-c02.s0 zmrws... 404 e-111 gi|86467383|gb|DY233753.1|DY233753 ZM_BFb0243I08.r ZM_BFb Zea ma... 391 e-106 gi|86469336|gb|DY235706.1|DY235706 ZM_BFb0246J11.r ZM_BFb Zea ma... 391 e-106 gi|15215478|gb|BI431295.1|BI431295 949066G11.x1 949 - Juvenile l... 375 e-102 gi|21215256|gb|AY110666.1| Zea mays CL332_1 mRNA sequence 369 e-100 gi|21215256|gb|AY110666.1| Zea mays CL332_1 mRNA sequence 369 e-100 gi|72058680|emb|CS138032.1| Sequence 1003 from Patent WO2005047516 367 2e-99 gi|8368245|gb|BE051190.1|BE051190 za73c10.b50 Maize Glume cDNAs ... 363 3e-98 gi|67025824|gb|CO454573.1|CO454573 MZCCL10206G12.g Maize Endospe... 355 8e-96 gi|19436258|gb|BM952668.1|BM952668 952057B01.y1 952 - BMS tissue... 353 3e-95 gi|89143142|emb|AM156905.1| Zea mays mRNA for transcription fact... 347 2e-93 gi|89143142|emb|AM156905.1| Zea mays mRNA for transcription fact... 347 2e-93 gi|29162630|emb|AX660866.1| Sequence 1223 from Patent WO03000906 337 2e-90 gi|22490989|gb|BU050912.1|BU050912 1111036A01.y1 1111 - Unigene ... 319 4e-85 gi|71426087|gb|DR807137.1|DR807137 ZM_BFb0033F03.f ZM_BFb Zea ma... 319 4e-85 gi|71764666|gb|DR962603.1|DR962603 ZM_BFb0081D04.r ZM_BFb Zea ma... 315 7e-84 gi|76016982|gb|DT944152.1|DT944152 ZM_BFb0130K10.r ZM_BFb Zea ma... 307 2e-81 gi|76019366|gb|DT946536.1|DT946536 ZM_BFb0134E16.r ZM_BFb Zea ma... 299 4e-79 gi|76292738|gb|DV032306.1|DV032306 ZM_BFb0156A17.r ZM_BFb Zea ma... 299 4e-79 gi|71314779|gb|DR794011.1|DR794011 ZM_BFb0014I17.r ZM_BFb Zea ma... 278 1e-72 gi|71421428|gb|DR805425.1|DR805425 ZM_BFb0030O18.r ZM_BFb Zea ma... 278 1e-72 gi|71437959|gb|DR819009.1|DR819009 ZM_BFb0054M14.r ZM_BFb Zea ma... 278 1e-72 gi|71442129|gb|DR823179.1|DR823179 ZM_BFb0064D12.r ZM_BFb Zea ma... 278 1e-72 gi|76012828|gb|DT939998.1|DT939998 ZM_BFb0122J19.r ZM_BFb Zea ma... 278 1e-72 gi|76285950|gb|DV025518.1|DV025518 ZM_BFb0146C14.r ZM_BFb Zea ma... 278 1e-72 gi|78085421|gb|DV513814.1|DV513814 ZM_BFb0195E09.r ZM_BFb Zea ma... 278 1e-72 gi|89759022|gb|DY687978.1|DY687978 ZM_BFb0280M24.r ZM_BFb Zea ma... 278 1e-72 gi|91055532|gb|EB165950.1|EB165950 ZM_BFb0345A20.r ZM_BFb Zea ma... 278 1e-72 gi|50329655|gb|CO524781.1|CO524781 3530_1_164_1_B07.y_1 3530 - F... 270 4e-70 gi|71333196|gb|DR803641.1|DR803641 ZM_BFb0028G03.r ZM_BFb Zea ma... 270 4e-70 gi|29946941|gb|CB816401.1|CB816401 3529_1_77_1_G12.y_1 3529 - 2 ... 268 1e-69 gi|37361308|gb|CF602597.1|CF602597 EST3670 Zea mays sperm cell c... 268 1e-69 gi|71445118|gb|DR826168.1|DR826168 ZM_BFb0068N05.r ZM_BFb Zea ma... 262 9e-68 gi|37391429|gb|CF632957.1|CF632957 zmrws48_0B20-009-h08.s3 zmrws... 258 1e-66 gi|71426088|gb|DR807138.1|DR807138 ZM_BFb0033F03.r ZM_BFb Zea ma... 246 5e-63 gi|86474681|gb|DY241051.1|DY241051 ZM_BFb0261D14.f ZM_BFb Zea ma... 246 5e-63 gi|33770856|gb|CF273150.1|CF273150 EST2712 Zea mays sperm cell c... 234 2e-59 gi|78116177|gb|DV534564.1|DV534564 ZM_BFb0226D11.f ZM_BFb Zea ma... 234 2e-59 gi|93014081|gb|EB639601.1|EB639601 ZM_BFb0327J16.r ZM_BFb Zea ma... 232 8e-59 gi|6165757|gb|AF099410.1|AF099410 Zea mays clone ZmMYBIM49 R2R3M... 232 8e-59 gi|6165757|gb|AF099410.1|AF099410 Zea mays clone ZmMYBIM49 R2R3M... 232 8e-59 gi|71441759|gb|DR822809.1|DR822809 ZM_BFb0063G11.r ZM_BFb Zea ma... 230 3e-58 gi|71764665|gb|DR962602.1|DR962602 ZM_BFb0081D04.f ZM_BFb Zea ma... 230 3e-58 gi|19072751|gb|AF474124.1| Zea mays typical P-type R2R3 Myb prot... 224 2e-56 gi|78092036|gb|DV520410.1|DV520410 ZM_BFb0205E08.r ZM_BFb Zea ma... 220 3e-55 gi|50327466|gb|CO522592.1|CO522592 3530_1_149_1_A05.y_1 3530 - F... 202 7e-50 gi|76280411|gb|DV019979.1|DV019979 ZM_BFb0138B23.r ZM_BFb Zea ma... 202 7e-50 gi|91049715|gb|EB160133.1|EB160133 ZM_BFb0296M16.r ZM_BFb Zea ma... 200 3e-49 gi|19548462|gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gen... 200 3e-49 gi|60344220|gb|DN211193.1|DN211193 MEST921_A06.T7-1 UGA-ZmSAM-XZ... 182 6e-44 gi|19072733|gb|AF474115.1| Zea mays typical P-type R2R3 Myb prot... 180 3e-43 gi|37424713|gb|CF650089.1|CF650089 3530_1_81_1_F11.x_1 3530 - Fu... 174 2e-41 gi|18659428|gb|BM500332.1|BM500332 PAC000000000513 Pioneer AF-1 ... 159 9e-37 gi|71321116|gb|DR797259.1|DR797259 ZM_BFb0019E13.r ZM_BFb Zea ma... 151 2e-34 gi|78090837|gb|DV519211.1|DV519211 ZM_BFb0203I15.r ZM_BFb Zea ma... 151 2e-34 gi|91872725|gb|EB402682.1|EB402682 ZM_BFb0309J21.r ZM_BFb Zea ma... 151 2e-34 gi|37377397|gb|CF625297.1|CF625297 zmrws05_0A20-015-c04.s4 zmrws... 149 9e-34 gi|25989611|gb|AY135018.1| Zea mays PL transcription factor (pl)... 133 5e-29 gi|25989615|gb|AY135019.1| Zea mays PL transcription factor (pl)... 133 5e-29 gi|25989615|gb|AY135019.1| Zea mays PL transcription factor (pl)... 133 5e-29 gi|25989611|gb|AY135018.1| Zea mays PL transcription factor (pl)... 133 5e-29 gi|50327020|gb|CO522146.1|CO522146 3530_1_146_1_B07.y_1 3530 - F... 131 2e-28 gi|67025755|gb|CO454504.1|CO454504 MZCCL10204H10.g Maize Endospe... 131 2e-28 gi|71429108|gb|DR810158.1|DR810158 ZM_BFb0037L06.r ZM_BFb Zea ma... 131 2e-28 gi|78114130|gb|DV532519.1|DV532519 ZM_BFb0223D21.r ZM_BFb Zea ma... 131 2e-28 gi|37389671|gb|CF632056.1|CF632056 zmrws48_0B10-016-d03.s3 zmrws... 129 8e-28 gi|6165799|gb|AF099431.1|AF099431 Zea mays clone ZmMYBIP39 R2R3M... 129 8e-28 gi|6165799|gb|AF099431.1|AF099431 Zea mays clone ZmMYBIP39 R2R3M... 129 8e-28 gi|71308073|gb|DR790252.1|DR790252 ZM_BFb0009C10.r ZM_BFb Zea ma... 127 3e-27 gi|71426243|gb|DR807293.1|DR807293 ZM_BFb0033I13.r ZM_BFb Zea ma... 127 3e-27 gi|71771140|gb|DR969077.1|DR969077 ZM_BFb0090K13.r ZM_BFb Zea ma... 127 3e-27 gi|71771838|gb|DR969775.1|DR969775 ZM_BFb0091K13.r ZM_BFb Zea ma... 127 3e-27 gi|71772728|gb|DR970655.1|DR970655 ZM_BFb0093A02.r ZM_BFb Zea ma... 127 3e-27 gi|78083839|gb|DV512232.1|DV512232 ZM_BFb0192M21.r ZM_BFb Zea ma... 127 3e-27 gi|78086925|gb|DV515318.1|DV515318 ZM_BFb0197N12.r ZM_BFb Zea ma... 127 3e-27 gi|91874168|gb|EB404125.1|EB404125 ZM_BFb0313C11.r ZM_BFb Zea ma... 127 3e-27 gi|58082443|gb|AC155584.2| Zea mays strain B73 clone ZMMBBc0196I... 127 3e-27 gi|71310575|gb|DR791583.1|DR791583 ZM_BFb0011B24.r ZM_BFb Zea ma... 123 5e-26 gi|76016981|gb|DT944151.1|DT944151 ZM_BFb0130K10.f ZM_BFb Zea ma... 123 5e-26 gi|93012785|gb|EB638305.1|EB638305 ZM_BFb0325G13.r ZM_BFb Zea ma... 123 5e-26 gi|19072747|gb|AF474122.1| Zea mays typical P-type R2R3 Myb prot... 121 2e-25 gi|19548442|gb|AF470077.1| Zea mays P-type R2R3 Myb protein (Myb... 121 2e-25 gi|40336655|gb|CK370725.1|CK370725 zmrww005_0A10-008-g12.s0 zmrw... 119 8e-25 gi|76285013|gb|DV024581.1|DV024581 ZM_BFb0144N05.r ZM_BFb Zea ma... 119 8e-25 gi|89143140|emb|AM156904.1| Zea mays mRNA for transcription fact... 119 8e-25 gi|89143140|emb|AM156904.1| Zea mays mRNA for transcription fact... 119 8e-25 gi|19548468|gb|AF470090.1| Zea mays P-type R2R3 Myb protein (Myb... 119 8e-25 gi|40333941|gb|CK368011.1|CK368011 zmrws055_0A10-003-b12.s0 zmrw... 117 3e-24 gi|44901096|gb|CK827641.1|CK827641 zmrws05_0A11-003-b12.s4 zmrws... 117 3e-24 gi|78116615|gb|DV535002.1|DV535002 ZM_BFb0226N11.r ZM_BFb Zea ma... 117 3e-24 gi|21217176|gb|AY112586.1| Zea mays CL346_1 mRNA sequence 117 3e-24 gi|21217176|gb|AY112586.1| Zea mays CL346_1 mRNA sequence 117 3e-24 gi|6165775|gb|AF099419.1|AF099419 Zea mays clone ZmMYBIP122 R2R3... 115 1e-23 gi|6165775|gb|AF099419.1|AF099419 Zea mays clone ZmMYBIP122 R2R3... 115 1e-23 gi|91056683|gb|EB167101.1|EB167101 ZM_BFb0377K22.r ZM_BFb Zea ma... 111 2e-22 gi|6165741|gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3M... 111 2e-22 gi|6165741|gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3M... 111 2e-22 gi|18171701|gb|BM341541.1|BM341541 MEST336-D05.T3 ISUM5-RN Zea m... 109 8e-22 gi|60338535|gb|DN205508.1|DN205508 MEST818_F10.T7-1 UGA-ZmSAM-XZ... 109 8e-22 gi|6165687|gb|AF099375.1|AF099375 Zea mays clone ZmMYB3H101 R2R3... 109 8e-22 gi|6165687|gb|AF099375.1|AF099375 Zea mays clone ZmMYB3H101 R2R3... 109 8e-22 gi|71433862|gb|DR814912.1|DR814912 ZM_BFb0044M17.r ZM_BFb Zea ma... 107 3e-21 gi|76020620|gb|DT947790.1|DT947790 ZM_BFb0136E02.r ZM_BFb Zea ma... 107 3e-21 gi|76280856|gb|DV020424.1|DV020424 ZM_BFb0138L22.r ZM_BFb Zea ma... 107 3e-21 gi|76285011|gb|DV024579.1|DV024579 ZM_BFb0144N04.r ZM_BFb Zea ma... 107 3e-21 gi|78080722|gb|DV509134.1|DV509134 ZM_BFb0188A21.r ZM_BFb Zea ma... 107 3e-21 gi|78118144|gb|DV536531.1|DV536531 ZM_BFb0229B05.r ZM_BFb Zea ma... 107 3e-21 gi|88758164|gb|DY542305.1|DY542305 ZM_BFb0367M19.r ZM_BFb Zea ma... 107 3e-21 gi|91048267|gb|EB158685.1|EB158685 ZM_BFb0292D01.r ZM_BFb Zea ma... 107 3e-21 gi|168589|gb|M73028.1|MZEPPR Zea mays protein homologous to the ... 107 3e-21 gi|168591|gb|M73029.1|MZEPPRA Zea mays myb-like transcription fa... 107 3e-21 gi|1491932|gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, com... 107 3e-21 gi|6165783|gb|AF099423.1|AF099423 Zea mays clone ZmMYBIP156 R2R3... 107 3e-21 gi|16507119|gb|AF427146.1|AF427146 Zea mays myb-like transcripti... 107 3e-21 gi|21207167|gb|AY104089.1| Zea mays PCO146624 mRNA sequence 107 3e-21 gi|1491932|gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, com... 107 3e-21 gi|168591|gb|M73029.1|MZEPPRA Zea mays myb-like transcription fa... 107 3e-21 gi|168589|gb|M73028.1|MZEPPR Zea mays protein homologous to the ... 107 3e-21 gi|21207167|gb|AY104089.1| Zea mays PCO146624 mRNA sequence 107 3e-21 gi|16507119|gb|AF427146.1|AF427146 Zea mays myb-like transcripti... 107 3e-21 gi|6165783|gb|AF099423.1|AF099423 Zea mays clone ZmMYBIP156 R2R3... 107 3e-21 gi|40336064|gb|CK370134.1|CK370134 zmrws485_0B20-002-g06.s0 zmrw... 105 1e-20 gi|86474682|gb|DY241052.1|DY241052 ZM_BFb0261D14.r ZM_BFb Zea ma... 105 1e-20 gi|6165675|gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3M... 105 1e-20 gi|6165779|gb|AF099421.1|AF099421 Zea mays clone ZmMYBIP126 R2R3... 105 1e-20 gi|309571|gb|L19496.1|MZETRACTB Zea mays transcriptional activat... 105 1e-20 gi|309569|gb|L19495.1| Zea mays transcriptional activator gene, ... 105 1e-20 gi|309567|gb|L19494.1|MZEPLTANSA Zea mays PL transcriptional act... 105 1e-20 gi|293899|gb|L13454.1|MZEPLBH Zea mays Pl-Bh (Blotched1) gene, c... 105 1e-20 gi|88861838|gb|DQ394071.1| Zea mays non-functional purple plant ... 105 1e-20 gi|88595887|gb|DQ379502.1| Zea mays PL1 transcription factor-lik... 105 1e-20 gi|88595885|gb|DQ379501.1| Zea mays PL1 transcription factor (pl... 105 1e-20 gi|88595883|gb|DQ379500.1| Zea mays PL1 transcription factor (pl... 105 1e-20 gi|88595881|gb|DQ379499.1| Zea mays PL1 transcription factor (pl... 105 1e-20 gi|46981892|gb|AY530952.1| Zea mays unknown (Z576C20.2), putativ... 105 1e-20 gi|25989613|gb|AY135017.1| Zea mays PL transcription factor (pl)... 105 1e-20 gi|25989607|gb|AY135016.1| Zea mays PL transcription factor (pl)... 105 1e-20 gi|19548448|gb|AF470080.1| Zea mays P-type R2R3 Myb protein (Myb... 105 1e-20 gi|6165779|gb|AF099421.1|AF099421 Zea mays clone ZmMYBIP126 R2R3... 105 1e-20 gi|6165675|gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3M... 105 1e-20 gi|2343274|gb|AF015269.1|AF015269 Zea mays retrotransposon Magel... 105 1e-20 gi|2343272|gb|AF015268.1|AF015268 Zea mays PL transcription fact... 105 1e-20 gi|19351084|gb|BM895616.1|BM895616 952076A07.y1 952 - BMS tissue... 103 5e-20 gi|40335344|gb|CK369414.1|CK369414 zmrws485_0A10-004-c09.s0 zmrw... 103 5e-20 gi|71306457|gb|DR789376.1|DR789376 ZM_BFb0007O07.r ZM_BFb Zea ma... 103 5e-20 gi|71417476|gb|DR804074.1|DR804074 ZM_BFb0029A02.r ZM_BFb Zea ma... 103 5e-20 gi|71433798|gb|DR814848.1|DR814848 ZM_BFb0044L07.r ZM_BFb Zea ma... 103 5e-20 gi|76933766|gb|DV173580.1|DV173580 ZM_BFb0176K09.r ZM_BFb Zea ma... 103 5e-20 gi|76935837|gb|DV174489.1|DV174489 ZM_BFb0178D08.r ZM_BFb Zea ma... 103 5e-20 gi|87153529|gb|DY398318.1|DY398318 III-952-11B-F08.M13-R UGIII-R... 103 5e-20 gi|91874914|gb|EB404871.1|EB404871 ZM_BFb0314H11.r ZM_BFb Zea ma... 103 5e-20 gi|89143146|emb|AM156907.1| Zea mays mRNA for transcription fact... 103 5e-20 gi|89143146|emb|AM156907.1| Zea mays mRNA for transcription fact... 103 5e-20 gi|6031337|gb|AW076194.1|AW076194 614064D10.y1 614 - root cDNA l... 101 2e-19 gi|18165209|gb|BM335048.1|BM335048 MEST144-H06.T3 ISUM5-RN Zea m... 101 2e-19 gi|6165751|gb|AF099407.1|AF099407 Zea mays clone ZmMYBIM42 R2R3M... 101 2e-19 gi|29569833|gb|AY237128.1| Zea mays myb-related protein c1-I-2K1... 101 2e-19 gi|29569833|gb|AY237128.1| Zea mays myb-related protein c1-I-2K1... 101 2e-19 gi|19072737|gb|AF474117.1| Zea mays typical P-type R2R3 Myb prot... 101 2e-19 gi|6165751|gb|AF099407.1|AF099407 Zea mays clone ZmMYBIM42 R2R3M... 101 2e-19 gi|58082293|gb|AC155431.2| Zea mays strain B73 clone ZMMBBb0240E... 101 2e-19 gi|78116178|gb|DV534565.1|DV534565 ZM_BFb0226D11.r ZM_BFb Zea ma... 100 7e-19 gi|91876238|gb|EB406195.1|EB406195 ZM_BFb0316L22.r ZM_BFb Zea ma... 100 7e-19 gi|6165793|gb|AF099428.1|AF099428 Zea mays clone ZmMYBIP29 R2R3M... 100 7e-19 gi|6165793|gb|AF099428.1|AF099428 Zea mays clone ZmMYBIP29 R2R3M... 100 7e-19 gi|22491454|gb|BU051377.1|BU051377 1111042F08.y1 1111 - Unigene ... 98 3e-18 gi|21212011|gb|AY108777.1| Zea mays PCO139596 mRNA sequence 98 3e-18 gi|21212011|gb|AY108777.1| Zea mays PCO139596 mRNA sequence 98 3e-18 gi|11229031|gb|AF315587.1|AF315587 Zea mays truncated PL protein... 98 3e-18 gi|90704951|gb|AC184048.1| Zea mays chromosome UNK clone ZMMBBb-... 98 3e-18 gi|78086924|gb|DV515317.1|DV515317 ZM_BFb0197N12.f ZM_BFb Zea ma... 96 1e-17 gi|5268628|gb|AI770592.1|AI770592 606054G05.x2 606 - Ear tissue ... 94 5e-17 gi|50326490|gb|CO521616.1|CO521616 3530_1_142_1_G02.y_1 3530 - F... 94 5e-17 gi|71760965|gb|DR958902.1|DR958902 ZM_BFb0063G11.f ZM_BFb Zea ma... 94 5e-17 gi|71765330|gb|DR963267.1|DR963267 ZM_BFb0082C13.r ZM_BFb Zea ma... 94 5e-17 gi|78084620|gb|DV513013.1|DV513013 ZM_BFb0193P03.r ZM_BFb Zea ma... 94 5e-17 gi|86466328|gb|DY232699.1|DY232699 ZM_BFb0241P11.r ZM_BFb Zea ma... 94 5e-17 gi|91874388|gb|EB404345.1|EB404345 ZM_BFb0313I04.r ZM_BFb Zea ma... 94 5e-17 gi|19548460|gb|AF470086.1| Zea mays P-type R2R3 Myb protein (Myb... 94 5e-17 gi|60339598|gb|DN206571.1|DN206571 MEST835_F11.T7-1 UGA-ZmSAM-XZ... 92 2e-16 gi|71323538|gb|DR798430.1|DR798430 ZM_BFb0020P04.f ZM_BFb Zea ma... 92 2e-16 gi|71323539|gb|DR798431.1|DR798431 ZM_BFb0020P04.r ZM_BFb Zea ma... 92 2e-16 gi|6165709|gb|AF099386.1|AF099386 Zea mays clone ZmMYBIF14 R2R3M... 92 2e-16 gi|6165729|gb|AF099396.1|AF099396 Zea mays clone ZmMYBIF41 R2R3M... 92 2e-16 gi|6165765|gb|AF099414.1|AF099414 Zea mays clone ZmMYBIM66 R2R3M... 92 2e-16 gi|517491|emb|X78845.1|ZM1G12 Z.Mays Zm1 gene, introns 1 and 2 92 2e-16 gi|11526772|gb|AF210616.1|AF210616 Zea mays P2 protein (P2) gene... 92 2e-16 gi|6165765|gb|AF099414.1|AF099414 Zea mays clone ZmMYBIM66 R2R3M... 92 2e-16 gi|6165729|gb|AF099396.1|AF099396 Zea mays clone ZmMYBIF41 R2R3M... 92 2e-16 gi|6165709|gb|AF099386.1|AF099386 Zea mays clone ZmMYBIF14 R2R3M... 92 2e-16 gi|22213|emb|X52201.1|ZMC1I Z.mays C1-I gene 90 7e-16 gi|22212|emb|X06333.1|ZMC1 Z.mays DNA for c1 locus 90 7e-16 gi|168514|gb|M37153.1|MZEMYBAA Z.mays c1 locus myb homologue cDN... 90 7e-16 gi|38230583|gb|AF320614.3| Zea mays anthocyanin regulatory C1 (c... 90 7e-16 gi|38230582|gb|AF320613.3| Zea mays anthocyanin regulatory C1 (c... 90 7e-16 gi|15042117|gb|AF292545.1|AF292545 Zea mays subsp. parviglumis P... 90 7e-16 gi|15042115|gb|AF292544.1|AF292544 Zea mays subsp. parviglumis M... 90 7e-16 gi|15042113|gb|AF292543.1|AF292543 Zea mays subsp. parviglumis M... 90 7e-16 gi|15042111|gb|AF292542.1|AF292542 Zea mays subsp. parviglumis P... 90 7e-16 gi|15042109|gb|AF292541.1|AF292541 Zea mays subsp. parviglumis P... 90 7e-16 gi|15042107|gb|AF292540.1|AF292540 Zea mays subsp. parviglumis P... 90 7e-16 gi|57790136|gb|AC149815.2| Zea mays clone ZMMBBb0305O08, *** SEQ... 90 7e-16 gi|19436176|gb|BM952586.1|BM952586 952076A07.x1 952 - BMS tissue... 88 3e-15 gi|71774057|gb|DR971943.1|DR971943 ZM_BFb0094O01.r ZM_BFb Zea ma... 88 3e-15 gi|46981881|gb|AY530950.1| Zea mays putative zinc finger protein... 88 3e-15 gi|19072745|gb|AF474121.1| Zea mays typical P-type R2R3 Myb prot... 88 3e-15 gi|19072735|gb|AF474116.1| Zea mays typical P-type R2R3 Myb prot... 88 3e-15 gi|5268844|gb|AI770808.1|AI770808 606058F03.x2 606 - Ear tissue ... 86 1e-14 gi|37417369|gb|CF646337.1|CF646337 3530_1_112_1_E06.x_1 3530 - F... 86 1e-14 gi|50338321|gb|CO533447.1|CO533447 3530_1_220_1_A11.y_1 3530 - F... 86 1e-14 gi|71299306|gb|DR785666.1|DR785666 ZM_BFb0002E13.r ZM_BFb Zea ma... 86 1e-14 gi|71304173|gb|DR788206.1|DR788206 ZM_BFb0006B24.r ZM_BFb Zea ma... 86 1e-14 gi|71436530|gb|DR817580.1|DR817580 ZM_BFb0051B11.r ZM_BFb Zea ma... 86 1e-14 gi|71438159|gb|DR819209.1|DR819209 ZM_BFb0055F10.r ZM_BFb Zea ma... 86 1e-14 gi|78090893|gb|DV519267.1|DV519267 ZM_BFb0203J22.r ZM_BFb Zea ma... 86 1e-14 gi|78111891|gb|DV530288.1|DV530288 ZM_BFb0220A08.r ZM_BFb Zea ma... 86 1e-14 gi|78120398|gb|DV538782.1|DV538782 ZM_BFb0232F19.r ZM_BFb Zea ma... 86 1e-14 gi|78122337|gb|DV540721.1|DV540721 ZM_BFb0235C23.r ZM_BFb Zea ma... 86 1e-14 gi|91049867|gb|EB160285.1|EB160285 ZM_BFb0298A24.r ZM_BFb Zea ma... 86 1e-14 gi|28610109|gb|AF521880.1| Zea mays R2R3 Myb transcription facto... 86 1e-14 gi|21216231|gb|AY111641.1| Zea mays CL1341_1 mRNA sequence 86 1e-14 gi|42794335|gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, com... 86 1e-14 gi|42794337|gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, com... 86 1e-14 gi|42794337|gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, com... 86 1e-14 gi|42794335|gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, com... 86 1e-14 gi|21216231|gb|AY111641.1| Zea mays CL1341_1 mRNA sequence 86 1e-14 gi|28610109|gb|AF521880.1| Zea mays R2R3 Myb transcription facto... 86 1e-14 gi|37423553|gb|CF649504.1|CF649504 3530_1_71_1_B10.x_2 3530 - Fu... 84 4e-14 gi|88756553|gb|DY540694.1|DY540694 ZM_BFb0358D20.r ZM_BFb Zea ma... 84 4e-14 gi|6165691|gb|AF099377.1|AF099377 Zea mays clone ZmMYB4H47 R2R3M... 84 4e-14 gi|22176|emb|Z11879.1|ZMAYSPG Z.mays P gene 84 4e-14 gi|51804292|gb|AY702552.1| Zea mays Myb-like transcription facto... 84 4e-14 gi|19548438|gb|AF470075.1| Zea mays A-type R2R3 Myb protein (Myb... 84 4e-14 gi|19548434|gb|AF470073.1| Zea mays A-type R2R3 Myb protein (Myb... 84 4e-14 gi|11526774|gb|AF210617.1|AF210617 Zea mays subsp. parviglumis P... 84 4e-14 gi|6165691|gb|AF099377.1|AF099377 Zea mays clone ZmMYB4H47 R2R3M... 84 4e-14 gi|6918813|gb|AW400343.1|AW400343 707059D09.x1 707 - Mixed adult... 82 2e-13 gi|12046396|gb|BF728535.1|BF728535 1000063G03.x1 1000 - Unigene ... 82 2e-13 gi|15426714|gb|BI542536.1|BI542536 949021A03.y1 949 - Juvenile l... 82 2e-13 gi|71314043|gb|DR793635.1|DR793635 ZM_BFb0013P19.r ZM_BFb Zea ma... 82 2e-13 gi|71323173|gb|DR798254.1|DR798254 ZM_BFb0020L07.r ZM_BFb Zea ma... 82 2e-13 gi|71444420|gb|DR825470.1|DR825470 ZM_BFb0067M18.f ZM_BFb Zea ma... 82 2e-13 gi|71444421|gb|DR825471.1|DR825471 ZM_BFb0067M18.r ZM_BFb Zea ma... 82 2e-13 gi|78074012|gb|DV502446.1|DV502446 ZM_BFb0174E18.f ZM_BFb Zea ma... 82 2e-13 gi|78074013|gb|DV502447.1|DV502447 ZM_BFb0174E18.r ZM_BFb Zea ma... 82 2e-13 gi|78082646|gb|DV511053.1|DV511053 ZM_BFb0191A18.f ZM_BFb Zea ma... 82 2e-13 gi|78112787|gb|DV531181.1|DV531181 ZM_BFb0221D19.f ZM_BFb Zea ma... 82 2e-13 gi|78112788|gb|DV531182.1|DV531182 ZM_BFb0221D19.r ZM_BFb Zea ma... 82 2e-13 gi|78180714|gb|DV551087.1|DV551087 1000063-G03.GAD10-F UGI-Reseq... 82 2e-13 gi|86467382|gb|DY233752.1|DY233752 ZM_BFb0243I08.f ZM_BFb Zea ma... 82 2e-13 gi|86467417|gb|DY233787.1|DY233787 ZM_BFb0243J07.f ZM_BFb Zea ma... 82 2e-13 gi|86469335|gb|DY235705.1|DY235705 ZM_BFb0246J11.f ZM_BFb Zea ma... 82 2e-13 gi|89249308|gb|DY621094.1|DY621094 ZM_BFb0283D04.r ZM_BFb Zea ma... 82 2e-13 gi|91050648|gb|EB161066.1|EB161066 ZM_BFb0299M06.r ZM_BFb Zea ma... 82 2e-13 gi|11526776|gb|AH010035.1|SEG_AF210619S Zea mays subsp. parviglu... 82 2e-13 gi|11526777|gb|AF210619.1|AF210619S1 Zea mays subsp. parviglumis... 82 2e-13 gi|92900807|gb|AC185471.1| Zea mays chromosome 4 clone CH201-266... 82 2e-13 gi|89515019|gb|AC183656.1| Zea mays chromosome UNK clone CH201-3... 82 2e-13 gi|19548466|gb|AF470089.1| Zea mays P-type R2R3 Myb protein (Myb... 80 7e-13 gi|44900796|gb|CK827341.1|CK827341 zmrsub1_0B10-008-f04.s0 zmrsu... 78 3e-12 gi|71328401|gb|DR800834.1|DR800834 ZM_BFb0024G05.r ZM_BFb Zea ma... 78 3e-12 gi|74235090|gb|DT643004.1|DT643004 ZM_BFb0101M11.r ZM_BFb Zea ma... 78 3e-12 gi|91050806|gb|EB161224.1|EB161224 ZM_BFb0300D07.r ZM_BFb Zea ma... 78 3e-12 gi|93016922|gb|EB642442.1|EB642442 ZM_BFb0332M10.r ZM_BFb Zea ma... 78 3e-12 gi|19548456|gb|AF470084.1| Zea mays P-type R2R3 Myb protein (Myb... 78 3e-12 gi|19548436|gb|AF470074.1| Zea mays A-type R2R3 Myb protein (Myb... 78 3e-12 gi|88900607|gb|AC182604.2| Zea mays chromosome UNK clone CH201-4... 78 3e-12 gi|37384952|gb|CF629586.1|CF629586 zmrws48_0A20-003-b01.s0 zmrws... 76 1e-11 gi|40335674|gb|CK369744.1|CK369744 zmrws485_0A21-003-b01.s0 zmrw... 76 1e-11 gi|44900608|gb|CK827153.1|CK827153 zmrsub1_0B10-006-d04.s0 zmrsu... 76 1e-11 gi|71327646|gb|DR800431.1|DR800431 ZM_BFb0023M24.r ZM_BFb Zea ma... 76 1e-11 gi|76914722|gb|DV165654.1|DV165654 ZM_BFb0162L09.r ZM_BFb Zea ma... 76 1e-11 gi|91048016|gb|EB158434.1|EB158434 ZM_BFb0291G04.r ZM_BFb Zea ma... 76 1e-11 gi|6165707|gb|AF099385.1|AF099385 Zea mays clone ZmMYBIF13 R2R3M... 76 1e-11 gi|28610111|gb|AF521881.1| Zea mays R2R3 Myb transcription facto... 76 1e-11 gi|28610111|gb|AF521881.1| Zea mays R2R3 Myb transcription facto... 76 1e-11 gi|19548464|gb|AF470088.1| Zea mays P-type R2R3 Myb protein (Myb... 76 1e-11 gi|6165707|gb|AF099385.1|AF099385 Zea mays clone ZmMYBIF13 R2R3M... 76 1e-11 gi|76018269|gb|DT945439.1|DT945439 ZM_BFb0132K15.r ZM_BFb Zea ma... 74 4e-11 gi|93015010|gb|EB640530.1|EB640530 ZM_BFb0329H19.f ZM_BFb Zea ma... 74 4e-11 gi|14332390|gb|G70705.1|G70705 VE0295311FB73 maize leaf DNA Zea ... 74 4e-11 gi|19072749|gb|AF474123.1| Zea mays typical P-type R2R3 Myb prot... 74 4e-11 gi|19548432|gb|AF470072.1| Zea mays A-type R2R3 Myb protein (Myb... 74 4e-11 gi|37375168|gb|CF624004.1|CF624004 zmrws05_0A10-014-g08.s0 zmrws... 72 2e-10 gi|71314042|gb|DR793634.1|DR793634 ZM_BFb0013P19.f ZM_BFb Zea ma... 72 2e-10 gi|71318039|gb|DR795781.1|DR795781 ZM_BFb0017B23.r ZM_BFb Zea ma... 72 2e-10 gi|71322344|gb|DR797848.1|DR797848 ZM_BFb0020C06.r ZM_BFb Zea ma... 72 2e-10 gi|71324739|gb|DR799078.1|DR799078 ZM_BFb0021N21.r ZM_BFb Zea ma... 72 2e-10 gi|71427805|gb|DR808855.1|DR808855 ZM_BFb0035M14.r ZM_BFb Zea ma... 72 2e-10 gi|71437705|gb|DR818755.1|DR818755 ZM_BFb0054B11.r ZM_BFb Zea ma... 72 2e-10 gi|71439427|gb|DR820477.1|DR820477 ZM_BFb0058O01.r ZM_BFb Zea ma... 72 2e-10 gi|71443055|gb|DR824105.1|DR824105 ZM_BFb0065L14.r ZM_BFb Zea ma... 72 2e-10 gi|71445811|gb|DR826861.1|DR826861 ZM_BFb0069M24.r ZM_BFb Zea ma... 72 2e-10 gi|71769782|gb|DR967719.1|DR967719 ZM_BFb0088L05.r ZM_BFb Zea ma... 72 2e-10 gi|71772780|gb|DR970705.1|DR970705 ZM_BFb0093B06.r ZM_BFb Zea ma... 72 2e-10 gi|71774193|gb|DR972073.1|DR972073 ZM_BFb0095B05.f ZM_BFb Zea ma... 72 2e-10 gi|74240744|gb|DT648658.1|DT648658 ZM_BFb0110F15.r ZM_BFb Zea ma... 72 2e-10 gi|74242172|gb|DT650086.1|DT650086 ZM_BFb0113F11.r ZM_BFb Zea ma... 72 2e-10 gi|76293043|gb|DV032611.1|DV032611 ZM_BFb0156H12.r ZM_BFb Zea ma... 72 2e-10 gi|76918489|gb|DV167324.1|DV167324 ZM_BFb0165F23.r ZM_BFb Zea ma... 72 2e-10 gi|76931001|gb|DV172587.1|DV172587 ZM_BFb0175D16.r ZM_BFb Zea ma... 72 2e-10 gi|78073898|gb|DV502332.1|DV502332 ZM_BFb0174C03.r ZM_BFb Zea ma... 72 2e-10 gi|78081616|gb|DV510028.1|DV510028 ZM_BFb0189H05.r ZM_BFb Zea ma... 72 2e-10 gi|78107708|gb|DV526126.1|DV526126 ZM_BFb0213J19.r ZM_BFb Zea ma... 72 2e-10 gi|78118143|gb|DV536530.1|DV536530 ZM_BFb0229B05.f ZM_BFb Zea ma... 72 2e-10 gi|89252337|gb|DY624123.1|DY624123 ZM_BFb0299M06.f ZM_BFb Zea ma... 72 2e-10 gi|91050525|gb|EB160943.1|EB160943 ZM_BFb0299F16.r ZM_BFb Zea ma... 72 2e-10 gi|91872161|gb|EB402118.1|EB402118 ZM_BFb0308K22.r ZM_BFb Zea ma... 72 2e-10 gi|91874578|gb|EB404535.1|EB404535 ZM_BFb0313M23.r ZM_BFb Zea ma... 72 2e-10 gi|91875322|gb|EB405279.1|EB405279 ZM_BFb0315D03.r ZM_BFb Zea ma... 72 2e-10 gi|91877374|gb|EB407331.1|EB407331 ZM_BFb0319H11.r ZM_BFb Zea ma... 72 2e-10 gi|19548440|gb|AF470076.1| Zea mays P-type R2R3 Myb protein (Myb... 72 2e-10 gi|4753385|gb|AI657290.1|AI657290 486093A08.y1 486 - leaf primor... 70 7e-10 gi|32804366|gb|CD956602.1|CD956602 SCE_171 GeneTag2 Zea mays cDN... 70 7e-10 gi|71421516|gb|DR805478.1|DR805478 ZM_BFb0030P22.r ZM_BFb Zea ma... 70 7e-10 gi|71438646|gb|DR819696.1|DR819696 ZM_BFb0056L09.r ZM_BFb Zea ma... 70 7e-10 gi|74237787|gb|DT645701.1|DT645701 ZM_BFb0105N11.r ZM_BFb Zea ma... 70 7e-10 gi|74237820|gb|DT645734.1|DT645734 ZM_BFb0105O09.r ZM_BFb Zea ma... 70 7e-10 gi|74245026|gb|DT652940.1|DT652940 ZM_BFb0119J20.r ZM_BFb Zea ma... 70 7e-10 gi|78081645|gb|DV510057.1|DV510057 ZM_BFb0189H24.r ZM_BFb Zea ma... 70 7e-10 gi|78105478|gb|DV523896.1|DV523896 ZM_BFb0210F08.r ZM_BFb Zea ma... 70 7e-10 gi|78125281|gb|DV543665.1|DV543665 ZM_BFb0239N08.r ZM_BFb Zea ma... 70 7e-10 gi|91048895|gb|EB159313.1|EB159313 ZM_BFb0294I09.r ZM_BFb Zea ma... 70 7e-10 gi|91877724|gb|EB407681.1|EB407681 ZM_BFb0320B02.r ZM_BFb Zea ma... 70 7e-10 gi|93011896|gb|EB637416.1|EB637416 ZM_BFb0323B03.r ZM_BFb Zea ma... 70 7e-10 gi|21207636|gb|AY104558.1| Zea mays PCO116495 mRNA sequence 70 7e-10 gi|21207636|gb|AY104558.1| Zea mays PCO116495 mRNA sequence 70 7e-10 gi|58082255|gb|AC155393.2| Zea mays strain B73 clone ZMMBBb0157N... 70 7e-10 gi|60394154|gb|DN227024.1|DN227024 MEST1198_C12.T7-1 UGA-ZmSAM-X... 68 3e-09 gi|67021186|gb|CO449935.1|CO449935 MZCCL10142D02.g Maize Endospe... 68 3e-09 gi|71316277|gb|DR794817.1|DR794817 ZM_BFb0015K24.f ZM_BFb Zea ma... 68 3e-09 gi|71316278|gb|DR794818.1|DR794818 ZM_BFb0015K24.r ZM_BFb Zea ma... 68 3e-09 gi|78104845|gb|DV523263.1|DV523263 ZM_BFb0209G13.r ZM_BFb Zea ma... 68 3e-09 gi|6165673|gb|AF099368.1|AF099368 Zea mays clone ZmMYB1G26 R2R3M... 68 3e-09 gi|6165693|gb|AF099378.1|AF099378 Zea mays clone ZmMYB4H48 R2R3M... 68 3e-09 gi|19072743|gb|AF474120.1| Zea mays typical P-type R2R3 Myb prot... 68 3e-09 gi|6165693|gb|AF099378.1|AF099378 Zea mays clone ZmMYB4H48 R2R3M... 68 3e-09 gi|6165673|gb|AF099368.1|AF099368 Zea mays clone ZmMYB1G26 R2R3M... 68 3e-09 gi|90568144|gb|AC183932.1| Zea mays chromosome UNK clone ZMMBBb-... 68 3e-09 gi|90819245|gb|AC165178.2| Zea mays clone ZMMBBb-272P17, complet... 68 3e-09 gi|13150400|gb|BG320722.1|BG320722 Zm04_07a04_R Zm04_AAFC_ECORC_... 66 1e-08 gi|18659239|gb|BM500231.1|BM500231 PAC000000000446 Pioneer AF-1 ... 66 1e-08 gi|37397079|gb|CF635834.1|CF635834 zmrww00_0B10-001-a11.s2 zmrww... 66 1e-08 gi|50334157|gb|CO529283.1|CO529283 3530_1_193_1_E08.y_1 3530 - F... 66 1e-08 gi|50336431|gb|CO531557.1|CO531557 3530_1_208_1_B09.x_1 3530 - F... 66 1e-08 gi|67018908|gb|CO447657.1|CO447657 MZCCL10097G05.g1 Maize Endosp... 66 1e-08 gi|71433797|gb|DR814847.1|DR814847 ZM_BFb0044L07.f ZM_BFb Zea ma... 66 1e-08 gi|71426311|gb|DR807361.1|DR807361 ZM_BFb0033K01.f ZM_BFb Zea ma... 66 1e-08 gi|71767383|gb|DR965320.1|DR965320 ZM_BFb0085D06.f ZM_BFb Zea ma... 66 1e-08 gi|74238354|gb|DT646268.1|DT646268 ZM_BFb0106K23.r ZM_BFb Zea ma... 66 1e-08 gi|74241505|gb|DT649419.1|DT649419 ZM_BFb0112B22.f ZM_BFb Zea ma... 66 1e-08 gi|74241855|gb|DT649769.1|DT649769 ZM_BFb0112L09.r ZM_BFb Zea ma... 66 1e-08 gi|76282041|gb|DV021609.1|DV021609 ZM_BFb0140G23.r ZM_BFb Zea ma... 66 1e-08 gi|76289296|gb|DV028864.1|DV028864 ZM_BFb0151A15.r ZM_BFb Zea ma... 66 1e-08 gi|76917569|gb|DV166895.1|DV166895 ZM_BFb0164K21.r ZM_BFb Zea ma... 66 1e-08 gi|78074367|gb|DV502801.1|DV502801 ZM_BFb0174M13.r ZM_BFb Zea ma... 66 1e-08 gi|78080924|gb|DV509336.1|DV509336 ZM_BFb0188G02.r ZM_BFb Zea ma... 66 1e-08 gi|78113997|gb|DV532386.1|DV532386 ZM_BFb0223A19.f ZM_BFb Zea ma... 66 1e-08 gi|78117089|gb|DV535476.1|DV535476 ZM_BFb0227I20.r ZM_BFb Zea ma... 66 1e-08 gi|88757587|gb|DY541728.1|DY541728 ZM_BFb0366N21.r ZM_BFb Zea ma... 66 1e-08 gi|91049428|gb|EB159846.1|EB159846 ZM_BFb0296F06.f ZM_BFb Zea ma... 66 1e-08 gi|91872190|gb|EB402147.1|EB402147 ZM_BFb0308L18.r ZM_BFb Zea ma... 66 1e-08 gi|21207971|gb|AY104893.1| Zea mays PCO132275 mRNA sequence 66 1e-08 gi|21211047|gb|AY107969.1| Zea mays PCO069276 mRNA sequence 66 1e-08 gi|72056897|emb|CS137822.1| Sequence 793 from Patent WO2005047516 66 1e-08 gi|21211047|gb|AY107969.1| Zea mays PCO069276 mRNA sequence 66 1e-08 gi|21207971|gb|AY104893.1| Zea mays PCO132275 mRNA sequence 66 1e-08 gi|19072739|gb|AF474118.1| Zea mays typical P-type R2R3 Myb prot... 66 1e-08 gi|88024619|gb|AC182617.1| Zea mays chromosome UNK clone CH201-1... 66 1e-08 gi|89274337|gb|AC182438.3| Zea mays chromosome UNK clone ZMMBBb-... 66 1e-08 gi|89274354|gb|AC182419.3| Zea mays chromosome UNK clone ZMMBBb-... 66 1e-08 gi|37376881|gb|CF625002.1|CF625002 zmrws05_0A20-011-h12.s0 zmrws... 64 4e-08 gi|50324413|gb|CO519539.1|CO519539 3530_1_128_1_E05.y_1 3530 - F... 64 4e-08 gi|71764920|gb|DR962857.1|DR962857 ZM_BFb0081I17.r ZM_BFb Zea ma... 64 4e-08 gi|76934017|gb|DV173689.1|DV173689 ZM_BFb0176M23.r ZM_BFb Zea ma... 64 4e-08 gi|18659913|gb|BM500588.1|BM500588 PAC000000001231 Pioneer AF-1 ... 62 2e-07 gi|71301963|gb|DR787058.1|DR787058 ZM_BFb0004E22.r ZM_BFb Zea ma... 62 2e-07 gi|71442045|gb|DR823095.1|DR823095 ZM_BFb0064B16.r ZM_BFb Zea ma... 62 2e-07 gi|78087761|gb|DV516154.1|DV516154 ZM_BFb0199A16.r ZM_BFb Zea ma... 62 2e-07 gi|78093279|gb|DV521653.1|DV521653 ZM_BFb0207B02.r ZM_BFb Zea ma... 62 2e-07 gi|88746373|gb|DY530514.1|DY530514 ZM_BFb0248L02.r ZM_BFb Zea ma... 62 2e-07 gi|89247809|gb|DY619595.1|DY619595 ZM_BFb0277K17.r ZM_BFb Zea ma... 62 2e-07 gi|91868755|gb|EB400144.1|EB400144 ZM_BFb0304P23.r ZM_BFb Zea ma... 62 2e-07 gi|91872320|gb|EB402277.1|EB402277 ZM_BFb0308P13.r ZM_BFb Zea ma... 62 2e-07 gi|21210341|gb|AY107263.1| Zea mays PCO113331 mRNA sequence 62 2e-07 gi|21210341|gb|AY107263.1| Zea mays PCO113331 mRNA sequence 62 2e-07 gi|40334033|gb|CK368103.1|CK368103 zmrws055_0A11-004-d10.s0 zmrw... 60 6e-07 gi|89757575|gb|DY687119.1|DY687119 ZM_BFb0276I15.r ZM_BFb Zea ma... 60 6e-07 gi|3157223|gb|AA979845.1|AA979845 MEST2-C4.TW1412.Seq ISUM2 Zea ... 58 3e-06 gi|6536617|gb|AW224930.1|AW224930 687047H03.y1 687 - Early embry... 58 3e-06 gi|9953044|gb|BE639627.1|BE639627 946036F05.y1 946 - tassel prim... 58 3e-06 gi|13558921|gb|BG550276.1|BG550276 947039B09.y1 947 - 2 week sho... 58 3e-06 gi|22473234|gb|BU037714.1|BU037714 946141D04.y1 946 - tassel pri... 58 3e-06 gi|23357664|gb|BU645313.1|BU645313 946182F02.y1 946 - tassel pri... 58 3e-06 gi|29576784|gb|CB616896.1|CB616896 3529_1_66_1_C07.y_1 3529 - 2 ... 58 3e-06 gi|32851249|gb|CD990930.1|CD990930 QAZ2c06.yg QAZ Zea mays cDNA ... 58 3e-06 gi|37416590|gb|CF645947.1|CF645947 3530_1_104_1_B06.x_1 3530 - F... 58 3e-06 gi|50337394|gb|CO532520.1|CO532520 3530_1_214_1_A06.y_1 3530 - F... 58 3e-06 gi|67012428|gb|CO441177.1|CO441177 MZCCL10028B04.g Maize Endospe... 58 3e-06 gi|67026346|gb|CO455095.1|CO455095 MZCCL15008H12.g Maize Endospe... 58 3e-06 gi|71308215|gb|DR790339.1|DR790339 ZM_BFb0009E10.r ZM_BFb Zea ma... 58 3e-06 gi|71315569|gb|DR794389.1|DR794389 ZM_BFb0015B12.r ZM_BFb Zea ma... 58 3e-06 gi|71317839|gb|DR795686.1|DR795686 ZM_BFb0016P18.r ZM_BFb Zea ma... 58 3e-06 gi|71326450|gb|DR799905.1|DR799905 ZM_BFb0023A24.r ZM_BFb Zea ma... 58 3e-06 gi|71419155|gb|DR804670.1|DR804670 ZM_BFb0029N14.r ZM_BFb Zea ma... 58 3e-06 gi|71443099|gb|DR824149.1|DR824149 ZM_BFb0065N05.f ZM_BFb Zea ma... 58 3e-06 gi|76287178|gb|DV026746.1|DV026746 ZM_BFb0147O12.r ZM_BFb Zea ma... 58 3e-06 gi|76911849|gb|DV164464.1|DV164464 ZM_BFb0160O24.r ZM_BFb Zea ma... 58 3e-06 gi|78077303|gb|DV505737.1|DV505737 ZM_BFb0183C23.r ZM_BFb Zea ma... 58 3e-06 gi|78104874|gb|DV523292.1|DV523292 ZM_BFb0209H05.f ZM_BFb Zea ma... 58 3e-06 gi|78104875|gb|DV523293.1|DV523293 ZM_BFb0209H05.r ZM_BFb Zea ma... 58 3e-06 gi|6165717|gb|AF099390.1|AF099390 Zea mays clone ZmMYBIF28 R2R3M... 58 3e-06 gi|19548450|gb|AF470081.1| Zea mays P-type R2R3 Myb protein (Myb... 58 3e-06 gi|11526778|gb|AF210618.1|AF210619S2 Zea mays subsp. parviglumis... 58 3e-06 gi|6165717|gb|AF099390.1|AF099390 Zea mays clone ZmMYBIF28 R2R3M... 58 3e-06 gi|14242808|gb|BG840636.2|BG840636 MEST14-F12.T7-1 ISUM4-TN Zea ... 56 1e-05 gi|71426598|gb|DR807648.1|DR807648 ZM_BFb0034A09.r ZM_BFb Zea ma... 56 1e-05 gi|71436178|gb|DR817228.1|DR817228 ZM_BFb0050H17.r ZM_BFb Zea ma... 56 1e-05 gi|71439554|gb|DR820604.1|DR820604 ZM_BFb0059D04.r ZM_BFb Zea ma... 56 1e-05 gi|78112222|gb|DV530616.1|DV530616 ZM_BFb0220H11.r ZM_BFb Zea ma... 56 1e-05 gi|86472225|gb|DY238595.1|DY238595 ZM_BFb0256I14.r ZM_BFb Zea ma... 56 1e-05 gi|6165747|gb|AF099405.1|AF099405 Zea mays clone ZmMYBIM35 R2R3M... 56 1e-05 gi|19548446|gb|AF470079.1| Zea mays P-type R2R3 Myb protein (Myb... 56 1e-05 gi|6165747|gb|AF099405.1|AF099405 Zea mays clone ZmMYBIM35 R2R3M... 56 1e-05 gi|26457517|gb|CA829100.1|CA829100 1114037F02.y2 1114 - Unigene ... 54 4e-05 gi|71446732|gb|DR827782.1|DR827782 ZM_BFb0071E23.r ZM_BFb Zea ma... 54 4e-05 gi|86474950|gb|DY241320.1|DY241320 ZM_BFb0261K11.r ZM_BFb Zea ma... 54 4e-05 gi|91876184|gb|EB406141.1|EB406141 ZM_BFb0316K16.r ZM_BFb Zea ma... 54 4e-05 gi|72056898|emb|CS137824.1| Sequence 795 from Patent WO2005047516 54 4e-05 gi|31355532|gb|CD439889.1|CD439889 EL01N0530C06.b Endosperm_5 Ze... 52 2e-04 gi|47961873|gb|CN844582.1|CN844582 EST2532 Zea mays embryo sac c... 52 2e-04 gi|76011427|gb|DT938597.1|DT938597 ZM_BFb0120C04.r ZM_BFb Zea ma... 52 2e-04 gi|88752383|gb|DY536524.1|DY536524 ZM_BFb0269M10.r ZM_BFb Zea ma... 52 2e-04 gi|6165711|gb|AF099387.1|AF099387 Zea mays clone ZmMYBIF17 R2R3M... 52 2e-04 gi|6165711|gb|AF099387.1|AF099387 Zea mays clone ZmMYBIF17 R2R3M... 52 2e-04 gi|48717676|gb|AC148152.3| Zea mays clone ZMMBBc0388A01, *** SEQ... 52 2e-04 gi|14701061|gb|BI233479.1|BI233479 949010G07.y2 949 - Juvenile l... 50 6e-04 gi|18649480|gb|BM498299.1|BM498299 952021E05.x1 952 - BMS tissue... 50 6e-04 gi|18649955|gb|BM498774.1|BM498774 952021E05.y1 952 - BMS tissue... 50 6e-04 gi|18649992|gb|BM498811.1|BM498811 952022D04.y1 952 - BMS tissue... 50 6e-04 gi|18655287|gb|BM500092.1|BM500092 952036G01.x1 952 - BMS tissue... 50 6e-04 gi|19822559|gb|BQ048583.1|BQ048583 952022D04.y2 952 - BMS tissue... 50 6e-04 gi|19822638|gb|BQ048662.1|BQ048662 952023A08.x4 952 - BMS tissue... 50 6e-04 gi|19822639|gb|BQ048663.1|BQ048663 952023A08.y1 952 - BMS tissue... 50 6e-04 gi|22489734|gb|BU049657.1|BU049657 1111012C10.y1 1111 - Unigene ... 50 6e-04 gi|22490011|gb|BU049934.1|BU049934 1111017D04.y1 1111 - Unigene ... 50 6e-04 gi|37387123|gb|CF630754.1|CF630754 zmrws48_0A20-016-d02.s0 zmrws... 50 6e-04 gi|50322928|gb|CO518054.1|CO518054 3530_1_117_1_F09.y_1 3530 - F... 50 6e-04 gi|50333825|gb|CO528951.1|CO528951 3530_1_191_1_B11.y_1 3530 - F... 50 6e-04 gi|71319148|gb|DR796335.1|DR796335 ZM_BFb0017O13.r ZM_BFb Zea ma... 50 6e-04 gi|71329886|gb|DR801662.1|DR801662 ZM_BFb0025J10.r ZM_BFb Zea ma... 50 6e-04 gi|71766349|gb|DR964286.1|DR964286 ZM_BFb0083K12.r ZM_BFb Zea ma... 50 6e-04 gi|76011988|gb|DT939158.1|DT939158 ZM_BFb0120O20.r ZM_BFb Zea ma... 50 6e-04 gi|76919491|gb|DV167739.1|DV167739 ZM_BFb0166A10.r ZM_BFb Zea ma... 50 6e-04 gi|78104844|gb|DV523262.1|DV523262 ZM_BFb0209G13.f ZM_BFb Zea ma... 50 6e-04 gi|78106804|gb|DV525222.1|DV525222 ZM_BFb0212E24.r ZM_BFb Zea ma... 50 6e-04 gi|78114129|gb|DV532518.1|DV532518 ZM_BFb0223D21.f ZM_BFb Zea ma... 50 6e-04 gi|87151889|gb|DY396678.1|DY396678 III-952-5D-D03.M13-R UGIII-Re... 50 6e-04 gi|87153788|gb|DY398577.1|DY398577 III-952-3C-C10.M13-R UGIII-Re... 50 6e-04 gi|88748188|gb|DY532329.1|DY532329 ZM_BFb0251N11.r ZM_BFb Zea ma... 50 6e-04 gi|88750376|gb|DY534517.1|DY534517 ZM_BFb0265P21.r ZM_BFb Zea ma... 50 6e-04 gi|89106410|gb|DY576627.1|DY576627 III-952-5A-D04.M13-R UGIII-Re... 50 6e-04 gi|91877730|gb|EB407687.1|EB407687 ZM_BFb0320B07.r ZM_BFb Zea ma... 50 6e-04 gi|6165791|gb|AF099427.1|AF099427 Zea mays clone ZmMYBIP26 R2R3M... 50 6e-04 gi|21208354|gb|AY105276.1| Zea mays PCO109481 mRNA sequence 50 6e-04 gi|21208354|gb|AY105276.1| Zea mays PCO109481 mRNA sequence 50 6e-04 gi|6165791|gb|AF099427.1|AF099427 Zea mays clone ZmMYBIP26 R2R3M... 50 6e-04 gi|58082274|gb|AC155412.2| Zea mays strain B73 clone ZMMBBb0191E... 50 6e-04 gi|13249858|gb|BG360763.1|BG360763 947041F04.y2 947 - 2 week sho... 48 0.002 gi|18650284|gb|BM499103.1|BM499103 947041F04.y1 947 - 2 week sho... 48 0.002 gi|18660515|gb|BM500902.1|BM500902 PAC000000000774 Pioneer AF-1 ... 48 0.002 gi|31355148|gb|CD439505.1|CD439505 EL01N0525F10.b Endosperm_5 Ze... 48 0.002 gi|71330258|gb|DR801878.1|DR801878 ZM_BFb0025O10.r ZM_BFb Zea ma... 48 0.002 gi|76280357|gb|DV019925.1|DV019925 ZM_BFb0138A17.r ZM_BFb Zea ma... 48 0.002 gi|76289311|gb|DV028879.1|DV028879 ZM_BFb0151A24.r ZM_BFb Zea ma... 48 0.002 >gi|15590132|gb|BI674748.1|BI674748 949066G11.y2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 504 Score = 999 bits (504), Expect = 0.0 Identities = 504/504 (100%) Strand = Plus / Minus Query: 618 ttgaggtcggggcatctgggcgccttggcggccgtcgcctcggcttctgctgctgctgcg 677 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 504 ttgaggtcggggcatctgggcgccttggcggccgtcgcctcggcttctgctgctgctgcg 445 Query: 678 gcggcggcgctggggctgggctggaacgagacggtggtcacggtcacggcgtcggcggcg 737 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 444 gcggcggcgctggggctgggctggaacgagacggtggtcacggtcacggcgtcggcggcg 385 Query: 738 atggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtg 797 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 384 atggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtg 325 Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 324 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 265 Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 264 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 205 Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 204 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 145 Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 144 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 85 Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcc 1097 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 84 atgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcc 25 Query: 1098 ttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||||||||| Sbjct: 24 ttctcgcagcagggcgaccgcccc 1 >gi|72058683|emb|CS138038.1| Sequence 1009 from Patent WO2005047516 Length = 963 Score = 981 bits (495), Expect = 0.0 Identities = 528/539 (97%) Strand = Plus / Minus Query: 583 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 575 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 516 Query: 643 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 515 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 456 Query: 703 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 455 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 396 Query: 763 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 395 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 336 Query: 823 ccgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgca 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 335 ccgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgca 276 Query: 883 gcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccgga 942 |||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||| Sbjct: 275 gcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtccgggcgga 216 Query: 943 ggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgg 1002 ||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||| ||| Sbjct: 215 ggtagttgatccagcgcaggcggcagctcttgccgcagcgcagcaggcccgccgccctgg 156 Query: 1003 gcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcct 1062 ||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||| Sbjct: 155 gcagcgagcgccagcacccttcgccgtgcgcgcggacgtaggccaccagccgctcgtcct 96 Query: 1063 cctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 95 cctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcacggcgaccgcccc 37 Score = 733 bits (370), Expect = 0.0 Identities = 370/370 (100%) Strand = Plus / Minus Query: 195 cggaggaactaagctatccacgagccacgaatcctctcgccatcttggctctccttctca 254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 963 cggaggaactaagctatccacgagccacgaatcctctcgccatcttggctctccttctca 904 Query: 255 tcttccactatcctcctaccaggaactagctatccagatccatcaaggcgagaaccaacc 314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 903 tcttccactatcctcctaccaggaactagctatccagatccatcaaggcgagaaccaacc 844 Query: 315 aaaccgacgaaccagaagaatccgcccatctcgctgggcttcgttcacttcatcttgagg 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 843 aaaccgacgaaccagaagaatccgcccatctcgctgggcttcgttcacttcatcttgagg 784 Query: 375 cctctaaagtccagcatgccgcccctgagccccaagcagcggtggccgttgctgctgctg 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 783 cctctaaagtccagcatgccgcccctgagccccaagcagcggtggccgttgctgctgctg 724 Query: 435 cagctgcacccgggcgcgcccttctggacgcccaggctgcagccgaagcagagcgccccg 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 723 cagctgcacccgggcgcgcccttctggacgcccaggctgcagccgaagcagagcgccccg 664 Query: 495 ccgtggccgtggccgcggccgcccagcagaacctcccgcttgacgacggcggcggagggc 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 663 ccgtggccgtggccgcggccgcccagcagaacctcccgcttgacgacggcggcggagggc 604 Query: 555 ttgaggtcca 564 |||||||||| Sbjct: 603 ttgaggtcca 594 >gi|32168511|emb|AX756380.1| Sequence 1119 from Patent WO03000905 Length = 618 Score = 965 bits (487), Expect = 0.0 Identities = 528/539 (97%), Gaps = 2/539 (0%) Strand = Plus / Minus Query: 584 ctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcctt 643 |||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 540 ctgcgggcacggcgggatgatgcagaggtcggggttgaggtcggggcatctgg-cgcctt 482 Query: 644 -ggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 702 |||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 481 tggcggccgtcacctcggtttctgctgctgctgcggcggcgtcgctggggctgggctgga 422 Query: 703 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 362 Query: 763 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 302 Query: 823 ccgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgca 882 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 301 ccgtccgccccgggagccgcgcggcgatgagcggccacttgttcccgaggaggctgtgca 242 Query: 883 gcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccgga 942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 gcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccgga 182 Query: 943 ggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgg 1002 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgg 122 Query: 1003 gcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcct 1062 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gcagcgtccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcct 62 Query: 1063 cctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 61 cctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcggccgcccc 3 Score = 46.1 bits (23), Expect = 0.010 Identities = 29/31 (93%) Strand = Plus / Minus Query: 534 ttgacgacggcggcggagggcttgaggtcca 564 |||||||||||||||||||| | |||||||| Sbjct: 590 ttgacgacggcggcggagggttggaggtcca 560 >gi|45847961|gb|CN071904.1|CN071904 1021021G09.x1 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 604 Score = 769 bits (388), Expect = 0.0 Identities = 401/404 (99%), Gaps = 1/404 (0%) Strand = Plus / Plus Query: 161 acacaaaatggaagataagagagagcagggaggccggaggaactaagctatccacgagcc 220 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 160 acacaaaatggaagataagagagagcagggaggccggaggaacta-gctatccacgagcc 218 Query: 221 acgaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 280 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 219 aggaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 278 Query: 281 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 279 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 338 Query: 341 catctcgctgggcttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccct 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 339 catctcgctgggcttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccct 398 Query: 401 gagccccaagcagcggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctg 460 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 gagccccaagcagcggcggccgttgctgctgctgcagctgcacccgggcgcgcccttctg 458 Query: 461 gacgcccaggctgcagccgaagcagagcgccccgccgtggccgtggccgcggccgcccag 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 459 gacgcccaggctgcagccgaagcagagcgccccgccgtggccgtggccgcggccgcccag 518 Query: 521 cagaacctcccgcttgacgacggcggcggagggcttgaggtcca 564 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 519 cagaacctcccgcttgacgacggcggcggagggcttgaggtcca 562 Score = 264 bits (133), Expect = 2e-68 Identities = 133/133 (100%) Strand = Plus / Plus Query: 2 ttctccacaaacacagaggaaaacagaagttgatgaggttgacaatctacatgtgatacc 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ttctccacaaacacagaggaaaacagaagttgatgaggttgacaatctacatgtgatacc 60 Query: 62 tacctaccgactagtatagctagcatcagagttatacatgatcattttctaacattcagg 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tacctaccgactagtatagctagcatcagagttatacatgatcattttctaacattcagg 120 Query: 122 cacagccagggga 134 ||||||||||||| Sbjct: 121 cacagccagggga 133 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Plus Query: 583 gctgctggcacggcgggctgatgc 606 |||||||||||||||||||||||| Sbjct: 581 gctgctggcacggcgggctgatgc 604 >gi|78023078|gb|DV491465.1|DV491465 1000126-D05.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 492 Score = 769 bits (388), Expect = 0.0 Identities = 388/388 (100%) Strand = Plus / Plus Query: 177 aagagagagcagggaggccggaggaactaagctatccacgagccacgaatcctctcgcca 236 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aagagagagcagggaggccggaggaactaagctatccacgagccacgaatcctctcgcca 60 Query: 237 tcttggctctccttctcatcttccactatcctcctaccaggaactagctatccagatcca 296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tcttggctctccttctcatcttccactatcctcctaccaggaactagctatccagatcca 120 Query: 297 tcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcccatctcgctgggcttc 356 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcccatctcgctgggcttc 180 Query: 357 gttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcagcgg 416 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcagcgg 240 Query: 417 tggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctgcag 476 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 tggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctgcag 300 Query: 477 ccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgcttg 536 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 ccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgcttg 360 Query: 537 acgacggcggcggagggcttgaggtcca 564 |||||||||||||||||||||||||||| Sbjct: 361 acgacggcggcggagggcttgaggtcca 388 Score = 170 bits (86), Expect = 2e-40 Identities = 86/86 (100%) Strand = Plus / Plus Query: 583 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 407 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 466 Query: 643 tggcggccgtcgcctcggcttctgct 668 |||||||||||||||||||||||||| Sbjct: 467 tggcggccgtcgcctcggcttctgct 492 >gi|517492|emb|X78846.1|ZM38G1 Z.Mays Zm38 gene, intron 1 Length = 3045 Score = 759 bits (383), Expect = 0.0 Identities = 403/410 (98%), Gaps = 6/410 (1%) Strand = Plus / Minus Query: 161 acacaaaatggaagataagagagagcagggaggccggaggaactaagctatccacgagcc 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3021 acacaaaatggaagataagagagagcagggaggccggaggaactaagctatccacgagcc 2962 Query: 221 acgaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2961 acgaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 2902 Query: 281 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2901 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 2842 Query: 341 catctcgctgggcttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccct 400 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 2841 catctcgctgggcttcgttcatttcatcttgaggcctctaaagtccagcatgccgcccct 2782 Query: 401 gagccccaagcagcggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctg 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2781 gagccccaagcagcggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctg 2722 Query: 461 gacgcccaggctgcagccgaagcagagcgccccgccgtggc------cgtggccgcggcc 514 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 2721 gacgcccaggctgcagccgaagcagagcgccccgccgtggccgtggccgtggccgcggcc 2662 Query: 515 gcccagcagaacctcccgcttgacgacggcggcggagggcttgaggtcca 564 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2661 gcccagcagaacctcccgcttgacgacggcggcggagggcttgaggtcca 2612 Score = 551 bits (278), Expect = e-155 Identities = 278/278 (100%) Strand = Plus / Minus Query: 583 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2596 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 2537 Query: 643 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2536 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 2477 Query: 703 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2476 acgagacggtggtcacggtcacggcgtcggcggcgatggggcggtgcgtgacggggtcga 2417 Query: 763 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2416 tgcccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgt 2357 Query: 823 ccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||||||||||||| Sbjct: 2356 ccgtccgccccgggagccgcgcggcgatgagcgaccac 2319 Score = 505 bits (255), Expect = e-141 Identities = 261/263 (99%) Strand = Plus / Minus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2154 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 2095 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2094 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 2035 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 2034 accgcagcaggcccgccgccttgggtagcgaccgccagcacccttcgccgtgcgcgcgga 1975 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1098 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1974 tgtaggccacaaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1915 Query: 1099 tctcgcagcagggcgaccgcccc 1121 ||||||||||||||||||||||| Sbjct: 1914 tctcgcagcagggcgaccgcccc 1892 >gi|5499405|gb|AI855272.1|AI855272 603013E09.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 516 Score = 733 bits (370), Expect = 0.0 Identities = 370/370 (100%) Strand = Plus / Plus Query: 195 cggaggaactaagctatccacgagccacgaatcctctcgccatcttggctctccttctca 254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cggaggaactaagctatccacgagccacgaatcctctcgccatcttggctctccttctca 60 Query: 255 tcttccactatcctcctaccaggaactagctatccagatccatcaaggcgagaaccaacc 314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tcttccactatcctcctaccaggaactagctatccagatccatcaaggcgagaaccaacc 120 Query: 315 aaaccgacgaaccagaagaatccgcccatctcgctgggcttcgttcacttcatcttgagg 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 aaaccgacgaaccagaagaatccgcccatctcgctgggcttcgttcacttcatcttgagg 180 Query: 375 cctctaaagtccagcatgccgcccctgagccccaagcagcggtggccgttgctgctgctg 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 cctctaaagtccagcatgccgcccctgagccccaagcagcggtggccgttgctgctgctg 240 Query: 435 cagctgcacccgggcgcgcccttctggacgcccaggctgcagccgaagcagagcgccccg 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 cagctgcacccgggcgcgcccttctggacgcccaggctgcagccgaagcagagcgccccg 300 Query: 495 ccgtggccgtggccgcggccgcccagcagaacctcccgcttgacgacggcggcggagggc 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 ccgtggccgtggccgcggccgcccagcagaacctcccgcttgacgacggcggcggagggc 360 Query: 555 ttgaggtcca 564 |||||||||| Sbjct: 361 ttgaggtcca 370 Score = 254 bits (128), Expect = 2e-65 Identities = 128/128 (100%) Strand = Plus / Plus Query: 583 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 389 gctgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgcct 448 Query: 643 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 449 tggcggccgtcgcctcggcttctgctgctgctgcggcggcggcgctggggctgggctgga 508 Query: 703 acgagacg 710 |||||||| Sbjct: 509 acgagacg 516 >gi|89143148|emb|AM156908.1| Zea mays mRNA for transcription factor MYB42 (myb42 gene) Length = 1129 Score = 642 bits (324), Expect = 0.0 Identities = 416/447 (93%), Gaps = 6/447 (1%) Strand = Plus / Minus Query: 675 gcggcggcggcgctggggctgggctggaacgagacggtggtcacggtcacggcgtcggcg 734 |||||||||| | ||||||||||||||||||||| |||||| | ||||| | | Sbjct: 545 gcggcggcggagttggggctgggctggaacgagatggtggt------cgcggcgcccccc 492 Query: 735 gcgatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgc 794 |||| | ||||||||||||||||||||||||| |||||||||||||| ||||||| |||| Sbjct: 491 gcgacgcggcggtgcgtgacggggtcgatgccgctgcccagcagcttgcgccggatgtgc 432 Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 372 Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 312 Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974 |||||||| ||||| ||||| || ||||||||||||||||| ||||| |||||||||||| Sbjct: 311 aagttgcctcgcttgaggtccgggcggaggtagttgatccagcgcaggcggcagctcttg 252 Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034 ||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 251 ccgcagcgcagcaggcccgccgccctgggcagcgagcgccagcacccttcgccgtgcgcg 192 Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094 |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 cggacgtaggccaccagccgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 132 Query: 1095 gccttctcgcagcagggcgaccgcccc 1121 |||||||||||||| |||||||||||| Sbjct: 131 gccttctcgcagcacggcgaccgcccc 105 Score = 109 bits (55), Expect = 8e-22 Identities = 158/193 (81%), Gaps = 12/193 (6%) Strand = Plus / Minus Query: 354 ttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcag 413 |||||||||||||||| |||||||| ||||| |||| || | ||||||||||| | || Sbjct: 890 ttcgttcacttcatctccaggcctctgaagtcgagcacgctggtcctgagccccaggaag 831 Query: 414 cggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctg 473 ||||||||||||||| |||||||||||| ||| |||||||| ||||||||| | Sbjct: 830 tggtggccgttgctgc------agctgcacccggccgctcccttctgtccgcccaggccg 777 Query: 474 cagccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgc 533 ||||||| |||||| |||||||||||||||| ||||| || |||| |||||||| Sbjct: 776 cagccgaggcagag------gccgtggccgtggccgtggccggcctgcagcgcctcccgc 723 Query: 534 ttgacgacggcgg 546 ||||||| ||||| Sbjct: 722 ttgacgaaggcgg 710 Score = 109 bits (55), Expect = 8e-22 Identities = 64/67 (95%) Strand = Plus / Minus Query: 585 tgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgccttg 644 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 665 tgctggcacggcgggctgatgcagaggtccaggttgaggtcggggcacctgggcgccttg 606 Query: 645 gcggccg 651 |||||| Sbjct: 605 acggccg 599 Score = 48.1 bits (24), Expect = 0.002 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 662 ttctgctgctgctgcggcggcggc---gctggggctgggctggaacgagacggtggtc 716 |||||| || || ||||||||||| | ||||||||||||||||||||| ||||||| Sbjct: 561 ttctgcggcggcggcggcggcggcggagttggggctgggctggaacgagatggtggtc 504 >gi|89143148|emb|AM156908.1| Zea mays mRNA for transcription factor MYB42 (myb42 gene) Length = 1129 Score = 642 bits (324), Expect = 0.0 Identities = 416/447 (93%), Gaps = 6/447 (1%) Strand = Plus / Minus Query: 675 gcggcggcggcgctggggctgggctggaacgagacggtggtcacggtcacggcgtcggcg 734 |||||||||| | ||||||||||||||||||||| |||||| | ||||| | | Sbjct: 545 gcggcggcggagttggggctgggctggaacgagatggtggt------cgcggcgcccccc 492 Query: 735 gcgatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgc 794 |||| | ||||||||||||||||||||||||| |||||||||||||| ||||||| |||| Sbjct: 491 gcgacgcggcggtgcgtgacggggtcgatgccgctgcccagcagcttgcgccggatgtgc 432 Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 372 Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 312 Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974 |||||||| ||||| ||||| || ||||||||||||||||| ||||| |||||||||||| Sbjct: 311 aagttgcctcgcttgaggtccgggcggaggtagttgatccagcgcaggcggcagctcttg 252 Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034 ||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 251 ccgcagcgcagcaggcccgccgccctgggcagcgagcgccagcacccttcgccgtgcgcg 192 Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094 |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 cggacgtaggccaccagccgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 132 Query: 1095 gccttctcgcagcagggcgaccgcccc 1121 |||||||||||||| |||||||||||| Sbjct: 131 gccttctcgcagcacggcgaccgcccc 105 Score = 109 bits (55), Expect = 8e-22 Identities = 158/193 (81%), Gaps = 12/193 (6%) Strand = Plus / Minus Query: 354 ttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcag 413 |||||||||||||||| |||||||| ||||| |||| || | ||||||||||| | || Sbjct: 890 ttcgttcacttcatctccaggcctctgaagtcgagcacgctggtcctgagccccaggaag 831 Query: 414 cggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctg 473 ||||||||||||||| |||||||||||| ||| |||||||| ||||||||| | Sbjct: 830 tggtggccgttgctgc------agctgcacccggccgctcccttctgtccgcccaggccg 777 Query: 474 cagccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgc 533 ||||||| |||||| |||||||||||||||| ||||| || |||| |||||||| Sbjct: 776 cagccgaggcagag------gccgtggccgtggccgtggccggcctgcagcgcctcccgc 723 Query: 534 ttgacgacggcgg 546 ||||||| ||||| Sbjct: 722 ttgacgaaggcgg 710 Score = 109 bits (55), Expect = 8e-22 Identities = 64/67 (95%) Strand = Plus / Minus Query: 585 tgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgccttg 644 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 665 tgctggcacggcgggctgatgcagaggtccaggttgaggtcggggcacctgggcgccttg 606 Query: 645 gcggccg 651 |||||| Sbjct: 605 acggccg 599 Score = 48.1 bits (24), Expect = 0.002 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 662 ttctgctgctgctgcggcggcggc---gctggggctgggctggaacgagacggtggtc 716 |||||| || || ||||||||||| | ||||||||||||||||||||| ||||||| Sbjct: 561 ttctgcggcggcggcggcggcggcggagttggggctgggctggaacgagatggtggtc 504 >gi|21211622|gb|AY108544.1| Zea mays PCO117007 mRNA sequence Length = 410 Score = 609 bits (307), Expect = e-172 Identities = 358/374 (95%), Gaps = 1/374 (0%) Strand = Plus / Minus Query: 749 cgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagtagtt 808 |||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| Sbjct: 410 cgtgacggggtcgatgccgctgcccagcagcttgcgccggatgtgcgtgttccagtagtt 351 Query: 809 cttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgttccc 868 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 350 cttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgttccc 291 Query: 869 gaggaggctgtgcagcttgacgatgaggtcgtcctcgt-cggcggtgaagttgccgcgct 927 ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| Sbjct: 290 gaggaggctgtgcagcttgacgatgaggtcgtcntcgttcggcggtgaagttgccgcgct 231 Query: 928 tcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcagca 987 | ||||| || ||||||||||||||||| ||||| ||||||||||||||||| ||||||| Sbjct: 230 tgaggtccgggcggaggtagttgatccagcgcaggcggcagctcttgccgcagcgcagca 171 Query: 988 ggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggcca 1047 ||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| Sbjct: 170 ggcccgccgccctgggcagcgagcgccagcacccttcgccgtgcgcgcggacgtaggcca 111 Query: 1048 ccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagc 1107 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 110 ccagccgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagc 51 Query: 1108 agggcgaccgcccc 1121 | |||||||||||| Sbjct: 50 acggcgaccgcccc 37 >gi|21211622|gb|AY108544.1| Zea mays PCO117007 mRNA sequence Length = 410 Score = 609 bits (307), Expect = e-172 Identities = 358/374 (95%), Gaps = 1/374 (0%) Strand = Plus / Minus Query: 749 cgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagtagtt 808 |||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| Sbjct: 410 cgtgacggggtcgatgccgctgcccagcagcttgcgccggatgtgcgtgttccagtagtt 351 Query: 809 cttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgttccc 868 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 350 cttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgttccc 291 Query: 869 gaggaggctgtgcagcttgacgatgaggtcgtcctcgt-cggcggtgaagttgccgcgct 927 ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| Sbjct: 290 gaggaggctgtgcagcttgacgatgaggtcgtcntcgttcggcggtgaagttgccgcgct 231 Query: 928 tcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcagca 987 | ||||| || ||||||||||||||||| ||||| ||||||||||||||||| ||||||| Sbjct: 230 tgaggtccgggcggaggtagttgatccagcgcaggcggcagctcttgccgcagcgcagca 171 Query: 988 ggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggcca 1047 ||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| Sbjct: 170 ggcccgccgccctgggcagcgagcgccagcacccttcgccgtgcgcgcggacgtaggcca 111 Query: 1048 ccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagc 1107 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 110 ccagccgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagc 51 Query: 1108 agggcgaccgcccc 1121 | |||||||||||| Sbjct: 50 acggcgaccgcccc 37 >gi|19072741|gb|AF474119.1| Zea mays typical P-type R2R3 Myb protein (Myb26) gene, partial cds Length = 605 Score = 513 bits (259), Expect = e-143 Identities = 262/263 (99%) Strand = Plus / Minus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 303 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 244 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 243 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 184 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 124 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1098 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 64 Query: 1099 tctcgcagcagggcgaccgcccc 1121 | ||||||||||||||||||||| Sbjct: 63 tttcgcagcagggcgaccgcccc 41 Score = 196 bits (99), Expect = 4e-48 Identities = 118/123 (95%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 739 tggggcggtgcgtgacggggtcgatgcccctgccca-gcagcttccgccggacgtgcgtg 797 |||| |||||||| ||||||| ||||||||||||| ||||||||||||||||||||||| Sbjct: 605 tgggccggtgcgtaacggggtaaatgcccctgcccaagcagcttccgccggacgtgcgtg 546 Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 545 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 486 Query: 858 cac 860 ||| Sbjct: 485 cac 483 >gi|78082647|gb|DV511054.1|DV511054 ZM_BFb0191A18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 578 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 525 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 466 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 465 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 406 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 405 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 346 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 345 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 286 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 285 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 226 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 225 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 166 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 165 tcgcagcacggcgacctcccc 145 >gi|93015011|gb|EB640531.1|EB640531 ZM_BFb0329H19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 813 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 512 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 453 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 452 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 393 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 392 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 333 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 332 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 273 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 272 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 213 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 212 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 153 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 152 tcgcagcacggcgacctcccc 132 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 771 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 727 >gi|21211358|gb|AY108280.1| Zea mays PCO132931 mRNA sequence Length = 1372 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 521 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 462 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 461 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 402 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 401 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 342 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 341 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 282 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 281 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 222 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 221 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 162 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 161 tcgcagcacggcgacctcccc 141 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 780 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 736 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 866 cccaggctgcagccgaagcagagc 843 >gi|89143144|emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (myb31 gene) Length = 1264 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 523 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 464 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 463 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 404 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 403 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcttcctccgtgaagttg 344 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 343 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 284 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 283 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 224 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 223 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 164 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 163 tcgcagcacggcgacctcccc 143 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 788 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 744 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 874 cccaggctgcagccgaagcagagc 851 >gi|72058682|emb|CS138036.1| Sequence 1007 from Patent WO2005047516 Length = 1420 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 645 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 586 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 585 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 526 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 525 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 466 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 465 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 406 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 405 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 346 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 345 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 286 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 285 tcgcagcacggcgacctcccc 265 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 907 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 863 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 996 cccaggctgcagccgaagcagagc 973 >gi|72058681|emb|CS138034.1| Sequence 1005 from Patent WO2005047516 Length = 1372 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 521 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 462 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 461 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 402 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 401 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 342 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 341 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 282 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 281 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 222 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 221 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 162 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 161 tcgcagcacggcgacctcccc 141 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 780 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 736 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 866 cccaggctgcagccgaagcagagc 843 >gi|21211358|gb|AY108280.1| Zea mays PCO132931 mRNA sequence Length = 1372 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 521 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 462 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 461 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 402 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 401 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 342 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 341 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 282 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 281 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 222 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 221 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 162 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 161 tcgcagcacggcgacctcccc 141 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 780 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 736 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 866 cccaggctgcagccgaagcagagc 843 >gi|89143144|emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (myb31 gene) Length = 1264 Score = 430 bits (217), Expect = e-118 Identities = 340/381 (89%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 523 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 464 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 463 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 404 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 403 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcttcctccgtgaagttg 344 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 343 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 284 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| ||||||||||| | |||| Sbjct: 283 cgcaggaggccggcggccttgggcagcgagcgccagcacccctcgccgtgcgccctgatg 224 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 223 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttc 164 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| ||||||| |||| Sbjct: 163 tcgcagcacggcgacctcccc 143 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 788 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 744 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 874 cccaggctgcagccgaagcagagc 851 >gi|37391154|gb|CF632818.1|CF632818 zmrws48_0B20-008-d04.s0 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 661 Score = 410 bits (207), Expect = e-112 Identities = 300/331 (90%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 282 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 341 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 342 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 401 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 402 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 461 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 462 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 521 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 522 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 581 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 582 gtgcgccttctcgcagcacggcgacctcccc 612 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 25 aggtcgaggttgaggtcggggca 47 >gi|37394042|gb|CF634290.1|CF634290 zmrww00_0A10-010-e06.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 659 Score = 410 bits (207), Expect = e-112 Identities = 300/331 (90%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 282 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 341 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 342 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 401 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 402 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 461 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 462 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 521 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 522 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 581 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 582 gtgcgccttctcgcagcacggcgacctcccc 612 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 25 aggtcgaggttgaggtcggggca 47 >gi|40333880|gb|CK367950.1|CK367950 zmrws055_0A10-002-b02.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 556 Score = 410 bits (207), Expect = e-112 Identities = 300/331 (90%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 373 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 314 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 313 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 254 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 253 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 194 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 193 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 134 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 133 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 74 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 73 gtgcgccttctcgcagcacggcgacctcccc 43 >gi|40333882|gb|CK367952.1|CK367952 zmrws055_0A10-002-c02.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 525 Score = 410 bits (207), Expect = e-112 Identities = 300/331 (90%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 373 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 314 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 313 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 254 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 253 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 194 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 193 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 134 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 133 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 74 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 73 gtgcgccttctcgcagcacggcgacctcccc 43 >gi|40337372|gb|CK371442.1|CK371442 zmrww005_0B20-004-b04.s0 zmrww005 Zea mays cDNA 5', mRNA sequence Length = 634 Score = 410 bits (207), Expect = e-112 Identities = 300/331 (90%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 362 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 303 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 302 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 243 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 242 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 183 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 182 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 123 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 122 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 63 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 62 gtgcgccttctcgcagcacggcgacctcccc 32 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Minus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 619 aggtcgaggttgaggtcggggca 597 >gi|37375697|gb|CF624303.1|CF624303 zmrws05_0A11-002-c02.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 647 Score = 404 bits (204), Expect = e-111 Identities = 294/324 (90%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 282 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 341 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||| ||||||||||| || |||||||||||||| || |||||| |||||||||||| | Sbjct: 342 gagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtc 401 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || ||||||||||| ||||| ||||||| |||||| Sbjct: 402 ggtgaagttgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagct 461 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||||||||||||||||||||||||||| || ||||| Sbjct: 462 cttgccgcagcgcagcagccccgccgccttgggcagcgaccgccagcacccctccccgtg 521 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| |||| ||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 522 cgcccggacgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 581 Query: 1091 gtgcgccttctcgcagcagggcga 1114 |||||||||||||||||| ||||| Sbjct: 582 gtgcgccttctcgcagcacggcga 605 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 25 aggtcgaggttgaggtcggggca 47 >gi|86467383|gb|DY233753.1|DY233753 ZM_BFb0243I08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 749 Score = 391 bits (197), Expect = e-106 Identities = 335/381 (87%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 530 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 471 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 470 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 411 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| || ||||| || | ||||||||| Sbjct: 410 ttgttgccgaggacgctgtgcagcttgacgatgagctcttcctcctcctccgtgaagttg 351 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 350 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 291 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| || |||||||| | |||| Sbjct: 290 cgcaggaggccggcggccttgggcagcgagcgccagcacccctctccgtgcgccctgatg 231 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || ||||||||||| |||||||||||||||| |||||||||||||||||||||||| Sbjct: 230 tgcgcgaccaggcgctcttcctcctccttggtccccgcgcccctgttggtgtgcgccttt 171 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| || |||| |||| Sbjct: 170 tcgcagcacggggacctcccc 150 >gi|86469336|gb|DY235706.1|DY235706 ZM_BFb0246J11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 764 Score = 391 bits (197), Expect = e-106 Identities = 335/381 (87%) Strand = Plus / Minus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| | |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 527 gggcggtgcgtctccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 468 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||| ||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 467 cagtagtttttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 408 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttg 920 ||||| ||||||| ||||||||||||||||||||| |||||||| || | ||||||||| Sbjct: 407 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctccgtgaagttg 348 Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 347 ccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcag 288 Query: 981 cgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcggatg 1040 ||||| ||||| || |||||||||||||| ||||||||||| || |||||||| | |||| Sbjct: 287 cgcaggaggccggcggccttgggcagcgagcgccagcacccctctccgtgcgccctgatg 228 Query: 1041 taggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttc 1100 | || |||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 227 tgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgccttt 168 Query: 1101 tcgcagcagggcgaccgcccc 1121 |||||||| || |||| |||| Sbjct: 167 tcgcagcacggggacctcccc 147 >gi|15215478|gb|BI431295.1|BI431295 949066G11.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 356 Score = 375 bits (189), Expect = e-102 Identities = 196/197 (99%), Gaps = 1/197 (0%) Strand = Plus / Plus Query: 161 acacaaaatggaagataagagagagcagggaggccggaggaactaagctatccacgagcc 220 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 161 acacaaaatggaagataagagagagcagggaggccggaggaacta-gctatccacgagcc 219 Query: 221 acgaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220 acgaatcctctcgccatcttggctctccttctcatcttccactatcctcctaccaggaac 279 Query: 281 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 280 tagctatccagatccatcaaggcgagaaccaaccaaaccgacgaaccagaagaatccgcc 339 Query: 341 catctcgctgggcttcg 357 ||||||||||||||||| Sbjct: 340 catctcgctgggcttcg 356 Score = 266 bits (134), Expect = 6e-69 Identities = 134/134 (100%) Strand = Plus / Plus Query: 1 cttctccacaaacacagaggaaaacagaagttgatgaggttgacaatctacatgtgatac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cttctccacaaacacagaggaaaacagaagttgatgaggttgacaatctacatgtgatac 60 Query: 61 ctacctaccgactagtatagctagcatcagagttatacatgatcattttctaacattcag 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ctacctaccgactagtatagctagcatcagagttatacatgatcattttctaacattcag 120 Query: 121 gcacagccagggga 134 |||||||||||||| Sbjct: 121 gcacagccagggga 134 >gi|21215256|gb|AY110666.1| Zea mays CL332_1 mRNA sequence Length = 927 Score = 369 bits (186), Expect = e-100 Identities = 334/385 (86%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||| ||||||||||||||||| |||||| Sbjct: 461 gatggggcggtgtgtcaccgggtcgatnnnnntgctcagcagcttccgccggatgtgcgt 402 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 |||||||||||||||||||||||||||||||| ||||| |||| ||||||| || || Sbjct: 401 gttccagtagttcttgatctcgttgtccgtcctgcccggcagccttccggcgatcaggga 342 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||||||||| |||||||||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 341 ccacttgttgccgaggaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 282 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| |||||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 281 gttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagctcttgcc 222 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 221 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 162 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||| Sbjct: 161 gatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgc 102 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 101 cttctcgcagcacggcgacctcccc 77 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 569 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 525 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 643 cccaggctgcagctgaagcagagc 620 >gi|21215256|gb|AY110666.1| Zea mays CL332_1 mRNA sequence Length = 927 Score = 369 bits (186), Expect = e-100 Identities = 334/385 (86%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||| ||||||||||||||||| |||||| Sbjct: 461 gatggggcggtgtgtcaccgggtcgatnnnnntgctcagcagcttccgccggatgtgcgt 402 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 |||||||||||||||||||||||||||||||| ||||| |||| ||||||| || || Sbjct: 401 gttccagtagttcttgatctcgttgtccgtcctgcccggcagccttccggcgatcaggga 342 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||||||||| |||||||||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 341 ccacttgttgccgaggaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 282 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| |||||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 281 gttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagctcttgcc 222 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 221 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 162 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||| Sbjct: 161 gatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgc 102 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 101 cttctcgcagcacggcgacctcccc 77 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 569 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 525 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 643 cccaggctgcagctgaagcagagc 620 >gi|72058680|emb|CS138032.1| Sequence 1003 from Patent WO2005047516 Length = 920 Score = 367 bits (185), Expect = 2e-99 Identities = 335/385 (87%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 461 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 402 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 401 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 342 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 341 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 282 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 281 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgcc 222 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 221 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 162 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||| Sbjct: 161 gatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgc 102 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 101 cttctcgcagcacggcgacctcccc 77 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 569 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 525 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 643 cccaggctgcagctgaagcagagc 620 >gi|8368245|gb|BE051190.1|BE051190 za73c10.b50 Maize Glume cDNAs Library Zea mays cDNA clone za73c10 5', mRNA sequence Length = 503 Score = 363 bits (183), Expect = 3e-98 Identities = 294/331 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||||||||||||||||||||||||||||||||| || || |||| ||||||| Sbjct: 500 gtgcgtgttccagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgat 441 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 || ||||||||||| ||||||| ||||||||||||||||||||| |||||||| || | Sbjct: 440 cagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctcctcctc 381 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 ||||||||||||||||| |||||||| ||||||||||||||||| || || |||||||| Sbjct: 380 cgtgaagttgccgcgcttgaggtcggggcggaggtagttgatccagcggaggcggcagct 321 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| ||||| ||||| ||||||||||||||||| ||||||||||| |||||||| Sbjct: 320 cttgccgcagcgcaggaggccggccgccttgggcagcgagcgccagcacccctcgccgtg 261 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 ||| | ||||| || |||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 260 cgccctgatgtgcgcgaccaggcgctcgtcctcctccttggtccacgcgcccttgttggt 201 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||| || ||||||||| ||||||| |||| Sbjct: 200 gtgccccccctcgcagcacggcgacctcccc 170 >gi|67025824|gb|CO454573.1|CO454573 MZCCL10206G12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 914 Score = 355 bits (179), Expect = 8e-96 Identities = 272/303 (89%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 429 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 370 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 || ||||||||||| ||||||||| |||||| || |||||| |||||||||||| | Sbjct: 369 cagagaccacttgttgccgaggagggcgtgcaggcggatgatgagctcgtcctcgtcgtc 310 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 ||||||||| |||||||| ||||| |||||||||||||| ||||||||||||| |||||| Sbjct: 309 ggtgaagttcccgcgcttgaggtccggccggaggtagttcatccaccgcagcctgcagct 250 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||| |||||||| ||||||||||||| ||||||||||| ||||| Sbjct: 249 cttgccgcagcgcagcagacccgccgcgctgggcagcgaccgacagcacccttccccgtg 190 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || |||||||| |||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 189 cgaccggatgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggt 130 Query: 1091 gtg 1093 ||| Sbjct: 129 gtg 127 >gi|19436258|gb|BM952668.1|BM952668 952057B01.y1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 575 Score = 353 bits (178), Expect = 3e-95 Identities = 330/380 (86%), Gaps = 3/380 (0%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 391 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 332 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 331 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 272 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | |||| Sbjct: 271 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctccg---tgaa 215 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 214 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgcc 155 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 154 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 95 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||| Sbjct: 94 gatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgc 35 Query: 1097 cttctcgcagcagggcgacc 1116 |||||||||||| ||||||| Sbjct: 34 cttctcgcagcacggcgacc 15 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 499 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 455 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 573 cccaggctgcagctgaagcagagc 550 >gi|89143142|emb|AM156905.1| Zea mays mRNA for transcription factor MYB8 (myb8 gene) Length = 1082 Score = 347 bits (175), Expect = 2e-93 Identities = 292/331 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 517 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 458 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 |||||||||||||| ||||||| ||| ||||||| ||||| ||||||||| || Sbjct: 457 cagcgaccacttgtttccgaggacctggtggagcttgatgatgacgtcgtcctcctcctg 398 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| |||||||| || ||||||||||||||||| || |||||||| Sbjct: 397 ggtgaagttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagct 338 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||||||||| |||||||| ||||||| |||||| ||||||||||| Sbjct: 337 cttgccgcagcgcagcaggcccgcggccttggggagcgacctccagcagccttcgccgtg 278 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || ||||||||| || || |||| |||||||||||||||||| |||||| |||| || Sbjct: 277 ggccttgatgtaggcgacgagccgctggtcctcctccttggtccaggcgcccttgttcgt 218 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 217 gtgcgccttctcgcagcacggcgacctcccc 187 >gi|89143142|emb|AM156905.1| Zea mays mRNA for transcription factor MYB8 (myb8 gene) Length = 1082 Score = 347 bits (175), Expect = 2e-93 Identities = 292/331 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 517 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 458 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 |||||||||||||| ||||||| ||| ||||||| ||||| ||||||||| || Sbjct: 457 cagcgaccacttgtttccgaggacctggtggagcttgatgatgacgtcgtcctcctcctg 398 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| |||||||| || ||||||||||||||||| || |||||||| Sbjct: 397 ggtgaagttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagct 338 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||||||||| |||||||| ||||||| |||||| ||||||||||| Sbjct: 337 cttgccgcagcgcagcaggcccgcggccttggggagcgacctccagcagccttcgccgtg 278 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || ||||||||| || || |||| |||||||||||||||||| |||||| |||| || Sbjct: 277 ggccttgatgtaggcgacgagccgctggtcctcctccttggtccaggcgcccttgttcgt 218 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||| ||||||| |||| Sbjct: 217 gtgcgccttctcgcagcacggcgacctcccc 187 >gi|29162630|emb|AX660866.1| Sequence 1223 from Patent WO03000906 Length = 597 Score = 337 bits (170), Expect = 2e-90 Identities = 281/318 (88%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 232 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 291 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 |||||||||||||| ||||||| ||| ||||||| ||||| ||||||||| || Sbjct: 292 cagcgaccacttgtttccgaggacctggtggagcttgatgatgacgtcgtcctcctcctg 351 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| |||||||| || ||||||||||||||||| || |||||||| Sbjct: 352 ggtgaagttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagct 411 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||||||||| |||||||||||||| |||||||| ||||||| |||||| ||||||||||| Sbjct: 412 cttgccgcaacgcagcaggcccgcggccttggggagcgacctccagcagccttcgccgtg 471 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || ||||||||| || || |||| |||||||||||||||||| |||||| |||| || Sbjct: 472 ggccttgatgtaggcgacgagccgctggtcctcctccttggtccaggcgcccttgttcgt 531 Query: 1091 gtgcgccttctcgcagca 1108 |||||||||||||||||| Sbjct: 532 gtgcgccttctcgcagca 549 >gi|22490989|gb|BU050912.1|BU050912 1111036A01.y1 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 474 Score = 319 bits (161), Expect = 4e-85 Identities = 320/372 (86%), Gaps = 2/372 (0%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 371 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 312 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| ||| | ||||| || || Sbjct: 311 gttccagtagttcttgatctcgttgtcggtcctgcccggcagcgttccagcgatcaggga 252 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||| | || | ||||| Sbjct: 251 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtaca--tcctccgtgaa 194 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 193 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgcc 134 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 133 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 74 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||| Sbjct: 73 gatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgc 14 Query: 1097 cttctcgcagca 1108 |||||||||||| Sbjct: 13 cttctcgcagca 2 Score = 63.9 bits (32), Expect = 4e-08 Identities = 38/40 (95%) Strand = Plus / Minus Query: 592 acggcgggctgatgcagaggtcgaggttgaggtcggggca 631 |||||||||||||||||||||| ||||| ||||||||||| Sbjct: 474 acggcgggctgatgcagaggtccaggttcaggtcggggca 435 >gi|71426087|gb|DR807137.1|DR807137 ZM_BFb0033F03.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 857 Score = 319 bits (161), Expect = 4e-85 Identities = 330/385 (85%), Gaps = 1/385 (0%) Strand = Plus / Plus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 458 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 517 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 518 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 577 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 578 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 637 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 638 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgcc 697 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||| || || || |||||||| || || ||||||||||| ||||||||||| Sbjct: 698 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgccgtgcgcctt 757 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || ||||||| ||||||||| ||||||||| || | |||||| Sbjct: 758 gatgtacgccaccagacggtcgtccttctccttggt-cacgcgcccttggttcggtgcgc 816 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 817 cttctcgcagcacggcgacctcccc 841 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 350 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 394 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 276 cccaggctgcagctgaagcagagc 299 >gi|71764666|gb|DR962603.1|DR962603 ZM_BFb0081D04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 840 Score = 315 bits (159), Expect = 7e-84 Identities = 237/263 (90%) Strand = Plus / Minus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| || |||||||||||||| || |||||| |||||||||||| ||||||||| Sbjct: 315 acttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 256 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 |||||||||| ||||| || ||||||||||| ||||| ||||||| |||||||||||||| Sbjct: 255 tgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagctcttgccgc 196 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 | |||||||| |||||||||||||||||||| ||||||||||| || |||||||| |||| Sbjct: 195 agcgcagcagccccgccgccttgggcagcgagcgccagcacccctccccgtgcgcccgga 136 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1098 ||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 135 cgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggtgtgcgcct 76 Query: 1099 tctcgcagcagggcgaccgcccc 1121 |||||||||| ||||||| |||| Sbjct: 75 tctcgcagcacggcgacctcccc 53 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 564 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 505 Query: 851 gagcgaccac 860 ||| |||||| Sbjct: 504 gagggaccac 495 >gi|76016982|gb|DT944152.1|DT944152 ZM_BFb0130K10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 874 Score = 307 bits (155), Expect = 2e-81 Identities = 236/263 (89%) Strand = Plus / Minus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| ||||||||| |||||| || |||||| |||||||||||| ||||||||| Sbjct: 296 acttgttgccgaggagggcgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 237 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 | |||||||| ||||| |||||||||||||| ||||||||||||| |||||||||||||| Sbjct: 236 tcccgcgcttgaggtccggccggaggtagttcatccaccgcagcctgcagctcttgccgc 177 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 | |||||||| |||||||| ||||||||||||||||||||||||| ||||||| |||| Sbjct: 176 agcgcagcagacccgccgcgctgggcagcgaccgccagcacccttccccgtgcgaccgga 117 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1098 |||| |||||||| |||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 116 tgtacgccaccagccgctcgtcctcctccttggtccacgcgcccttgttggtgtgcccct 57 Query: 1099 tctcgcagcagggcgaccgcccc 1121 |||||||||| ||||||| |||| Sbjct: 56 tctcgcagcacggcgacctcccc 34 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 469 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 410 Query: 851 gagcgaccac 860 || |||||| Sbjct: 409 cagagaccac 400 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Minus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 690 aggtcgaggttgaggtcggggca 668 >gi|76019366|gb|DT946536.1|DT946536 ZM_BFb0134E16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 808 Score = 299 bits (151), Expect = 4e-79 Identities = 286/331 (86%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||||||||||||||||||||||||||||||||| ||||| |||| | ||||||| Sbjct: 618 gtgcgtgttccagtagttcttgatctcgttgtccgtcctgcccggcagcctcccggcgat 559 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||||||||||||||| |||| ||| ||| | ||||| ||||||||| ||||| || | Sbjct: 558 gagcgaccacttgttgccgaagagctcgtggaacttgatgatgaggtcatcctcctcctc 499 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 498 ggtgaagttgccgcgcttgaggtccgggcgcaggtagttgatccaccgcagccggcagct 439 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||| ||||| |||||||| || || || || || ||||| | |||||| || |||||||| Sbjct: 438 cttcccgcagcgcagcagacctgcggcttttggtagcgatctccagcagccctcgccgtg 379 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || ||||||||| || ||||||| ||||||||||||||||||||||||| ||||||| Sbjct: 378 ggccttgatgtaggcgacgaggcgctggtcctcctccttggtccacgcgcccttgttggt 319 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||| ||||||||| || |||| |||| Sbjct: 318 gtgcgcctgctcgcagcacggggacctcccc 288 >gi|76292738|gb|DV032306.1|DV032306 ZM_BFb0156A17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 840 Score = 299 bits (151), Expect = 4e-79 Identities = 286/331 (86%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||||||||||||||||||||||||||||||||| ||||| |||| | ||||||| Sbjct: 499 gtgcgtgttccagtagttcttgatctcgttgtccgtcctgcccggcagcctcccggcgat 440 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||||||||||||||| |||| ||| ||| | ||||| ||||||||| ||||| || | Sbjct: 439 gagcgaccacttgttgccgaagagctcgtggaacttgatgatgaggtcatcctcctcctc 380 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 379 ggtgaagttgccgcgcttgaggtccgggcgcaggtagttgatccaccgcagccggcagct 320 Query: 971 cttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030 ||| ||||| |||||||| || || || || || ||||| | |||||| || |||||||| Sbjct: 319 cttcccgcagcgcagcagacctgcggcttttggtagcgatctccagcagccctcgccgtg 260 Query: 1031 cgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggt 1090 || ||||||||| || ||||||| ||||||||||||||||||||||||| ||||||| Sbjct: 259 ggccttgatgtaggcgacgaggcgctggtcctcctccttggtccacgcgcccttgttggt 200 Query: 1091 gtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||| ||||||||| || |||| |||| Sbjct: 199 gtgcgcctgctcgcagcacggggacctcccc 169 >gi|71314779|gb|DR794011.1|DR794011 ZM_BFb0014I17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 619 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 547 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 488 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 487 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 428 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 427 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 368 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 367 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 308 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 307 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 248 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 247 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 200 >gi|71421428|gb|DR805425.1|DR805425 ZM_BFb0030O18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 781 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 552 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 493 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 492 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 433 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 432 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 373 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 372 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 313 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 312 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 253 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 252 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 205 >gi|71437959|gb|DR819009.1|DR819009 ZM_BFb0054M14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 745 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 531 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 472 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 471 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 412 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 411 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 352 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 351 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 292 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 291 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 232 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 231 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 184 >gi|71442129|gb|DR823179.1|DR823179 ZM_BFb0064D12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 734 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 531 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 472 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 471 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 412 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 411 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 352 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 351 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 292 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 291 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 232 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 231 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 184 >gi|76012828|gb|DT939998.1|DT939998 ZM_BFb0122J19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 849 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 531 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 472 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 471 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 412 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 411 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 352 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 351 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 292 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 291 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 232 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 231 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 184 >gi|76285950|gb|DV025518.1|DV025518 ZM_BFb0146C14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 831 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 526 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 467 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 466 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 407 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 406 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 347 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 346 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 287 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 286 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 227 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 226 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 179 >gi|78085421|gb|DV513814.1|DV513814 ZM_BFb0195E09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 697 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 551 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 492 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 491 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 432 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 431 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 372 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 371 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 312 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 311 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 252 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 251 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 204 >gi|89759022|gb|DY687978.1|DY687978 ZM_BFb0280M24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 761 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 531 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 472 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 471 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 412 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 411 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 352 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 351 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 292 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 291 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 232 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 231 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 184 >gi|91055532|gb|EB165950.1|EB165950 ZM_BFb0345A20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 812 Score = 278 bits (140), Expect = 1e-72 Identities = 296/348 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 559 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 500 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 499 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 440 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 439 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 380 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 379 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 320 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 319 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 260 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 259 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 212 >gi|50329655|gb|CO524781.1|CO524781 3530_1_164_1_B07.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 693 Score = 270 bits (136), Expect = 4e-70 Identities = 295/348 (84%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 568 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 509 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | ||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 508 ggcagcctcccggcgatgagcgaccacttgtagccgaacagctcgtggaacttgatgatc 449 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 448 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 389 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 388 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 329 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 328 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 269 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 268 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 221 >gi|71333196|gb|DR803641.1|DR803641 ZM_BFb0028G03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 798 Score = 270 bits (136), Expect = 4e-70 Identities = 295/348 (84%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 529 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 470 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 469 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 410 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 409 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 350 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 349 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 290 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||| | || ||||||||| | ||||||| |||||||||||||||| Sbjct: 289 cagcagccctcgccgcgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 230 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 229 cacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 182 >gi|29946941|gb|CB816401.1|CB816401 3529_1_77_1_G12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 565 Score = 268 bits (135), Expect = 1e-69 Identities = 285/335 (85%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 375 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 316 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 315 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 256 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 255 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 196 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 ||||||||||||||| |||| |||||||||||||| || || || || || ||||||| | Sbjct: 195 caccgcagccggcagttcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 136 Query: 1014 cagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtc 1073 ||||| || |||||||| || ||||||||| | ||||||| |||||||||||||||| Sbjct: 135 cagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctccttggtc 76 Query: 1074 cacgcgcccctgttggtgtgcgccttctcgcagca 1108 ||||||||| ||||||||||||||| ||||||||| Sbjct: 75 cacgcgcccttgttggtgtgcgcctgctcgcagca 41 >gi|37361308|gb|CF602597.1|CF602597 EST3670 Zea mays sperm cell cDNA library Zea mays cDNA clone Zmsp8908 5', mRNA sequence Length = 673 Score = 268 bits (135), Expect = 1e-69 Identities = 231/263 (87%) Strand = Plus / Plus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||||| Sbjct: 183 acttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaagt 242 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 |||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||| Sbjct: 243 tgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgccgc 302 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 | |||| || || || |||||||| || || ||||||||||||||||||||||| || Sbjct: 303 agcgcacaagtccggcggccttgggaagggagcgccagcacccttcgccgtgcgccttga 362 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgcct 1098 |||| |||||||| || ||||||||||||||||||||||||||| |||| |||||||||| Sbjct: 363 tgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtgtgcgcct 422 Query: 1099 tctcgcagcagggcgaccgcccc 1121 |||||||||| ||||||| |||| Sbjct: 423 tctcgcagcacggcgacctcccc 445 Score = 103 bits (52), Expect = 5e-20 Identities = 61/64 (95%) Strand = Plus / Plus Query: 765 cccctgcccagcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtcc 824 ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1 cccctgctcagcagcttccgccggatgtgcgtgttccagtagttcttgatctcgttgtcg 60 Query: 825 gtcc 828 |||| Sbjct: 61 gtcc 64 >gi|71445118|gb|DR826168.1|DR826168 ZM_BFb0068N05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 871 Score = 262 bits (132), Expect = 9e-68 Identities = 240/276 (86%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 ||||| || ||||| |||| |||||| |||||||| ||||||| |||||| |||||||| Sbjct: 859 gcgatcagggaccatttgtgcccgagtaggctgtggagcttgatgatgagctcgtcctcc 800 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccgg 965 || | ||||||||||||||||| ||||||||||| ||||||||||||||||| || ||| Sbjct: 799 tcctccgtgaagttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcgg 740 Query: 966 cagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcg 1025 |||||||||||||| |||| || || || |||||||| || || ||||||||||| ||| Sbjct: 739 cagctcttgccgcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcg 680 Query: 1026 ccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctg 1085 |||||||| |||||| |||||||| || ||||||||||||||||||||||||||| || Sbjct: 679 ccgtgcgccttgatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttg 620 Query: 1086 ttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 || |||||||||||||||||||| ||||||| |||| Sbjct: 619 ttcgtgtgcgccttctcgcagcacggcgacctcccc 584 >gi|37391429|gb|CF632957.1|CF632957 zmrws48_0B20-009-h08.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 671 Score = 258 bits (130), Expect = 1e-66 Identities = 250/290 (86%) Strand = Plus / Plus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 382 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 441 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 442 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 501 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 502 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 561 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 562 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttgcc 621 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgc 1026 ||| |||| || || || |||||||| || || ||||||||||| |||| Sbjct: 622 gcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcgc 671 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 274 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 318 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 200 cccaggctgcagctgaagcagagc 223 >gi|71426088|gb|DR807138.1|DR807138 ZM_BFb0033F03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 863 Score = 246 bits (124), Expect = 5e-63 Identities = 238/276 (86%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 ||||| || ||||| ||||| ||||| |||||||| ||||||| |||||| |||||||| Sbjct: 843 gcgatcagggaccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcc 784 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccgg 965 || | |||||||||||||||| |||||||||| ||||||||||||||||| || ||| Sbjct: 783 tcctccgtgaagttgccgcgctgagggtcgggccgcaggtagttgatccaccggaggcgg 724 Query: 966 cagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcg 1025 |||||||||||||| |||| || || || |||||||| || || ||||||||||| ||| Sbjct: 723 cagctcttgccgcagcgcacaagtccggcggccttgggaagggagcgccagcacccctcg 664 Query: 1026 ccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctg 1085 |||||||| |||||| |||||||| || ||||||||||||||||||||||||||| || Sbjct: 663 ccgtgcgccttgatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttg 604 Query: 1086 ttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 || |||||||||||||||||||| ||||||| |||| Sbjct: 603 ttcgtgtgcgccttctcgcagcacggcgacctcccc 568 >gi|86474681|gb|DY241051.1|DY241051 ZM_BFb0261D14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 688 Score = 246 bits (124), Expect = 5e-63 Identities = 217/248 (87%) Strand = Plus / Plus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 437 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 496 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 497 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 556 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 557 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 616 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| ||||||||||| ||||||||||||| ||| || |||||||||||||| Sbjct: 617 gttgccgcgcttgaggtcgggccgcaggtagttgatcccccggaggcggcagctcttgcc 676 Query: 977 gcaccgca 984 |||||||| Sbjct: 677 gcaccgca 684 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 329 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 373 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 255 cccaggctgcagctgaagcagagc 278 >gi|33770856|gb|CF273150.1|CF273150 EST2712 Zea mays sperm cell cDNA library Zea mays cDNA clone Zmsp7240 5', mRNA sequence Length = 658 Score = 234 bits (118), Expect = 2e-59 Identities = 187/210 (89%) Strand = Plus / Plus Query: 912 gtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctc 971 ||||||||||||||||| ||||||||||| ||||||||||||||||| || ||||||||| Sbjct: 10 gtgaagttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctc 69 Query: 972 ttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgc 1031 |||||||| |||| || || || |||||||| || || ||||||||||||||||||||| Sbjct: 70 ttgccgcagcgcacaagtccggcggccttgggaagggagcgccagcacccttcgccgtgc 129 Query: 1032 gcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtg 1091 || |||||| |||||||| || ||||||||||||||||||||||||||| |||| ||| Sbjct: 130 gccttgatgtacgccaccagacggtcgtcctcctccttggtccacgcgcccttgttcgtg 189 Query: 1092 tgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||||||| ||||||| |||| Sbjct: 190 tgcgccttctcgcagcacggcgacctcccc 219 >gi|78116177|gb|DV534564.1|DV534564 ZM_BFb0226D11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 706 Score = 234 bits (118), Expect = 2e-59 Identities = 208/238 (87%) Strand = Plus / Plus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 469 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 528 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 529 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 588 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaa 916 ||| ||||| ||||| |||||||| ||||||| |||||| |||||||| || | ||||| Sbjct: 589 ccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaa 648 Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974 |||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||| Sbjct: 649 gttgccgcgcttgaggtcgggccgcaggtagttgatccaccggaggcggcagctcttg 706 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 361 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 405 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 287 cccaggctgcagctgaagcagagc 310 >gi|93014081|gb|EB639601.1|EB639601 ZM_BFb0327J16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 558 Score = 232 bits (117), Expect = 8e-59 Identities = 296/352 (84%), Gaps = 4/352 (1%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttg-atctcgttgtccgtccgccc 832 |||||||||||| || |||||||||||||||||| || |||||||||||||||| || Sbjct: 558 agcagcttccgcttgatgtgcgtgttccagtagtttttttatctcgttgtccgtcctgcc 499 Query: 833 cgggagccgcgcggcg--atgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||| |||| | ||||| ||||||||||||||||| |||| || ||| | ||||| | Sbjct: 498 cggcagcctcccggcggaatgagcgaccacttgttgccgaacagctcgtggaacttgatg 439 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggagg-tagtt 949 || || |||||||| || || |||||||||||||||| ||||| || || ||| ||||| Sbjct: 438 atcagctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcagggtagtt 379 Query: 950 gatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcga 1009 |||||||||||||||||||||||| |||||||||||||| || || || || || ||||| Sbjct: 378 gatccaccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcga 319 Query: 1010 ccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctcctt 1069 || |||||| || |||||||| || ||||||||| | ||||||| |||||||||||| Sbjct: 318 cctccagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctcctcctt 259 Query: 1070 ggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 258 ggtccacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 207 >gi|6165757|gb|AF099410.1|AF099410 Zea mays clone ZmMYBIM49 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 232 bits (117), Expect = 8e-59 Identities = 126/129 (97%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||| Sbjct: 69 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtccgggcggag 10 Query: 944 gtagttgat 952 ||||||||| Sbjct: 9 gtagttgat 1 >gi|6165757|gb|AF099410.1|AF099410 Zea mays clone ZmMYBIM49 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 232 bits (117), Expect = 8e-59 Identities = 126/129 (97%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||| Sbjct: 69 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtccgggcggag 10 Query: 944 gtagttgat 952 ||||||||| Sbjct: 9 gtagttgat 1 >gi|71441759|gb|DR822809.1|DR822809 ZM_BFb0063G11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 308 Score = 230 bits (116), Expect = 3e-58 Identities = 209/240 (87%) Strand = Plus / Minus Query: 882 agcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccgg 941 ||||||| |||||| ||||| |||||| ||||||||||||||||||| ||||| || ||| Sbjct: 292 agcttgatgatgagctcgtcgtcgtcgccggtgaagttgccgcgcttgaggtccgggcgg 233 Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||| ||||| || |||| ||||||||||||||| || || || ||||| |||||| Sbjct: 232 aggtagttcatccagcggagcctgcagctcttgccgcagcggaggagtcccgcggccttg 173 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 |||||||| ||||||| ||| ||||||||||| | ||||||||| | |||||||| |||| Sbjct: 172 ggcagcgagcgccagctcccctcgccgtgcgccctgatgtaggcgatcaggcgctggtcc 113 Query: 1062 tcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||| |||||| |||| ||||| |||||||||||||| || |||| |||| Sbjct: 112 tcctccttggtccaggcgcccttgttcgtgtgtgccttctcgcagcacggagacctcccc 53 >gi|71764665|gb|DR962602.1|DR962602 ZM_BFb0081D04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 737 Score = 230 bits (116), Expect = 3e-58 Identities = 188/212 (88%) Strand = Plus / Plus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| || |||||||||||||| || |||||| |||||||||||| ||||||||| Sbjct: 526 acttgttgcccaggaggctgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 585 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 |||||||||| ||||| || ||||||||||| ||||| ||||||| |||||||||||||| Sbjct: 586 tgccgcgcttgaggtccgggcggaggtagttcatccagcgcagcctgcagctcttgccgc 645 Query: 979 accgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgga 1038 | |||||||| |||||||||||||||||||| ||||||||||| || ||||||| |||| Sbjct: 646 agcgcagcagccccgccgccttgggcagcgagcgccagcacccctcctcgtgcgcccgga 705 Query: 1039 tgtaggccaccaggcgctcgtcctcctccttg 1070 ||| |||||||| |||||||||||||||||| Sbjct: 706 cgtacgccaccagccgctcgtcctcctccttg 737 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||| Sbjct: 277 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccaggcagctgcccggcgat 336 Query: 851 gagcgaccac 860 ||| |||||| Sbjct: 337 gagggaccac 346 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 17 aggtcgaggttgaggtcggggca 39 >gi|19072751|gb|AF474124.1| Zea mays typical P-type R2R3 Myb protein (Myb56) gene, partial cds Length = 1739 Score = 224 bits (113), Expect = 2e-56 Identities = 182/205 (88%) Strand = Plus / Minus Query: 917 gttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgcc 976 |||||||||||| |||||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 1395 gttgccgcgcttgaggtcggggcgcaggtagttgatccaccggaggcggcagctcttgcc 1336 Query: 977 gcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcg 1036 ||| |||||||||||||| |||||||| ||||||| |||||| ||||||||||| || Sbjct: 1335 gcagcgcagcaggcccgcggccttggggagcgacctccagcagccttcgccgtgggcctt 1276 Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 ||||||||| || || |||| |||||||||||||||||| |||||| |||| |||||||| Sbjct: 1275 gatgtaggcgacgagccgctggtcctcctccttggtccaggcgcccttgttcgtgtgcgc 1216 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 1215 cttctcgcagcacggcgacctcccc 1191 Score = 107 bits (54), Expect = 3e-21 Identities = 66/70 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 1633 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 1574 Query: 851 gagcgaccac 860 ||||||||| Sbjct: 1573 cagcgaccac 1564 >gi|78092036|gb|DV520410.1|DV520410 ZM_BFb0205E08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 699 Score = 220 bits (111), Expect = 3e-55 Identities = 246/291 (84%) Strand = Plus / Minus Query: 831 cccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||||| |||| | ||||||||||||| |||||||| |||| ||| ||| | ||||| | Sbjct: 696 cccggcagcctcccggcgatgagcgaacacttgttgccgaagagctcgtggaacttgatg 637 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 |||||||| || || || ||||||||||||||||||| ||||| || || ||||||||| Sbjct: 636 atgaggtcatcttcctcctcggtgaagttgccgcgcttgaggtccgggcgcaggtagttg 577 Query: 951 atccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgac 1010 ||||||||||||||||||||||| ||||| |||||||| || || || || || ||||| Sbjct: 576 atccaccgcagccggcagctcttcccgcagcgcagcagacctgcggcttttggtagcgat 517 Query: 1011 cgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttg 1070 | |||||| || |||||||| || ||||||||| || ||||||| ||||||||||||| Sbjct: 516 ctccagcagccctcgccgtgggccttgatgtaggcgacgaggcgctggtcctcctccttg 457 Query: 1071 gtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 456 gtccacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 406 >gi|50327466|gb|CO522592.1|CO522592 3530_1_149_1_A05.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 717 Score = 202 bits (102), Expect = 7e-50 Identities = 204/238 (85%) Strand = Plus / Minus Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||| || |||||||| || || |||||||||||||||| ||||| || || || Sbjct: 442 cttgatgatcagctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcag 383 Query: 944 gtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttggg 1003 |||||||||||||||||||||||||||||| |||||||||||||| || || || || || Sbjct: 382 gtagttgatccaccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttgg 323 Query: 1004 cagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctc 1063 ||||||| |||||| || |||||||| || ||||||||| | ||||||| |||||| Sbjct: 322 tagcgacctccagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcctc 263 Query: 1064 ctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 262 ctccttggtccacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 205 Score = 93.7 bits (47), Expect = 5e-17 Identities = 77/87 (88%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 664 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 605 Query: 834 gggagccgcgcggcgatgagcgaccac 860 || |||| | ||||||||||||||||| Sbjct: 604 ggcagcctcccggcgatgagcgaccac 578 >gi|76280411|gb|DV019979.1|DV019979 ZM_BFb0138B23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 427 Score = 202 bits (102), Expect = 7e-50 Identities = 204/238 (85%) Strand = Plus / Minus Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||||||||| ||||| || ||||||||||||||||||| ||||| || || || Sbjct: 409 cttgatgatgaggtcatcctcctcctcggtgaagttgccgcgcttgaggtccgggcgcag 350 Query: 944 gtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttggg 1003 ||||||||||| |||||||||||||||||| ||||| |||||||| || || || || || Sbjct: 349 gtagttgatcccccgcagccggcagctcttcccgcagcgcagcagacctgcggcttttgg 290 Query: 1004 cagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcctc 1063 ||||| | |||||| || |||||||| || ||||||||| || ||||||| |||||| Sbjct: 289 tagcgatctccagcagccctcgccgtgggccttgatgtaggcgacgaggcgctggtcctc 230 Query: 1064 ctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 229 ctccttggtccacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 172 >gi|91049715|gb|EB160133.1|EB160133 ZM_BFb0296M16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 935 Score = 200 bits (101), Expect = 3e-49 Identities = 218/257 (84%) Strand = Plus / Minus Query: 774 agcagcttccgccggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgcccc 833 |||||||||||| || |||||||||||||||||| || |||||||||||||||| ||| Sbjct: 276 agcagcttccgcttgatgtgcgtgttccagtagttttttatctcgttgtccgtcctgccc 217 Query: 834 gggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatg 893 || |||| | |||||||||||||||||||||| |||| || ||| | ||||| ||| Sbjct: 216 ggcagcctcccggcgatgagcgaccacttgttgccgaacagctcgtggaacttgatgatc 157 Query: 894 aggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatc 953 || |||||||| || || |||||||||||||||| ||||| || || |||||||||||| Sbjct: 156 agctcgtcctcctcctcgctgaagttgccgcgcttgaggtccgggcgcaggtagttgatc 97 Query: 954 caccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgc 1013 |||||||||||||||||||| |||||||||||||| || || || || || ||||||| | Sbjct: 96 caccgcagccggcagctcttcccgcaccgcagcagccctgcggcttttggtagcgacctc 37 Query: 1014 cagcacccttcgccgtg 1030 ||||| || |||||||| Sbjct: 36 cagcagccctcgccgtg 20 >gi|19548462|gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds Length = 433 Score = 200 bits (101), Expect = 3e-49 Identities = 143/157 (91%) Strand = Plus / Minus Query: 965 gcagctcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttc 1024 ||||||||||||||| ||||| ||||| || |||||||||||||| ||||||||||| || Sbjct: 421 gcagctcttgccgcagcgcaggaggccggcggccttgggcagcgagcgccagcacccctc 362 Query: 1025 gccgtgcgcgcggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccct 1084 ||||||||| | ||||| || |||||||||||||||||||||||||||||||||||| | Sbjct: 361 gccgtgcgccctgatgtgcgcgaccaggcgctcgtcctcctccttggtccacgcgccctt 302 Query: 1085 gttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||||||||||||| ||||||| |||| Sbjct: 301 gttggtgtgcgccttctcgcagcacggcgacctcccc 265 >gi|60344220|gb|DN211193.1|DN211193 MEST921_A06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 703 Score = 182 bits (92), Expect = 6e-44 Identities = 146/164 (89%) Strand = Plus / Plus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 531 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 590 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 591 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgattagggaccac 650 Query: 861 ttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctc 904 ||||| ||||||| ||||||||||||||||||||| |||||||| Sbjct: 651 ttgttgccgaggacgctgtgcagcttgacgatgagctcgtcctc 694 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 272 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 316 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 186 cccaggctgcagccgaagcagagc 209 >gi|19072733|gb|AF474115.1| Zea mays typical P-type R2R3 Myb protein (Myb1) gene, partial cds Length = 2399 Score = 180 bits (91), Expect = 3e-43 Identities = 199/235 (84%) Strand = Plus / Minus Query: 745 ggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagt 804 ||||||||||||||||||| ||| || ||||||||| |||| |||||||||||||| Sbjct: 2155 ggtgcgtgacggggtcgatccccatggagagcagcttcttgcggaggtgcgtgttccagt 2096 Query: 805 agttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgt 864 ||||||||||||||||||| || || || |||||| | ||||||| |||||||||| Sbjct: 2095 agttcttgatctcgttgtcggtgcggccggggagcttggtggcgatggaggaccacttgt 2036 Query: 865 tcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgc 924 | ||||||||| ||| || | |||||||||||| ||||||||| ||||||| |||||| Sbjct: 2035 tgccgaggagggagtggaggtggacgatgaggtcttcctcgtcgtcggtgaacctgccgc 1976 Query: 925 gcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgca 979 |||| | |||||| |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 1975 gcttgatgtcggggcggaggtagttggtccatcgcaggcggcagctcttgccgca 1921 >gi|37424713|gb|CF650089.1|CF650089 3530_1_81_1_F11.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 345 Score = 174 bits (88), Expect = 2e-41 Identities = 157/180 (87%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||||||||||||| |||||||||||||| || || || || Sbjct: 345 aggtagttgatccaccgcagccggcagctcttcccgcaccgcagcagccctgcggctttt 286 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 || ||||||| |||||| || |||||||| || ||||||||| | ||||||| |||| Sbjct: 285 ggtagcgacctccagcagccctcgccgtgggccttgatgtaggcgatgaggcgctggtcc 226 Query: 1062 tcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 ||||||||||||||||||||| ||||||||||||||| ||||||||| || |||| |||| Sbjct: 225 tcctccttggtccacgcgcccttgttggtgtgcgcctgctcgcagcacggggacctcccc 166 >gi|18659428|gb|BM500332.1|BM500332 PAC000000000513 Pioneer AF-1 array Zea mays cDNA, mRNA sequence Length = 436 Score = 159 bits (80), Expect = 9e-37 Identities = 155/180 (86%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||| ||||| || ||| ||||||||||||||| || || || ||||| |||||| Sbjct: 263 aggtagttcatccagcggagcttgcagctcttgccgcagcggaggagtcccgcggccttg 204 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 |||||||| ||||||| ||| ||||||||||| | ||||||||| | |||||||| |||| Sbjct: 203 ggcagcgagcgccagctcccctcgccgtgcgccctgatgtaggcgatcaggcgctggtcc 144 Query: 1062 tcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgaccgcccc 1121 |||||||||||||| |||||| |||| ||||| |||||||||||||| || |||| |||| Sbjct: 143 tcctccttggtccaggcgcccttgttcgtgtgtgccttctcgcagcacggagacctcccc 84 >gi|71321116|gb|DR797259.1|DR797259 ZM_BFb0019E13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 810 Score = 151 bits (76), Expect = 2e-34 Identities = 163/192 (84%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 539 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcctgggagctgcgccgcgat 480 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | ||||| ||||| Sbjct: 479 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctcctcctcggc 420 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| ||||||||||||||| |||||||||| |||||||| Sbjct: 419 tgtgaagggcccgcgcttgatgtccggccggaggtagttggtccaccgcagtcggcagct 360 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 359 cttgccgcaccg 348 >gi|78090837|gb|DV519211.1|DV519211 ZM_BFb0203I15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 888 Score = 151 bits (76), Expect = 2e-34 Identities = 163/192 (84%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 424 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcctgggagctgcgccgcgat 365 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | ||||| ||||| Sbjct: 364 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctcctcctcggc 305 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| ||||||||||||||| |||||||||| |||||||| Sbjct: 304 tgtgaagggcccgcgcttgatgtccggccggaggtagttggtccaccgcagtcggcagct 245 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 244 cttgccgcaccg 233 >gi|91872725|gb|EB402682.1|EB402682 ZM_BFb0309J21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 852 Score = 151 bits (76), Expect = 2e-34 Identities = 163/192 (84%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 539 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcctgggagctgcgccgcgat 480 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | ||||| ||||| Sbjct: 479 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctcctcctcggc 420 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| ||||||||||||||| |||||||||| |||||||| Sbjct: 419 tgtgaagggcccgcgcttgatgtccggccggaggtagttggtccaccgcagtcggcagct 360 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 359 cttgccgcaccg 348 >gi|37377397|gb|CF625297.1|CF625297 zmrws05_0A20-015-c04.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 529 Score = 149 bits (75), Expect = 9e-34 Identities = 138/159 (86%) Strand = Plus / Plus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 343 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 402 Query: 797 gttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcga 856 ||||||||||||||||||||||||||| |||| ||||| |||| | ||||| || || Sbjct: 403 gttccagtagttcttgatctcgttgtcggtcctgcccggcagccttccagcgatcaggga 462 Query: 857 ccacttgttcccgaggaggctgtgcagcttgacgatgag 895 ||| ||||| ||||| |||||||| ||||||| |||||| Sbjct: 463 ccatttgttgccgagtaggctgtggagcttgatgatgag 501 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 235 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 279 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 161 cccaggctgcagctgaagcagagc 184 >gi|25989611|gb|AY135018.1| Zea mays PL transcription factor (pl) mRNA, pl-bol3 allele, complete cds Length = 960 Score = 133 bits (67), Expect = 5e-29 Identities = 157/187 (83%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || ||||| || || ||||| |||| | || || |||| Sbjct: 378 tgttccagtagttcttgatttcattgtctgttcggcccggcagcctgcctgcaatcagcg 319 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| |||| ||| ||||||||| || ||||||||| || || Sbjct: 318 accacctgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggaga 259 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||||| | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 258 tgttgccgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 199 Query: 976 cgcaccg 982 ||||||| Sbjct: 198 cgcaccg 192 >gi|25989615|gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W22 allele, complete cds Length = 961 Score = 133 bits (67), Expect = 5e-29 Identities = 157/187 (83%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || ||||| || || ||||| |||| | || || |||| Sbjct: 378 tgttccagtagttcttgatttcattgtctgttcggcccggcagcctgcctgcaatcagcg 319 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| |||| ||| ||||||||| || ||||||||| || || Sbjct: 318 accacctgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggaga 259 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||||| | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 258 tgttgccgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 199 Query: 976 cgcaccg 982 ||||||| Sbjct: 198 cgcaccg 192 >gi|25989615|gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W22 allele, complete cds Length = 961 Score = 133 bits (67), Expect = 5e-29 Identities = 157/187 (83%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || ||||| || || ||||| |||| | || || |||| Sbjct: 378 tgttccagtagttcttgatttcattgtctgttcggcccggcagcctgcctgcaatcagcg 319 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| |||| ||| ||||||||| || ||||||||| || || Sbjct: 318 accacctgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggaga 259 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||||| | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 258 tgttgccgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 199 Query: 976 cgcaccg 982 ||||||| Sbjct: 198 cgcaccg 192 >gi|25989611|gb|AY135018.1| Zea mays PL transcription factor (pl) mRNA, pl-bol3 allele, complete cds Length = 960 Score = 133 bits (67), Expect = 5e-29 Identities = 157/187 (83%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || ||||| || || ||||| |||| | || || |||| Sbjct: 378 tgttccagtagttcttgatttcattgtctgttcggcccggcagcctgcctgcaatcagcg 319 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| |||| ||| ||||||||| || ||||||||| || || Sbjct: 318 accacctgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggaga 259 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||||| | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 258 tgttgccgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 199 Query: 976 cgcaccg 982 ||||||| Sbjct: 198 cgcaccg 192 >gi|50327020|gb|CO522146.1|CO522146 3530_1_146_1_B07.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 785 Score = 131 bits (66), Expect = 2e-28 Identities = 156/186 (83%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 865 |||||||||||||||||| || |||||||| ||| |||| ||||| |||||| |||| Sbjct: 483 gttcttgatctcgttgtcggtgcgccccggcagctgcgccgcgatcgctgaccacctgtt 424 Query: 866 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcg 925 ||||| || ||| || |||||||||| | |||||||||| ||||||||||||||| Sbjct: 423 gccgagctcgcggtggaggcggacgatgagggcctcctcgtcgggggtgaagttgccgcg 364 Query: 926 cttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcag 985 ||| | |||||| ||||||||||||||||| || || ||||||||||||||||| || || Sbjct: 363 cttgatgtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcagcggag 304 Query: 986 caggcc 991 |||||| Sbjct: 303 caggcc 298 Score = 50.1 bits (25), Expect = 6e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccc 1083 |||| ||||||||||||||||| ||||||||| | |||||||||||| Sbjct: 254 cggacgtaggccaccaggcgctggtcctcctcggcgctccacgcgcccc 206 >gi|67025755|gb|CO454504.1|CO454504 MZCCL10204H10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 811 Score = 131 bits (66), Expect = 2e-28 Identities = 156/186 (83%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 865 |||||||||||||||||| || |||||||| ||| |||| ||||| |||||| |||| Sbjct: 496 gttcttgatctcgttgtcggtgcgccccggcagctgcgccgcgatcgctgaccacctgtt 437 Query: 866 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcg 925 ||||| || ||| || |||||||||| | |||||||||| ||||||||||||||| Sbjct: 436 gccgagctcgcggtggaggcggacgatgagggcctcctcgtcgggggtgaagttgccgcg 377 Query: 926 cttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcag 985 ||| | |||||| ||||||||||||||||| || || ||||||||||||||||| || || Sbjct: 376 cttgatgtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcagcggag 317 Query: 986 caggcc 991 |||||| Sbjct: 316 caggcc 311 Score = 50.1 bits (25), Expect = 6e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccc 1083 |||| ||||||||||||||||| ||||||||| | |||||||||||| Sbjct: 267 cggacgtaggccaccaggcgctggtcctcctcggcgctccacgcgcccc 219 >gi|71429108|gb|DR810158.1|DR810158 ZM_BFb0037L06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 779 Score = 131 bits (66), Expect = 2e-28 Identities = 156/186 (83%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 865 |||||||||||||||||| || |||||||| ||| |||| ||||| |||||| |||| Sbjct: 666 gttcttgatctcgttgtcggtgcgccccggcagctgcgccgcgatcgctgaccacctgtt 607 Query: 866 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcg 925 ||||| || ||| || |||||||||| | |||||||||| ||||||||||||||| Sbjct: 606 gccgagctcgcggtggaggcggacgatgagggcctcctcgtcgggggtgaagttgccgcg 547 Query: 926 cttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcag 985 ||| | |||||| ||||||||||||||||| || || ||||||||||||||||| || || Sbjct: 546 cttgatgtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcagcggag 487 Query: 986 caggcc 991 |||||| Sbjct: 486 caggcc 481 Score = 50.1 bits (25), Expect = 6e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccc 1083 |||| ||||||||||||||||| ||||||||| | |||||||||||| Sbjct: 437 cggacgtaggccaccaggcgctggtcctcctcggcgctccacgcgcccc 389 >gi|78114130|gb|DV532519.1|DV532519 ZM_BFb0223D21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 806 Score = 131 bits (66), Expect = 2e-28 Identities = 156/186 (83%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 865 |||||||||||||||||| || |||||||| ||| |||| ||||| |||||| |||| Sbjct: 599 gttcttgatctcgttgtcggtgcgccccggcagctgcgccgcgatcgctgaccacctgtt 540 Query: 866 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcg 925 ||||| || ||| || |||||||||| | |||||||||| ||||||||||||||| Sbjct: 539 gccgagctcgcggtggaggcggacgatgagggcctcctcgtcgggggtgaagttgccgcg 480 Query: 926 cttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcag 985 ||| | |||||| ||||||||||||||||| || || ||||||||||||||||| || || Sbjct: 479 cttgatgtcggggcggaggtagttgatccagcggaggcggcagctcttgccgcagcggag 420 Query: 986 caggcc 991 |||||| Sbjct: 419 caggcc 414 Score = 50.1 bits (25), Expect = 6e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccc 1083 |||| ||||||||||||||||| ||||||||| | |||||||||||| Sbjct: 370 cggacgtaggccaccaggcgctggtcctcctcggcgctccacgcgcccc 322 >gi|37389671|gb|CF632056.1|CF632056 zmrws48_0B10-016-d03.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 665 Score = 129 bits (65), Expect = 8e-28 Identities = 110/125 (88%) Strand = Plus / Plus Query: 741 gggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttc 800 ||||||||||| || |||||||| ||||||| ||||||||||| ||||| |||||||||| Sbjct: 541 gggcggtgcgtcaccgggtcgatccccctgctcagcagcttcctccggatgtgcgtgttc 600 Query: 801 cagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccac 860 |||||||||||||||||||||||||||| || || |||| ||||||| || |||||| Sbjct: 601 cagtagttcttgatctcgttgtccgtcctgccgggcagccttccggcgatcagggaccac 660 Query: 861 ttgtt 865 ||||| Sbjct: 661 ttgtt 665 Score = 81.8 bits (41), Expect = 2e-13 Identities = 44/45 (97%) Strand = Plus / Plus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 282 ctggcacggcgggctgatgcagaggtccaggttgaggtcggggca 326 Score = 48.1 bits (24), Expect = 0.002 Identities = 24/24 (100%) Strand = Plus / Plus Query: 465 cccaggctgcagccgaagcagagc 488 |||||||||||||||||||||||| Sbjct: 196 cccaggctgcagccgaagcagagc 219 >gi|6165799|gb|AF099431.1|AF099431 Zea mays clone ZmMYBIP39 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 129 bits (65), Expect = 8e-28 Identities = 98/109 (89%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 | || | ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 49 cctcctccgtgaagttgccgcgcttgaggtcggggcggaggtagttgat 1 >gi|6165799|gb|AF099431.1|AF099431 Zea mays clone ZmMYBIP39 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 129 bits (65), Expect = 8e-28 Identities = 98/109 (89%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 | || | ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 49 cctcctccgtgaagttgccgcgcttgaggtcggggcggaggtagttgat 1 >gi|71308073|gb|DR790252.1|DR790252 ZM_BFb0009C10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 686 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 654 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 595 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 594 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 535 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 534 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 475 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 474 cttgccgcaccg 463 >gi|71426243|gb|DR807293.1|DR807293 ZM_BFb0033I13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 825 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 591 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 532 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 531 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 472 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 471 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 412 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 411 cttgccgcaccg 400 >gi|71771140|gb|DR969077.1|DR969077 ZM_BFb0090K13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 741 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 533 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 474 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 473 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 414 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 413 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 354 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 353 cttgccgcaccg 342 >gi|71771838|gb|DR969775.1|DR969775 ZM_BFb0091K13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 778 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 477 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 418 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 417 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 358 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 357 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 298 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 297 cttgccgcaccg 286 >gi|71772728|gb|DR970655.1|DR970655 ZM_BFb0093A02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 849 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 586 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 527 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 526 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 467 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 466 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 407 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 406 cttgccgcaccg 395 >gi|78083839|gb|DV512232.1|DV512232 ZM_BFb0192M21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 819 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 586 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 527 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 526 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 467 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 466 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 407 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 406 cttgccgcaccg 395 >gi|78086925|gb|DV515318.1|DV515318 ZM_BFb0197N12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 850 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 588 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 529 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 528 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 469 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 468 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 409 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 408 cttgccgcaccg 397 >gi|91874168|gb|EB404125.1|EB404125 ZM_BFb0313C11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 838 Score = 127 bits (64), Expect = 3e-27 Identities = 160/192 (83%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 649 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 590 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 589 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 530 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 529 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 470 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 469 cttgccgcaccg 458 >gi|58082443|gb|AC155584.2| Zea mays strain B73 clone ZMMBBc0196I14, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 188283 Score = 127 bits (64), Expect = 3e-27 Identities = 82/88 (93%) Strand = Plus / Plus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||| |||||| |||||||||||||||| ||||| || ||||||||||||||||||||| Sbjct: 83466 tcctcctcggcgctgaagttgccgcgcttgaggtccgggcggaggtagttgatccaccgc 83525 Query: 960 agccggcagctcttgccgcaccgcagca 987 |||||||||||||| ||||||||||||| Sbjct: 83526 agccggcagctcttcccgcaccgcagca 83553 Score = 95.6 bits (48), Expect = 1e-17 Identities = 78/88 (88%) Strand = Plus / Plus Query: 745 ggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagt 804 ||||||||||||||||||||||| ||| || ||||||| | || ||| || ||||||| Sbjct: 38736 ggtgcgtgacggggtcgatgcccatgcgcaccagcttctttctgatgtgtgtattccagt 38795 Query: 805 agttcttgatctcgttgtccgtccgccc 832 |||||||||||||||||||||||||||| Sbjct: 38796 agttcttgatctcgttgtccgtccgccc 38823 Score = 77.8 bits (39), Expect = 3e-12 Identities = 54/59 (91%) Strand = Plus / Plus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccg 958 |||||||||||||| |||||||||||||| | |||||| |||||||||||| ||||||| Sbjct: 39114 tcctcgtcggcggtaaagttgccgcgcttgatgtcggggcggaggtagttggtccaccg 39172 Score = 65.9 bits (33), Expect = 1e-08 Identities = 42/45 (93%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgg 835 ||||||||||||| |||||||||||||||||||||||| ||||| Sbjct: 83249 gtgcgtgttccagacgttcttgatctcgttgtccgtccggcccgg 83293 >gi|71310575|gb|DR791583.1|DR791583 ZM_BFb0011B24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 858 Score = 123 bits (62), Expect = 5e-26 Identities = 164/198 (82%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| |||||| || ||||||| ||| | Sbjct: 460 cgtgttccagtagttcttgatctcgttgtccgtcctccccggcagatgcgcggccatgcg 401 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | |||||||| |||||||||| || Sbjct: 400 cgcccacttgttgccgagctgcgcgtggagctgggcgatgaggagctcctcgtcggggga 341 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 340 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 281 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 280 gccgcagcgcagcaggcc 263 >gi|76016981|gb|DT944151.1|DT944151 ZM_BFb0130K10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 730 Score = 123 bits (62), Expect = 5e-26 Identities = 110/126 (87%) Strand = Plus / Plus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| ||||||||| |||||| || |||||| |||||||||||| ||||||||| Sbjct: 587 acttgttgccgaggagggcgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 646 Query: 919 tgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgc 978 | |||||||| ||||| |||||||||||||| |||| |||||||| |||||||||||||| Sbjct: 647 tcccgcgcttgaggtccggccggaggtagttcatcccccgcagcctgcagctcttgccgc 706 Query: 979 accgca 984 | |||| Sbjct: 707 agcgca 712 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 414 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 473 Query: 851 gagcgaccac 860 || |||||| Sbjct: 474 cagagaccac 483 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 193 aggtcgaggttgaggtcggggca 215 >gi|93012785|gb|EB638305.1|EB638305 ZM_BFb0325G13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 804 Score = 123 bits (62), Expect = 5e-26 Identities = 164/198 (82%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| |||||| || ||||||| ||| | Sbjct: 589 cgtgttccagtagttcttgatctcgttgtccgtcctccccggcagatgcgcggccatgcg 530 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | |||||||| |||||||||| || Sbjct: 529 cgcccacttgttgccgagctgcgcgtggagctgggcgatgaggagctcctcgtcggggga 470 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 469 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 410 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 409 gccgcagcgcagcaggcc 392 >gi|19072747|gb|AF474122.1| Zea mays typical P-type R2R3 Myb protein (Myb47) gene, partial cds Length = 923 Score = 121 bits (61), Expect = 2e-25 Identities = 94/105 (89%) Strand = Plus / Minus Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||||||||| ||||| || ||||||||||||||||||| ||||| || || || Sbjct: 487 cttgatgatgaggtcatcctcctcctcggtgaagttgccgcgcttgaggtccgggcgcag 428 Query: 944 gtagttgatccaccgcagccggcagctcttgccgcaccgcagcag 988 |||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 427 gtagttgatccaccgcagccggcagctcttcccgcagcgcagcag 383 Score = 105 bits (53), Expect = 1e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 ||||||||| || ||||||| ||||||||||||||||||||||||| ||||||||||||| Sbjct: 234 gatgtaggcgacgaggcgctggtcctcctccttggtccacgcgcccttgttggtgtgcgc 175 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 || ||||||||| || |||| |||| Sbjct: 174 ctgctcgcagcacggggacctcccc 150 Score = 75.8 bits (38), Expect = 1e-11 Identities = 38/38 (100%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||||||||||||||||||||||| Sbjct: 660 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 623 >gi|19548442|gb|AF470077.1| Zea mays P-type R2R3 Myb protein (Myb14) gene, partial cds Length = 2268 Score = 121 bits (61), Expect = 2e-25 Identities = 94/105 (89%) Strand = Plus / Minus Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||||||||| ||||| || ||||||||||||||||||| ||||| || || || Sbjct: 1832 cttgatgatgaggtcatcctcctcctcggtgaagttgccgcgcttgaggtccgggcgcag 1773 Query: 944 gtagttgatccaccgcagccggcagctcttgccgcaccgcagcag 988 |||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 1772 gtagttgatccaccgcagccggcagctcttcccgcagcgcagcag 1728 Score = 105 bits (53), Expect = 1e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 ||||||||| || ||||||| ||||||||||||||||||||||||| ||||||||||||| Sbjct: 1579 gatgtaggcgacgaggcgctggtcctcctccttggtccacgcgcccttgttggtgtgcgc 1520 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 || ||||||||| || |||| |||| Sbjct: 1519 ctgctcgcagcacggggacctcccc 1495 Score = 75.8 bits (38), Expect = 1e-11 Identities = 38/38 (100%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||||||||||||||||||||||| Sbjct: 2005 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 1968 >gi|40336655|gb|CK370725.1|CK370725 zmrww005_0A10-008-g12.s0 zmrww005 Zea mays cDNA 5', mRNA sequence Length = 747 Score = 119 bits (60), Expect = 8e-25 Identities = 84/92 (91%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 149 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 90 Query: 797 gttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||| |||||||| |||| Sbjct: 89 gttccagtagttcttgatatcgttgtcggtcc 58 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 257 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 213 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 331 cccaggctgcagctgaagcagagc 308 >gi|76285013|gb|DV024581.1|DV024581 ZM_BFb0144N05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 718 Score = 119 bits (60), Expect = 8e-25 Identities = 159/192 (82%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||||||||||| |||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 713 gtgcgtgttccagtagatcttgatctcgttgtccgtccggccagggagctgcgccgcgat 654 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | ||||||||||| |||| || | ||| |||| ||||||| | | ||| |||| Sbjct: 653 catggaccacttgttgccgacgatggcgtggagctggacgatggacttctgctcctcgga 594 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||| |||||||| | ||| |||||||||||||| |||||||||| |||||||| Sbjct: 593 tgtgaagggcccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagct 534 Query: 971 cttgccgcaccg 982 |||||||||||| Sbjct: 533 cttgccgcaccg 522 >gi|89143140|emb|AM156904.1| Zea mays mRNA for transcription factor MYB2 (myb2 gene) Length = 1339 Score = 119 bits (60), Expect = 8e-25 Identities = 81/88 (92%) Strand = Plus / Minus Query: 745 ggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagt 804 |||||||||||||||||| |||| ||| |||||||||| |||| |||||||||||||| Sbjct: 456 ggtgcgtgacggggtcgacgcccatgcgcagcagcttcttgcggatgtgcgtgttccagt 397 Query: 805 agttcttgatctcgttgtccgtccgccc 832 |||||||||||||||||||||||||||| Sbjct: 396 agttcttgatctcgttgtccgtccgccc 369 Score = 95.6 bits (48), Expect = 1e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||||| ||||||||||||||||||| | |||||| |||||||||||| |||| || Sbjct: 301 tcctcgtcgtcggtgaagttgccgcgcttgatgtcggggcggaggtagttggtccagcgg 242 Query: 960 agccggcagctcttgccgca 979 || ||||||||||||||||| Sbjct: 241 aggcggcagctcttgccgca 222 >gi|89143140|emb|AM156904.1| Zea mays mRNA for transcription factor MYB2 (myb2 gene) Length = 1339 Score = 119 bits (60), Expect = 8e-25 Identities = 81/88 (92%) Strand = Plus / Minus Query: 745 ggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagt 804 |||||||||||||||||| |||| ||| |||||||||| |||| |||||||||||||| Sbjct: 456 ggtgcgtgacggggtcgacgcccatgcgcagcagcttcttgcggatgtgcgtgttccagt 397 Query: 805 agttcttgatctcgttgtccgtccgccc 832 |||||||||||||||||||||||||||| Sbjct: 396 agttcttgatctcgttgtccgtccgccc 369 Score = 95.6 bits (48), Expect = 1e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||||| ||||||||||||||||||| | |||||| |||||||||||| |||| || Sbjct: 301 tcctcgtcgtcggtgaagttgccgcgcttgatgtcggggcggaggtagttggtccagcgg 242 Query: 960 agccggcagctcttgccgca 979 || ||||||||||||||||| Sbjct: 241 aggcggcagctcttgccgca 222 >gi|19548468|gb|AF470090.1| Zea mays P-type R2R3 Myb protein (Myb49) gene, complete cds Length = 773 Score = 119 bits (60), Expect = 8e-25 Identities = 81/88 (92%) Strand = Plus / Minus Query: 745 ggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgtgttccagt 804 |||||||||||||||||| |||| ||| |||||||||| |||| |||||||||||||| Sbjct: 676 ggtgcgtgacggggtcgacgcccatgcgcagcagcttcttgcggatgtgcgtgttccagt 617 Query: 805 agttcttgatctcgttgtccgtccgccc 832 |||||||||||||||||||||||||||| Sbjct: 616 agttcttgatctcgttgtccgtccgccc 589 Score = 95.6 bits (48), Expect = 1e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||||| ||||||||||||||||||| | |||||| |||||||||||| |||| || Sbjct: 408 tcctcgtcgtcggtgaagttgccgcgcttgatgtcggggcggaggtagttggtccagcgg 349 Query: 960 agccggcagctcttgccgca 979 || ||||||||||||||||| Sbjct: 348 aggcggcagctcttgccgca 329 >gi|40333941|gb|CK368011.1|CK368011 zmrws055_0A10-003-b12.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 689 Score = 117 bits (59), Expect = 3e-24 Identities = 71/75 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 97 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 38 Query: 851 gagcgaccacttgtt 865 |||||||||||||| Sbjct: 37 cagcgaccacttgtt 23 >gi|44901096|gb|CK827641.1|CK827641 zmrws05_0A11-003-b12.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 646 Score = 117 bits (59), Expect = 3e-24 Identities = 71/75 (94%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| Sbjct: 566 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggcggcgat 625 Query: 851 gagcgaccacttgtt 865 |||||||||||||| Sbjct: 626 cagcgaccacttgtt 640 >gi|78116615|gb|DV535002.1|DV535002 ZM_BFb0226N11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 734 Score = 117 bits (59), Expect = 3e-24 Identities = 71/75 (94%) Strand = Plus / Minus Query: 902 ctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcag 961 |||||||||| |||||||||| ||||||| |||||||||||||||||||| ||||||||| Sbjct: 446 ctcgtcggcgctgaagttgccacgcttcacgtcgggccggaggtagttgagccaccgcag 387 Query: 962 ccggcagctcttgcc 976 ||||||||||||||| Sbjct: 386 ccggcagctcttgcc 372 Score = 60.0 bits (30), Expect = 6e-07 Identities = 30/30 (100%) Strand = Plus / Minus Query: 799 tccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||||||||||||||| Sbjct: 549 tccagtagttcttgatctcgttgtccgtcc 520 >gi|21217176|gb|AY112586.1| Zea mays CL346_1 mRNA sequence Length = 1292 Score = 117 bits (59), Expect = 3e-24 Identities = 71/75 (94%) Strand = Plus / Minus Query: 902 ctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcag 961 |||||||||| |||||||||| ||||||| |||||||||||||||||||| ||||||||| Sbjct: 430 ctcgtcggcgctgaagttgccacgcttcacgtcgggccggaggtagttgagccaccgcag 371 Query: 962 ccggcagctcttgcc 976 ||||||||||||||| Sbjct: 370 ccggcagctcttgcc 356 Score = 60.0 bits (30), Expect = 6e-07 Identities = 30/30 (100%) Strand = Plus / Minus Query: 799 tccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||||||||||||||| Sbjct: 533 tccagtagttcttgatctcgttgtccgtcc 504 >gi|21217176|gb|AY112586.1| Zea mays CL346_1 mRNA sequence Length = 1292 Score = 117 bits (59), Expect = 3e-24 Identities = 71/75 (94%) Strand = Plus / Minus Query: 902 ctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcag 961 |||||||||| |||||||||| ||||||| |||||||||||||||||||| ||||||||| Sbjct: 430 ctcgtcggcgctgaagttgccacgcttcacgtcgggccggaggtagttgagccaccgcag 371 Query: 962 ccggcagctcttgcc 976 ||||||||||||||| Sbjct: 370 ccggcagctcttgcc 356 Score = 60.0 bits (30), Expect = 6e-07 Identities = 30/30 (100%) Strand = Plus / Minus Query: 799 tccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||||||||||||||||||| Sbjct: 533 tccagtagttcttgatctcgttgtccgtcc 504 >gi|6165775|gb|AF099419.1|AF099419 Zea mays clone ZmMYBIP122 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 115 bits (58), Expect = 1e-23 Identities = 94/106 (88%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 |||||||||| ||||||||||| || |||||||||||||| || |||||| ||||||| Sbjct: 109 cggcgatgagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 ||||| ||||||||||||||||||| ||||| || ||||||||||| Sbjct: 49 cgtcgtcggtgaagttgccgcgcttgaggtccgggcggaggtagtt 4 >gi|6165775|gb|AF099419.1|AF099419 Zea mays clone ZmMYBIP122 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 115 bits (58), Expect = 1e-23 Identities = 94/106 (88%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 |||||||||| ||||||||||| || |||||||||||||| || |||||| ||||||| Sbjct: 109 cggcgatgagggaccacttgttgcccaggaggctgtgcaggcggatgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 ||||| ||||||||||||||||||| ||||| || ||||||||||| Sbjct: 49 cgtcgtcggtgaagttgccgcgcttgaggtccgggcggaggtagtt 4 >gi|91056683|gb|EB167101.1|EB167101 ZM_BFb0377K22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 723 Score = 111 bits (56), Expect = 2e-22 Identities = 154/184 (83%), Gaps = 2/184 (1%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 865 |||||||||||||||||||||||||||||| | ||| ||||| |||||||| |||| Sbjct: 425 gttcttgatctcgttgtccgtccgccccggcaagtgcgacgcgatctgcgaccacctgtt 366 Query: 866 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgt-cggcggtgaagttgccgc 924 ||| |||| ||| ||| |||||||||||| ||||| | | ||| |||| ||||| Sbjct: 365 ccccaggatctcgtggagcgcgacgatgaggtcctcctcctgctgcga-gaagccgccgc 307 Query: 925 gcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgca 984 |||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 306 gcttgaggtcggggcggaggtagttgatccaccgcaggcggcagctcttgccgcagcgct 247 Query: 985 gcag 988 |||| Sbjct: 246 gcag 243 >gi|6165741|gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 111 bits (56), Expect = 2e-22 Identities = 92/104 (88%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 |||||||||||||||||||| ||||| ||| ||| ||||||| |||||| ||||| ||| Sbjct: 107 gcgatgagcgaccacttgttgccgagcagggcgtggagcttgatgatgagctcgtcgtcg 48 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 ||| ||||||||||||||||||| ||||| || ||||||||||| Sbjct: 47 tcgccggtgaagttgccgcgcttgaggtccgggcggaggtagtt 4 >gi|6165741|gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 111 bits (56), Expect = 2e-22 Identities = 92/104 (88%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 |||||||||||||||||||| ||||| ||| ||| ||||||| |||||| ||||| ||| Sbjct: 107 gcgatgagcgaccacttgttgccgagcagggcgtggagcttgatgatgagctcgtcgtcg 48 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 ||| ||||||||||||||||||| ||||| || ||||||||||| Sbjct: 47 tcgccggtgaagttgccgcgcttgaggtccgggcggaggtagtt 4 >gi|18171701|gb|BM341541.1|BM341541 MEST336-D05.T3 ISUM5-RN Zea mays cDNA clone MEST336-D05 3', mRNA sequence Length = 597 Score = 109 bits (55), Expect = 8e-22 Identities = 64/67 (95%) Strand = Plus / Plus Query: 585 tgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgccttg 644 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 417 tgctggcacggcgggctgatgcagaggtccaggttgaggtcggggcacctgggcgccttg 476 Query: 645 gcggccg 651 |||||| Sbjct: 477 acggccg 483 Score = 109 bits (55), Expect = 8e-22 Identities = 158/193 (81%), Gaps = 12/193 (6%) Strand = Plus / Plus Query: 354 ttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcag 413 |||||||||||||||| |||||||| ||||| |||| || | ||||||||||| | || Sbjct: 189 ttcgttcacttcatctccaggcctctgaagtcgagcacgctggtcctgagccccaggaag 248 Query: 414 cggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctg 473 |||| |||||||||| |||||||||||| ||| |||||||| ||||||||| | Sbjct: 249 tggtgcccgttgctgc------agctgcacccggccgctcccttctgtccgcccaggccg 302 Query: 474 cagccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgc 533 ||||||| |||||| |||||||||||||||| ||||| || |||| |||||||| Sbjct: 303 cagccgaggcagag------gccgtggccgtggccgtggccggcctgcagcgcctcccgc 356 Query: 534 ttgacgacggcgg 546 ||||||||||||| Sbjct: 357 ttgacgacggcgg 369 Score = 54.0 bits (27), Expect = 4e-05 Identities = 48/55 (87%) Strand = Plus / Plus Query: 662 ttctgctgctgctgcggcggcggcgctggggctgggctggaacgagacggtggtc 716 |||||| || || ||| |||||| | ||||||||||||||||||||| ||||||| Sbjct: 521 ttctgcggcggcggcgacggcggtgttggggctgggctggaacgagatggtggtc 575 >gi|60338535|gb|DN205508.1|DN205508 MEST818_F10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 682 Score = 109 bits (55), Expect = 8e-22 Identities = 64/67 (95%) Strand = Plus / Plus Query: 585 tgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgccttg 644 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 472 tgctggcacggcgggctgatgcagaggtccaggttgaggtcggggcacctgggcgccttg 531 Query: 645 gcggccg 651 |||||| Sbjct: 532 acggccg 538 Score = 109 bits (55), Expect = 8e-22 Identities = 158/193 (81%), Gaps = 12/193 (6%) Strand = Plus / Plus Query: 354 ttcgttcacttcatcttgaggcctctaaagtccagcatgccgcccctgagccccaagcag 413 |||||||||||||||| |||||||| ||||| |||| || | ||||||||||| | || Sbjct: 244 ttcgttcacttcatctccaggcctctgaagtcgagcacgctggtcctgagccccaggaag 303 Query: 414 cggtggccgttgctgctgctgcagctgcacccgggcgcgcccttctggacgcccaggctg 473 |||| |||||||||| |||||||||||| ||| |||||||| ||||||||| | Sbjct: 304 tggtgcccgttgctgc------agctgcacccggccgctcccttctgtccgcccaggccg 357 Query: 474 cagccgaagcagagcgccccgccgtggccgtggccgcggccgcccagcagaacctcccgc 533 ||||||| |||||| |||||||||||||||| ||||| || |||| |||||||| Sbjct: 358 cagccgaggcagag------gccgtggccgtggccgtggccggcctgcagcgcctcccgc 411 Query: 534 ttgacgacggcgg 546 ||||||||||||| Sbjct: 412 ttgacgacggcgg 424 Score = 56.0 bits (28), Expect = 1e-05 Identities = 31/32 (96%) Strand = Plus / Plus Query: 742 ggcggtgcgtgacggggtcgatgcccctgccc 773 ||||||||||||||||||||||||| |||||| Sbjct: 651 ggcggtgcgtgacggggtcgatgccgctgccc 682 Score = 54.0 bits (27), Expect = 4e-05 Identities = 48/55 (87%) Strand = Plus / Plus Query: 662 ttctgctgctgctgcggcggcggcgctggggctgggctggaacgagacggtggtc 716 |||||| || || ||| |||||| | ||||||||||||||||||||| ||||||| Sbjct: 576 ttctgcggcggcggcgacggcggtgttggggctgggctggaacgagatggtggtc 630 >gi|6165687|gb|AF099375.1|AF099375 Zea mays clone ZmMYB3H101 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 109 bits (55), Expect = 8e-22 Identities = 94/107 (87%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 | || | ||||||||||||||||| | | | ||||||||||||||| Sbjct: 49 cctcctccgtgaagttgccgcgcttgatgcccggccggaggtagttg 3 >gi|6165687|gb|AF099375.1|AF099375 Zea mays clone ZmMYB3H101 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 109 bits (55), Expect = 8e-22 Identities = 94/107 (87%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 | || | ||||||||||||||||| | | | ||||||||||||||| Sbjct: 49 cctcctccgtgaagttgccgcgcttgatgcccggccggaggtagttg 3 >gi|71433862|gb|DR814912.1|DR814912 ZM_BFb0044M17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 845 Score = 107 bits (54), Expect = 3e-21 Identities = 162/198 (81%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| ||| || || ||||||| ||| | Sbjct: 437 cgtgttccagtagttcttgatctcgttgtccgtcctcccgggcaggtgcgcggccatgcg 378 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | | |||||| |||||||||| || Sbjct: 377 cgcccacttgttgccgagctgcgcgtggagctgggctatgaggagctcctcgtcggggga 318 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 317 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 258 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 257 gccgcagcgcagcaggcc 240 >gi|76020620|gb|DT947790.1|DT947790 ZM_BFb0136E02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 794 Score = 107 bits (54), Expect = 3e-21 Identities = 162/198 (81%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| ||| || || ||||||| ||| | Sbjct: 574 cgtgttccagtagttcttgatctcgttgtccgtcctcccgggcaggtgcgcggccatgcg 515 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | | |||||| |||||||||| || Sbjct: 514 cgcccacttgttgccgagctgcgcgtggagctgggctatgaggagctcctcgtcggggga 455 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 454 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 395 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 394 gccgcagcgcagcaggcc 377 >gi|76280856|gb|DV020424.1|DV020424 ZM_BFb0138L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 759 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 440 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 381 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 380 ggcagcgacctccaggacccctcgccgtgc 351 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 591 gtgcgagttccagtagttcttgatctcgttgtc 559 >gi|76285011|gb|DV024579.1|DV024579 ZM_BFb0144N04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 625 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 498 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 439 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 438 ggcagcgacctccaggacccctcgccgtgc 409 >gi|78080722|gb|DV509134.1|DV509134 ZM_BFb0188A21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 769 Score = 107 bits (54), Expect = 3e-21 Identities = 162/198 (81%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| ||| || || ||||||| ||| | Sbjct: 437 cgtgttccagtagttcttgatctcgttgtccgtcctcccgggcaggtgcgcggccatgcg 378 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | | |||||| |||||||||| || Sbjct: 377 cgcccacttgttgccgagctgcgcgtggagctgggctatgaggagctcctcgtcggggga 318 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 317 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 258 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 257 gccgcagcgcagcaggcc 240 >gi|78118144|gb|DV536531.1|DV536531 ZM_BFb0229B05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 858 Score = 107 bits (54), Expect = 3e-21 Identities = 162/198 (81%) Strand = Plus / Minus Query: 794 cgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgag 853 ||||||||||||||||||||||||||||||||||| ||| || || ||||||| ||| | Sbjct: 475 cgtgttccagtagttcttgatctcgttgtccgtcctcccgggcaggtgcgcggccatgcg 416 Query: 854 cgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggt 913 || ||||||||| ||||| | ||| |||| | | |||||| |||||||||| || Sbjct: 415 cgcccacttgttgccgagctgcgcgtggagctgggctatgaggagctcctcgtcggggga 356 Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||| ||| |||| ||| ||||||| |||| |||| ||||| ||||||||||| Sbjct: 355 gaaggagcccttcttgaggttggggcggaggtggttggtccagcgcaggcggcagctctt 296 Query: 974 gccgcaccgcagcaggcc 991 |||||| ||||||||||| Sbjct: 295 gccgcagcgcagcaggcc 278 >gi|88758164|gb|DY542305.1|DY542305 ZM_BFb0367M19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 784 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 495 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 436 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 435 ggcagcgacctccaggacccctcgccgtgc 406 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 646 gtgcgagttccagtagttcttgatctcgttgtc 614 >gi|91048267|gb|EB158685.1|EB158685 ZM_BFb0292D01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 841 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 460 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 401 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 400 ggcagcgacctccaggacccctcgccgtgc 371 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 611 gtgcgagttccagtagttcttgatctcgttgtc 579 >gi|168589|gb|M73028.1|MZEPPR Zea mays protein homologous to the DNA-binding domain of myb-like transcription factor mRNA, complete cds Length = 1802 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 652 gtgcgagttccagtagttcttgatctcgttgtc 620 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1241 ctgctgctgctgcgacggcggc 1262 >gi|168591|gb|M73029.1|MZEPPRA Zea mays myb-like transcription factor (P) protein mRNA, complete cds Length = 945 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 >gi|1491932|gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, complete cds Length = 1601 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 652 gtgcgagttccagtagttcttgatctcgttgtc 620 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1241 ctgctgctgctgcgacggcggc 1262 >gi|6165783|gb|AF099423.1|AF099423 Zea mays clone ZmMYBIP156 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 107 bits (54), Expect = 3e-21 Identities = 108/126 (85%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||| ||||| ||| || ||||||| || ||||||||||| ||||||||| |||||| Sbjct: 129 cgtccggcccggcagctgcccggcgatcagagaccacttgttgccgaggagggcgtgcag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 || |||||| |||||||||||| |||||||||| |||||||| ||||| |||||||| Sbjct: 69 gcggatgatgagctcgtcctcgtcgtcggtgaagttcccgcgcttgaggtccggccggag 10 Query: 944 gtagtt 949 |||||| Sbjct: 9 gtagtt 4 >gi|16507119|gb|AF427146.1|AF427146 Zea mays myb-like transcription factor (P) mRNA, complete cds Length = 1513 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 360 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 301 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 300 ggcagcgacctccaggacccctcgccgtgc 271 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 511 gtgcgagttccagtagttcttgatctcgttgtc 479 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1101 ctgctgctgctgcgacggcggc 1122 >gi|21207167|gb|AY104089.1| Zea mays PCO146624 mRNA sequence Length = 914 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 493 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 434 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 433 ggcagcgacctccaggacccctcgccgtgc 404 >gi|1491932|gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, complete cds Length = 1601 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 652 gtgcgagttccagtagttcttgatctcgttgtc 620 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1241 ctgctgctgctgcgacggcggc 1262 >gi|168591|gb|M73029.1|MZEPPRA Zea mays myb-like transcription factor (P) protein mRNA, complete cds Length = 945 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 >gi|168589|gb|M73028.1|MZEPPR Zea mays protein homologous to the DNA-binding domain of myb-like transcription factor mRNA, complete cds Length = 1802 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 501 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 442 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 441 ggcagcgacctccaggacccctcgccgtgc 412 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 652 gtgcgagttccagtagttcttgatctcgttgtc 620 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1241 ctgctgctgctgcgacggcggc 1262 >gi|21207167|gb|AY104089.1| Zea mays PCO146624 mRNA sequence Length = 914 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 493 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 434 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 433 ggcagcgacctccaggacccctcgccgtgc 404 >gi|16507119|gb|AF427146.1|AF427146 Zea mays myb-like transcription factor (P) mRNA, complete cds Length = 1513 Score = 107 bits (54), Expect = 3e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||| Sbjct: 360 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcctgcattcttg 301 Query: 1002 ggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||| |||| |||| ||||||||| Sbjct: 300 ggcagcgacctccaggacccctcgccgtgc 271 Score = 58.0 bits (29), Expect = 3e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||||||||||||||| Sbjct: 511 gtgcgagttccagtagttcttgatctcgttgtc 479 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 664 ctgctgctgctgcggcggcggc 685 |||||||||||||| ||||||| Sbjct: 1101 ctgctgctgctgcgacggcggc 1122 >gi|6165783|gb|AF099423.1|AF099423 Zea mays clone ZmMYBIP156 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 107 bits (54), Expect = 3e-21 Identities = 108/126 (85%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||| ||||| ||| || ||||||| || ||||||||||| ||||||||| |||||| Sbjct: 129 cgtccggcccggcagctgcccggcgatcagagaccacttgttgccgaggagggcgtgcag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 || |||||| |||||||||||| |||||||||| |||||||| ||||| |||||||| Sbjct: 69 gcggatgatgagctcgtcctcgtcgtcggtgaagttcccgcgcttgaggtccggccggag 10 Query: 944 gtagtt 949 |||||| Sbjct: 9 gtagtt 4 >gi|40336064|gb|CK370134.1|CK370134 zmrws485_0B20-002-g06.s0 zmrws485 Zea mays cDNA 5', mRNA sequence Length = 421 Score = 105 bits (53), Expect = 1e-20 Identities = 161/197 (81%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||||||| ||||||||||||||||||||||| |||||| || | || ||||| Sbjct: 415 gtgcgtgttccacacgttcttgatctcgttgtccgtcctccccggcaggcaggcagcgat 356 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 ||||| || |||||||| | | ||||||| | | |||| || ||||| ||| | Sbjct: 355 cttagaccatttattcccgagcaacccgtgcagccttatgatggcctcctcctcctcgtc 296 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 |||||||||||||||||| ||||| ||||| |||||||||||||| ||||||| |||||| Sbjct: 295 ggtgaagttgccgcgcttgaggtccggccgcaggtagttgatccagcgcagcctgcagct 236 Query: 971 cttgccgcaccgcagca 987 ||| || || ||||||| Sbjct: 235 cttcccacagcgcagca 219 >gi|86474682|gb|DY241052.1|DY241052 ZM_BFb0261D14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 673 Score = 105 bits (53), Expect = 1e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 1037 gatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgcgc 1096 |||||| |||||||| || || |||||||||||||| |||||||||||||| |||||||| Sbjct: 666 gatgtacgccaccagacggtcttcctcctccttggtgcacgcgcccctgttcgtgtgcgc 607 Query: 1097 cttctcgcagcagggcgaccgcccc 1121 |||||||||||| ||||||| |||| Sbjct: 606 cttctcgcagcacggcgacctcccc 582 >gi|6165675|gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 105 bits (53), Expect = 1e-20 Identities = 110/129 (85%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||||||||| ||| | |||||||| |||||||||||||| ||||||| ||| || Sbjct: 129 cgtccgccccggcagctgggcggcgatcagcgaccacttgtttccgaggacctggtggag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||||| ||||||||| || |||||||||||||||||| |||||||| || || Sbjct: 69 cttgatgatgacgtcgtcctcctcctgggtgaagttgccgcgcttgaggtcggggcgcag 10 Query: 944 gtagttgat 952 ||||||||| Sbjct: 9 gtagttgat 1 >gi|6165779|gb|AF099421.1|AF099421 Zea mays clone ZmMYBIP126 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 105 bits (53), Expect = 1e-20 Identities = 95/109 (87%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 | || | | ||| || |||||||| |||||||| |||||||||||||| Sbjct: 49 cctcccccgggaatttcccgcgcttgaggtcggggcggaggtagttgat 1 >gi|309571|gb|L19496.1|MZETRACTB Zea mays transcriptional activator for anthocyanin synthesis gene, complete cds Length = 1893 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1075 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 1016 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1015 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 956 Query: 982 g 982 | Sbjct: 955 g 955 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 1246 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 1202 >gi|309569|gb|L19495.1| Zea mays transcriptional activator gene, complete cds Length = 7040 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 2226 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 2167 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 2166 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 2107 Query: 982 g 982 | Sbjct: 2106 g 2106 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 2437 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 2393 >gi|309567|gb|L19494.1|MZEPLTANSA Zea mays PL transcriptional activator gene, complete cds Length = 4439 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1184 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 1125 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1124 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 1065 Query: 982 g 982 | Sbjct: 1064 g 1064 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgat 814 ||||||||||||||||||| Sbjct: 1355 tgttccagtagttcttgat 1337 >gi|293899|gb|L13454.1|MZEPLBH Zea mays Pl-Bh (Blotched1) gene, complete cds Length = 3587 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1780 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 1721 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1720 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 1661 Query: 982 g 982 | Sbjct: 1660 g 1660 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgat 814 ||||||||||||||||||| Sbjct: 1951 tgttccagtagttcttgat 1933 >gi|88861838|gb|DQ394071.1| Zea mays non-functional purple plant 1 transcription factor (PL1) gene, PL1(ems9703) allele, partial cds Length = 530 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 393 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 334 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 333 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 274 Query: 982 g 982 | Sbjct: 273 g 273 >gi|88595887|gb|DQ379502.1| Zea mays PL1 transcription factor-like (pl1) gene, pl1-Rhoades (ems9711) allele, complete sequence Length = 466 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 392 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 333 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 332 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 273 Query: 982 g 982 | Sbjct: 272 g 272 >gi|88595885|gb|DQ379501.1| Zea mays PL1 transcription factor (pl1) gene, pl1-Rhoades (gamma9601) allele, partial cds Length = 508 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 391 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 332 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 331 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 272 Query: 982 g 982 | Sbjct: 271 g 271 >gi|88595883|gb|DQ379500.1| Zea mays PL1 transcription factor (pl1) gene, pl1-Rhoades (mum9802) allele, partial cds Length = 529 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 396 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 337 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 336 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 277 Query: 982 g 982 | Sbjct: 276 g 276 >gi|88595881|gb|DQ379499.1| Zea mays PL1 transcription factor (pl1) gene, pl1-Rhoades (mum9515) allele, partial cds Length = 527 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 394 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 335 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 334 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 275 Query: 982 g 982 | Sbjct: 274 g 274 >gi|46981892|gb|AY530952.1| Zea mays unknown (Z576C20.2), putative heme oxygenase 1 (Z576C20.3), anthocyanin biosynthesis regulatory protein Pl1_B73 (Z576C20.4), putative growth-regulating factor 1 (Z576C20.6), and putative aminoalcoholphosphotransferase (Z576C20.14) genes, complete cds; and putative receptor protein kinase (Z576C20.21) gene, partial cds Length = 155173 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Plus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 38757 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 38816 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 38817 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 38876 Query: 982 g 982 | Sbjct: 38877 g 38877 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Plus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 38550 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 38594 >gi|25989613|gb|AY135017.1| Zea mays PL transcription factor (pl) gene, pl-bol3c allele, complete cds Length = 1647 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 867 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 808 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 807 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 748 Query: 982 g 982 | Sbjct: 747 g 747 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 1041 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 997 >gi|25989607|gb|AY135016.1| Zea mays PL transcription factor (pl) gene, pl-bo3b allele, complete cds Length = 1771 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 906 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 847 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 846 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 787 Query: 982 g 982 | Sbjct: 786 g 786 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 1080 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 1036 >gi|19548448|gb|AF470080.1| Zea mays P-type R2R3 Myb protein (Myb23) gene, partial cds Length = 1576 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1344 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 1285 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1284 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 1225 Query: 982 g 982 | Sbjct: 1224 g 1224 >gi|6165779|gb|AF099421.1|AF099421 Zea mays clone ZmMYBIP126 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 105 bits (53), Expect = 1e-20 Identities = 95/109 (87%) Strand = Plus / Minus Query: 844 cggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcct 903 ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||| Sbjct: 109 cggcgatcagggaccacttgttgccgaggacgctgtgcagcttgacgatgagctcgtcct 50 Query: 904 cgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 | || | | ||| || |||||||| |||||||| |||||||||||||| Sbjct: 49 cctcccccgggaatttcccgcgcttgaggtcggggcggaggtagttgat 1 >gi|6165675|gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 105 bits (53), Expect = 1e-20 Identities = 110/129 (85%) Strand = Plus / Minus Query: 824 cgtccgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcag 883 |||||||||||| ||| | |||||||| |||||||||||||| ||||||| ||| || Sbjct: 129 cgtccgccccggcagctgggcggcgatcagcgaccacttgtttccgaggacctggtggag 70 Query: 884 cttgacgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggag 943 ||||| ||||| ||||||||| || |||||||||||||||||| |||||||| || || Sbjct: 69 cttgatgatgacgtcgtcctcctcctgggtgaagttgccgcgcttgaggtcggggcgcag 10 Query: 944 gtagttgat 952 ||||||||| Sbjct: 9 gtagttgat 1 >gi|2343274|gb|AF015269.1|AF015269 Zea mays retrotransposon Magellan, complete sequence, and PL transcription factor (Pl) gene, complete cds Length = 3218 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 2358 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 2299 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 2298 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 2239 Query: 982 g 982 | Sbjct: 2238 g 2238 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 2566 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 2522 >gi|2343272|gb|AF015268.1|AF015268 Zea mays PL transcription factor (Pl) gene, promoter and complete cds Length = 1900 Score = 105 bits (53), Expect = 1e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1040 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 981 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 980 cgcgcttgatgttgggccggaggtagttcagccaccgcagccggcagctcttgccgcacc 921 Query: 982 g 982 | Sbjct: 920 g 920 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 1248 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 1204 >gi|19351084|gb|BM895616.1|BM895616 952076A07.y1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 450 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Plus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 257 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 316 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 317 tgccgcaccgcagcagcccggcttgcttgggcagcg 352 >gi|40335344|gb|CK369414.1|CK369414 zmrws485_0A10-004-c09.s0 zmrws485 Zea mays cDNA 5', mRNA sequence Length = 668 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 295 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 236 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 235 tgccgcaccgcagcagcccggcttgcttgggcagcg 200 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 417 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 358 Query: 851 g 851 | Sbjct: 357 g 357 >gi|71306457|gb|DR789376.1|DR789376 ZM_BFb0007O07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 687 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 376 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 317 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 316 tgccgcaccgcagcagcccggcttgcttgggcagcg 281 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 498 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 439 Query: 851 g 851 | Sbjct: 438 g 438 >gi|71417476|gb|DR804074.1|DR804074 ZM_BFb0029A02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 834 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 372 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 313 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 312 tgccgcaccgcagcagcccggcttgcttgggcagcg 277 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 494 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 435 Query: 851 g 851 | Sbjct: 434 g 434 >gi|71433798|gb|DR814848.1|DR814848 ZM_BFb0044L07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 847 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 353 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 294 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 293 tgccgcaccgcagcagcccggcttgcttgggcagcg 258 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 475 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 416 Query: 851 g 851 | Sbjct: 415 g 415 >gi|76933766|gb|DV173580.1|DV173580 ZM_BFb0176K09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 648 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 367 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 308 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 307 tgccgcaccgcagcagcccggcttgcttgggcagcg 272 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 489 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 430 Query: 851 g 851 | Sbjct: 429 g 429 >gi|76935837|gb|DV174489.1|DV174489 ZM_BFb0178D08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 784 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 379 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 320 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 319 tgccgcaccgcagcagcccggcttgcttgggcagcg 284 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 501 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 442 Query: 851 g 851 | Sbjct: 441 g 441 >gi|87153529|gb|DY398318.1|DY398318 III-952-11B-F08.M13-R UGIII-Reseq Zea mays cDNA, mRNA sequence Length = 430 Score = 103 bits (52), Expect = 5e-20 Identities = 70/76 (92%) Strand = Plus / Plus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 248 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 307 Query: 973 tgccgcaccgcagcag 988 |||||||||||||||| Sbjct: 308 tgccgcaccgcagcag 323 >gi|91874914|gb|EB404871.1|EB404871 ZM_BFb0314H11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 623 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 262 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 203 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 202 tgccgcaccgcagcagcccggcttgcttgggcagcg 167 Score = 65.9 bits (33), Expect = 1e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 |||||||| |||| ||||||||||||||||||||||||||| || |||| |||||||| Sbjct: 384 gtgcgtgtgccagacgttcttgatctcgttgtccgtccgcccgggcagcctggcggcgat 325 Query: 851 g 851 | Sbjct: 324 g 324 >gi|89143146|emb|AM156907.1| Zea mays mRNA for transcription factor MYB39 (myb39 gene) Length = 1078 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | |||||| || |||||||||||||| || || |||||||||| Sbjct: 362 tgaagttgccgcgcttgatgtcggggcgcaggtagttgatccagcggaggcggcagctct 303 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 ||||||| || |||||||||||| ||||||||||| Sbjct: 302 tgccgcagcggagcaggcccgcctgcttgggcagcg 267 Score = 54.0 bits (27), Expect = 4e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||||||| |||||| |||| Sbjct: 469 gttcttgatctcgttgtccgtcctccccggcagcc 435 >gi|89143146|emb|AM156907.1| Zea mays mRNA for transcription factor MYB39 (myb39 gene) Length = 1078 Score = 103 bits (52), Expect = 5e-20 Identities = 85/96 (88%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | |||||| || |||||||||||||| || || |||||||||| Sbjct: 362 tgaagttgccgcgcttgatgtcggggcgcaggtagttgatccagcggaggcggcagctct 303 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 ||||||| || |||||||||||| ||||||||||| Sbjct: 302 tgccgcagcggagcaggcccgcctgcttgggcagcg 267 Score = 54.0 bits (27), Expect = 4e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||||||| |||||| |||| Sbjct: 469 gttcttgatctcgttgtccgtcctccccggcagcc 435 >gi|6031337|gb|AW076194.1|AW076194 614064D10.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 548 Score = 101 bits (51), Expect = 2e-19 Identities = 69/75 (92%) Strand = Plus / Minus Query: 737 gatggggcggtgcgtgacggggtcgatgcccctgcccagcagcttccgccggacgtgcgt 796 |||||||||||| || || |||||||| ||||||| ||||||||||||||||| |||||| Sbjct: 75 gatggggcggtgtgtcaccgggtcgatccccctgctcagcagcttccgccggatgtgcgt 16 Query: 797 gttccagtagttctt 811 ||||||||||||||| Sbjct: 15 gttccagtagttctt 1 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 587 ctggcacggcgggctgatgcagaggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 183 ctggcacggcgggctgatgcagaggtccaggttcaggtcggggca 139 Score = 40.1 bits (20), Expect = 0.59 Identities = 23/24 (95%) Strand = Plus / Minus Query: 465 cccaggctgcagccgaagcagagc 488 ||||||||||||| |||||||||| Sbjct: 257 cccaggctgcagctgaagcagagc 234 >gi|18165209|gb|BM335048.1|BM335048 MEST144-H06.T3 ISUM5-RN Zea mays cDNA clone MEST144-H06 3', mRNA sequence Length = 557 Score = 101 bits (51), Expect = 2e-19 Identities = 63/67 (94%) Strand = Plus / Plus Query: 585 tgctggcacggcgggctgatgcagaggtcgaggttgaggtcggggcatctgggcgccttg 644 ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 417 tgctggcacggcgggctgatgcataggtccaggttgaggtcggggcacctgggcgccttg 476 Query: 645 gcggccg 651 |||||| Sbjct: 477 acggccg 483 Score = 91.7 bits (46), Expect = 2e-16 Identities = 99/117 (84%), Gaps = 6/117 (5%) Strand = Plus / Plus Query: 430 tgctgcagctgcacccgggcgcgcccttctggacgcccaggctgcagccgaagcagagcg 489 |||||||||||||||||| ||| |||||||| ||||||||| |||||||| ||| || Sbjct: 259 tgctgcagctgcacccggccgctcccttctgtccgcccaggccgcagccgaggcatag-- 316 Query: 490 ccccgccgtggccgtggccgcggccgcccagcagaacctcccgcttgacgacggcgg 546 |||||||||||||||| ||||| || |||| ||||||||||||||||||||| Sbjct: 317 ----gccgtggccgtggccgtggccggcctgcagcgcctcccgcttgacgacggcgg 369 >gi|6165751|gb|AF099407.1|AF099407 Zea mays clone ZmMYBIM42 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 101 bits (51), Expect = 2e-19 Identities = 93/107 (86%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 ||||| || ||||| ||||| ||||| |||||||| ||||||| |||||| |||||||| Sbjct: 107 gcgatcagggaccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcc 48 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 || | ||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 47 tcctccgtgaagttgccgcgcttgaggtcgggccgcaggtagttgat 1 >gi|29569833|gb|AY237128.1| Zea mays myb-related protein c1-I-2K1 mRNA, complete cds Length = 826 Score = 101 bits (51), Expect = 2e-19 Identities = 153/187 (81%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || || || || || || || |||| | || || |||| Sbjct: 328 tgttccagtagttcttgatttcattttctgttcggccaggcagcctgcctgcaatcagcg 269 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| ||||| || || |||||| || ||||||||| || || Sbjct: 268 accacctgttgccgaggagcctgtggaggcggatgatgagatcctcctcgtcgtaggaga 209 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||| | | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 208 tgttgccgcgcctgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 149 Query: 976 cgcaccg 982 ||||||| Sbjct: 148 cgcaccg 142 >gi|29569833|gb|AY237128.1| Zea mays myb-related protein c1-I-2K1 mRNA, complete cds Length = 826 Score = 101 bits (51), Expect = 2e-19 Identities = 153/187 (81%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcg 855 ||||||||||||||||||| || || || || || || || |||| | || || |||| Sbjct: 328 tgttccagtagttcttgatttcattttctgttcggccaggcagcctgcctgcaatcagcg 269 Query: 856 accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtga 915 ||||| |||| |||||||| ||||| || || |||||| || ||||||||| || || Sbjct: 268 accacctgttgccgaggagcctgtggaggcggatgatgagatcctcctcgtcgtaggaga 209 Query: 916 agttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgc 975 |||||||||| | | || ||||||||||||||| | ||||||||||||||||||||||| Sbjct: 208 tgttgccgcgcctgatgttgggccggaggtagttcagccaccgcagccggcagctcttgc 149 Query: 976 cgcaccg 982 ||||||| Sbjct: 148 cgcaccg 142 >gi|19072737|gb|AF474117.1| Zea mays typical P-type R2R3 Myb protein (Myb18) gene, partial cds Length = 1900 Score = 101 bits (51), Expect = 2e-19 Identities = 161/195 (82%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 786 cggacgtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcg 845 |||| ||||||||||||||||||||||||||||||||| |||||||| | ||| | | Sbjct: 1784 cggaggtgcgtgttccagtagttcttgatctcgttgtcggtccgcccggacagcttggtg 1725 Query: 846 gcgatgagcg-accacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctc 904 || ||| ||| |||| ||||||||||||||| ||| || | || ||||| | ||||| Sbjct: 1724 gcaatg-gcgcaccatttgttcccgaggagggagtggaggtggataatgagcttctcctc 1666 Query: 905 gtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccg 964 |||| |||||||| ||||||||| | ||| || |||||||||||| |||| || || || Sbjct: 1665 gtcgtcggtgaagcggccgcgcttaatgtccgggcggaggtagttggtccagcggaggcg 1606 Query: 965 gcagctcttgccgca 979 ||||||||||||||| Sbjct: 1605 gcagctcttgccgca 1591 >gi|6165751|gb|AF099407.1|AF099407 Zea mays clone ZmMYBIM42 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 101 bits (51), Expect = 2e-19 Identities = 93/107 (86%) Strand = Plus / Minus Query: 846 gcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcg 905 ||||| || ||||| ||||| ||||| |||||||| ||||||| |||||| |||||||| Sbjct: 107 gcgatcagggaccatttgttgccgagtaggctgtggagcttgatgatgagctcgtcctcc 48 Query: 906 tcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgat 952 || | ||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 47 tcctccgtgaagttgccgcgcttgaggtcgggccgcaggtagttgat 1 >gi|58082293|gb|AC155431.2| Zea mays strain B73 clone ZMMBBb0240E24, *** SEQUENCING IN PROGRESS ***, 28 unordered pieces Length = 225628 Score = 101 bits (51), Expect = 2e-19 Identities = 69/75 (92%) Strand = Plus / Minus Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| |||||||||| |||||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 5376 gaagctgccgcgcttgaggtcggggcggaggtagttgatccaccgcaggcggcagctctt 5317 Query: 974 gccgcaccgcagcag 988 |||||| ||| |||| Sbjct: 5316 gccgcagcgctgcag 5302 Score = 71.9 bits (36), Expect = 2e-10 Identities = 39/40 (97%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgg 835 |||||||| ||||||||||||||||||||||||||||||| Sbjct: 5687 tgttccagaagttcttgatctcgttgtccgtccgccccgg 5648 >gi|78116178|gb|DV534565.1|DV534565 ZM_BFb0226D11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 635 Score = 99.6 bits (50), Expect = 7e-19 Identities = 62/66 (93%) Strand = Plus / Minus Query: 1056 tcgtcctcctccttggtccacgcgcccctgttggtgtgcgccttctcgcagcagggcgac 1115 ||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| Sbjct: 630 tcgtcctcctccttggtccacgcgcccttgttcgtgtgcgccttctcgcagcacggcgac 571 Query: 1116 cgcccc 1121 | |||| Sbjct: 570 ctcccc 565 >gi|91876238|gb|EB406195.1|EB406195 ZM_BFb0316L22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 770 Score = 99.6 bits (50), Expect = 7e-19 Identities = 158/194 (81%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||| ||||||||||||||| |||| || || ||||| Sbjct: 574 gtgcgtgttccagtagttcttgacgtcgttgtccgtccgctccggcaggtacgacgcgat 515 Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910 | || |||| |||| ||||||||| || || | ||||||||| | ||||| | | Sbjct: 514 ggccgcccacctgttgccgaggagggcctggaggtggacgatgagcttctcctcctgctc 455 Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970 ||||||||||||||| | | | | ||||||||||||||| ||||||| ||||||||||| Sbjct: 454 cgtgaagttgccgcgcctgatgcccggccggaggtagttggtccaccgaagccggcagct 395 Query: 971 cttgccgcaccgca 984 ||||| |||||||| Sbjct: 394 cttgctgcaccgca 381 >gi|6165793|gb|AF099428.1|AF099428 Zea mays clone ZmMYBIP29 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 99.6 bits (50), Expect = 7e-19 Identities = 104/122 (85%) Strand = Plus / Minus Query: 828 cgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttg 887 |||||||| ||| || | |||||||||||||||||||| ||||| ||| ||| |||||| Sbjct: 125 cgccccggcagctgccccgcgatgagcgaccacttgttgccgagcagggcgtggagcttg 66 Query: 888 acgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtag 947 | ||||| ||||| |||||| | ||||||||||||||||| ||||| || ||||||||| Sbjct: 65 atgatgacctcgtcgtcgtcgtccgtgaagttgccgcgcttgaggtccgggcggaggtag 6 Query: 948 tt 949 || Sbjct: 5 tt 4 >gi|6165793|gb|AF099428.1|AF099428 Zea mays clone ZmMYBIP29 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 99.6 bits (50), Expect = 7e-19 Identities = 104/122 (85%) Strand = Plus / Minus Query: 828 cgccccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttg 887 |||||||| ||| || | |||||||||||||||||||| ||||| ||| ||| |||||| Sbjct: 125 cgccccggcagctgccccgcgatgagcgaccacttgttgccgagcagggcgtggagcttg 66 Query: 888 acgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtag 947 | ||||| ||||| |||||| | ||||||||||||||||| ||||| || ||||||||| Sbjct: 65 atgatgacctcgtcgtcgtcgtccgtgaagttgccgcgcttgaggtccgggcggaggtag 6 Query: 948 tt 949 || Sbjct: 5 tt 4 >gi|22491454|gb|BU051377.1|BU051377 1111042F08.y1 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 432 Score = 97.6 bits (49), Expect = 3e-18 Identities = 67/73 (91%) Strand = Plus / Plus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||||||| ||||||||||||| Sbjct: 258 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatccaccggagccggcagctct 317 Query: 973 tgccgcaccgcag 985 ||||||||||||| Sbjct: 318 tgccgcaccgcag 330 >gi|21212011|gb|AY108777.1| Zea mays PCO139596 mRNA sequence Length = 496 Score = 97.6 bits (49), Expect = 3e-18 Identities = 79/89 (88%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||| | ||| |||| | |||||||||||||| ||||||||||||||||||||||| Sbjct: 266 tcctcgtggtcggagaaggttccgcgcttcaggtccggccggaggtagttgatccaccgg 207 Query: 960 agccggcagctcttgccgcaccgcagcag 988 || ||||||||||||||||| ||| |||| Sbjct: 206 aggcggcagctcttgccgcagcgctgcag 178 >gi|21212011|gb|AY108777.1| Zea mays PCO139596 mRNA sequence Length = 496 Score = 97.6 bits (49), Expect = 3e-18 Identities = 79/89 (88%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||| | ||| |||| | |||||||||||||| ||||||||||||||||||||||| Sbjct: 266 tcctcgtggtcggagaaggttccgcgcttcaggtccggccggaggtagttgatccaccgg 207 Query: 960 agccggcagctcttgccgcaccgcagcag 988 || ||||||||||||||||| ||| |||| Sbjct: 206 aggcggcagctcttgccgcagcgctgcag 178 >gi|11229031|gb|AF315587.1|AF315587 Zea mays truncated PL protein (Pl) gene, pl-0 allele, complete cds Length = 1891 Score = 97.6 bits (49), Expect = 3e-18 Identities = 103/121 (85%) Strand = Plus / Minus Query: 862 tgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgc 921 |||| |||||||| |||| ||| ||||||||| || ||||||||| || || ||||| Sbjct: 1068 tgttgccgaggagcttgtggagccggacgatgagatcctcctcgtcgtaggagatgttgc 1009 Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||| | || ||||||||||||||| | |||||||| |||||||||||||||||||| Sbjct: 1008 cgcgcttgatgttgggccggaggtagttcagccaccgcaaccggcagctcttgccgcacc 949 Query: 982 g 982 | Sbjct: 948 g 948 Score = 42.1 bits (21), Expect = 0.15 Identities = 39/45 (86%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtccgtccgccccgggagcc 840 ||||||||||||||||||| || ||||| || || ||||| |||| Sbjct: 1243 tgttccagtagttcttgatttcattgtctgttcggcccggcagcc 1199 >gi|90704951|gb|AC184048.1| Zea mays chromosome UNK clone ZMMBBb-565J3; ZMMBBb0565J03, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 128029 Score = 97.6 bits (49), Expect = 3e-18 Identities = 79/89 (88%) Strand = Plus / Plus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||||| | ||| |||| | |||||||||||||| ||||||||||||||||||||||| Sbjct: 45344 tcctcgtggtcggagaaggttccgcgcttcaggtccggccggaggtagttgatccaccgg 45403 Query: 960 agccggcagctcttgccgcaccgcagcag 988 || ||||||||||||||||| ||| |||| Sbjct: 45404 aggcggcagctcttgccgcagcgctgcag 45432 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 669 gctgctgcggcggcggcg 686 |||||||||||||||||| Sbjct: 44505 gctgctgcggcggcggcg 44522 >gi|78086924|gb|DV515317.1|DV515317 ZM_BFb0197N12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 799 Score = 95.6 bits (48), Expect = 1e-17 Identities = 72/80 (90%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 696 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 755 Query: 851 gagcgaccacttgttcccga 870 | ||||||||||| |||| Sbjct: 756 catggaccacttgttgccga 775 >gi|5268628|gb|AI770592.1|AI770592 606054G05.x2 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 598 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 550 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 491 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 490 tcttgctgcaccgca 476 >gi|50326490|gb|CO521616.1|CO521616 3530_1_142_1_G02.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 624 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 575 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 516 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 515 tcttgctgcaccgca 501 >gi|71760965|gb|DR958902.1|DR958902 ZM_BFb0063G11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 636 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||| ||||||||||||||||||||||| || || ||| || | ||||| Sbjct: 560 gtgcgtgttccagtacttcttgatctcgttgtccgtccggccgggcagctgccccgcgat 619 Query: 851 gagcgaccacttgtt 865 ||||||||||||||| Sbjct: 620 gagcgaccacttgtt 634 Score = 38.2 bits (19), Expect = 2.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||| ||||||||||||||||| Sbjct: 294 aggtccaggttgaggtcggggca 316 >gi|71765330|gb|DR963267.1|DR963267 ZM_BFb0082C13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 747 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 568 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 509 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 508 tcttgctgcaccgca 494 Score = 65.9 bits (33), Expect = 1e-08 Identities = 42/45 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgg 835 ||||||||||||||||||||||| ||||||||||||||| |||| Sbjct: 687 gtgcgtgttccagtagttcttgaggtcgttgtccgtccgctccgg 643 >gi|78084620|gb|DV513013.1|DV513013 ZM_BFb0193P03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 821 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 575 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 516 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 515 tcttgctgcaccgca 501 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgg 835 |||||||||||||||||||||||| ||||||||||||||| |||| Sbjct: 694 gtgcgtgttccagtagttcttgatgtcgttgtccgtccgctccgg 650 >gi|86466328|gb|DY232699.1|DY232699 ZM_BFb0241P11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 738 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 539 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 480 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 479 tcttgctgcaccgca 465 Score = 73.8 bits (37), Expect = 4e-11 Identities = 43/45 (95%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgg 835 |||||||||||||||||||||||| ||||||||||||||| |||| Sbjct: 658 gtgcgtgttccagtagttcttgatgtcgttgtccgtccgctccgg 614 >gi|91874388|gb|EB404345.1|EB404345 ZM_BFb0313I04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 841 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 689 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 630 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 629 tcttgctgcaccgca 615 >gi|19548460|gb|AF470086.1| Zea mays P-type R2R3 Myb protein (Myb36) gene, partial cds Length = 593 Score = 93.7 bits (47), Expect = 5e-17 Identities = 68/75 (90%) Strand = Plus / Minus Query: 910 cggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagc 969 ||||||||||||||||||| | | | ||||||||||||||| |||||||||| ||||||| Sbjct: 457 cggtgaagttgccgcgcttgatgcccggccggaggtagttggtccaccgcagacggcagc 398 Query: 970 tcttgccgcaccgca 984 |||||| |||||||| Sbjct: 397 tcttgctgcaccgca 383 >gi|60339598|gb|DN206571.1|DN206571 MEST835_F11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 651 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 172 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 113 Query: 851 gagcgaccac 860 || |||||| Sbjct: 112 cagagaccac 103 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Minus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 393 aggtcgaggttgaggtcggggca 371 >gi|71323538|gb|DR798430.1|DR798430 ZM_BFb0020P04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 689 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Plus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 448 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 507 Query: 851 gagcgaccac 860 || |||||| Sbjct: 508 cagagaccac 517 Score = 58.0 bits (29), Expect = 3e-06 Identities = 59/69 (85%) Strand = Plus / Plus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| ||||||||| |||||| || |||||| |||||||||||| ||||||||| Sbjct: 621 acttgttgccgaggagggcgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 680 Query: 919 tgccgcgct 927 | ||||||| Sbjct: 681 tcccgcgct 689 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Plus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 227 aggtcgaggttgaggtcggggca 249 >gi|71323539|gb|DR798431.1|DR798431 ZM_BFb0020P04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 689 Score = 91.7 bits (46), Expect = 2e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||||||| Sbjct: 242 gtgcgtgttccagtagttcttgatctcgttgtccgtccggcccggcagctgcccggcgat 183 Query: 851 gagcgaccac 860 || |||||| Sbjct: 182 cagagaccac 173 Score = 58.0 bits (29), Expect = 3e-06 Identities = 59/69 (85%) Strand = Plus / Minus Query: 859 acttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagt 918 ||||||| ||||||||| |||||| || |||||| |||||||||||| ||||||||| Sbjct: 69 acttgttgccgaggagggcgtgcaggcggatgatgagctcgtcctcgtcgtcggtgaagt 10 Query: 919 tgccgcgct 927 | ||||||| Sbjct: 9 tcccgcgct 1 Score = 46.1 bits (23), Expect = 0.010 Identities = 23/23 (100%) Strand = Plus / Minus Query: 609 aggtcgaggttgaggtcggggca 631 ||||||||||||||||||||||| Sbjct: 463 aggtcgaggttgaggtcggggca 441 >gi|6165709|gb|AF099386.1|AF099386 Zea mays clone ZmMYBIF14 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 49/50 (98%) Strand = Plus / Minus Query: 902 ctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttga 951 ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 51 ctcgtcggcggtgaagttgccgcgcttcacgtcgggccggaggtagttga 2 >gi|6165729|gb|AF099396.1|AF099396 Zea mays clone ZmMYBIF41 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 103/122 (84%) Strand = Plus / Minus Query: 831 cccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||||| |||| | |||||||||||||||||||||| |||| ||| ||| | ||||| | Sbjct: 122 cccggcagcctcccggcgatgagcgaccacttgttgccgaagagctcgtggaacttgatg 63 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 |||||||| ||||| || ||||||||||||||||||| ||||| || || ||||||||| Sbjct: 62 atgaggtcatcctcctcctcggtgaagttgccgcgcttgaggtccgggcgcaggtagttg 3 Query: 951 at 952 || Sbjct: 2 at 1 >gi|6165765|gb|AF099414.1|AF099414 Zea mays clone ZmMYBIM66 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 103/122 (84%) Strand = Plus / Minus Query: 831 cccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||||| |||| | ||||||||||||||||||||| |||| ||| ||| | ||||| | Sbjct: 122 cccggcagcctcccggcgatgagcgaccacttgtcgccgaagagctcgtggaacttgatg 63 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 |||||||| ||||| || | ||||||||||||||||| |||||||| |||||||||||| Sbjct: 62 atgaggtcatcctcctcctccgtgaagttgccgcgcttgaggtcggggcggaggtagttg 3 Query: 951 at 952 || Sbjct: 2 at 1 >gi|517491|emb|X78845.1|ZM1G12 Z.Mays Zm1 gene, introns 1 and 2 Length = 3270 Score = 91.7 bits (46), Expect = 2e-16 Identities = 67/74 (90%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||| ||| ||||||||||||||||||| ||||| ||||| |||||||||||||| ||| Sbjct: 1280 tcctcctcgtcggtgaagttgccgcgcttgaggtccggccgcaggtagttgatccagcgc 1221 Query: 960 agccggcagctctt 973 |||| ||||||||| Sbjct: 1220 agcctgcagctctt 1207 Score = 58.0 bits (29), Expect = 3e-06 Identities = 41/45 (91%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgg 835 |||||||||||| ||||||||||||||||||||||| |||||| Sbjct: 1508 gtgcgtgttccacacgttcttgatctcgttgtccgtcctccccgg 1464 >gi|11526772|gb|AF210616.1|AF210616 Zea mays P2 protein (P2) gene, complete cds Length = 12634 Score = 91.7 bits (46), Expect = 2e-16 Identities = 52/54 (96%) Strand = Plus / Minus Query: 938 ccggaggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcc 991 ||||||||||||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 5018 ccggaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 4965 Score = 50.1 bits (25), Expect = 6e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| ||||||||||||||| ||||||||||| Sbjct: 8979 gtgcgagttccagtagttcttaatctcgttgtc 8947 Score = 44.1 bits (22), Expect = 0.038 Identities = 31/34 (91%) Strand = Plus / Minus Query: 998 cttgggcagcgaccgccagcacccttcgccgtgc 1031 |||||||||||||| |||| |||| ||||||||| Sbjct: 4835 cttgggcagcgacctccaggacccctcgccgtgc 4802 >gi|6165765|gb|AF099414.1|AF099414 Zea mays clone ZmMYBIM66 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 103/122 (84%) Strand = Plus / Minus Query: 831 cccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||||| |||| | ||||||||||||||||||||| |||| ||| ||| | ||||| | Sbjct: 122 cccggcagcctcccggcgatgagcgaccacttgtcgccgaagagctcgtggaacttgatg 63 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 |||||||| ||||| || | ||||||||||||||||| |||||||| |||||||||||| Sbjct: 62 atgaggtcatcctcctcctccgtgaagttgccgcgcttgaggtcggggcggaggtagttg 3 Query: 951 at 952 || Sbjct: 2 at 1 >gi|6165729|gb|AF099396.1|AF099396 Zea mays clone ZmMYBIF41 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 103/122 (84%) Strand = Plus / Minus Query: 831 cccgggagccgcgcggcgatgagcgaccacttgttcccgaggaggctgtgcagcttgacg 890 ||||| |||| | |||||||||||||||||||||| |||| ||| ||| | ||||| | Sbjct: 122 cccggcagcctcccggcgatgagcgaccacttgttgccgaagagctcgtggaacttgatg 63 Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 |||||||| ||||| || ||||||||||||||||||| ||||| || || ||||||||| Sbjct: 62 atgaggtcatcctcctcctcggtgaagttgccgcgcttgaggtccgggcgcaggtagttg 3 Query: 951 at 952 || Sbjct: 2 at 1 >gi|6165709|gb|AF099386.1|AF099386 Zea mays clone ZmMYBIF14 R2R3MYB-domain protein mRNA, partial cds Length = 129 Score = 91.7 bits (46), Expect = 2e-16 Identities = 49/50 (98%) Strand = Plus / Minus Query: 902 ctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttga 951 ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 51 ctcgtcggcggtgaagttgccgcgcttcacgtcgggccggaggtagttga 2 >gi|22213|emb|X52201.1|ZMC1I Z.mays C1-I gene Length = 2204 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 954 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 895 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 894 cagccaccgcagccggcagctcttgccgcaccg 862 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgat 814 ||||||||||||||||||| Sbjct: 1190 tgttccagtagttcttgat 1172 >gi|22212|emb|X06333.1|ZMC1 Z.mays DNA for c1 locus Length = 4060 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 1400 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 1341 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 1340 cagccaccgcagccggcagctcttgccgcaccg 1308 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 1640 tgttccagtagttcttgatttcattgtc 1613 >gi|168514|gb|M37153.1|MZEMYBAA Z.mays c1 locus myb homologue cDNA, exons 1-3 Length = 4059 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 1400 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 1341 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 1340 cagccaccgcagccggcagctcttgccgcaccg 1308 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 1640 tgttccagtagttcttgatttcattgtc 1613 >gi|38230583|gb|AF320614.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1170 allele, complete cds Length = 6669 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 2659 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 2600 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 2599 cagccaccgcagccggcagctcttgccgcaccg 2567 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 2899 tgttccagtagttcttgatttcattgtc 2872 >gi|38230582|gb|AF320613.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1162 allele, complete cds Length = 6666 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 2661 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 2602 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 2601 cagccaccgcagccggcagctcttgccgcaccg 2569 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 2901 tgttccagtagttcttgatttcattgtc 2874 >gi|15042117|gb|AF292545.1|AF292545 Zea mays subsp. parviglumis PI331783 CI protein (c1) gene, partial cds Length = 740 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 495 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 436 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 435 cagccaccgcagccggcagctcttgccgcaccg 403 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 728 tgttccagtagttcttgatttcattgtc 701 >gi|15042115|gb|AF292544.1|AF292544 Zea mays subsp. parviglumis M063 CI protein (c1) gene, partial cds Length = 754 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 494 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 435 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 434 cagccaccgcagccggcagctcttgccgcaccg 402 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 742 tgttccagtagttcttgatttcattgtc 715 >gi|15042113|gb|AF292543.1|AF292543 Zea mays subsp. parviglumis M106 CI protein (c1) gene, partial cds Length = 761 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 509 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 450 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 449 cagccaccgcagccggcagctcttgccgcaccg 417 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 749 tgttccagtagttcttgatttcattgtc 722 >gi|15042111|gb|AF292542.1|AF292542 Zea mays subsp. parviglumis PI31788 CI protein (c1) gene, partial cds Length = 747 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 498 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 439 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 438 cagccaccgcagccggcagctcttgccgcaccg 406 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 735 tgttccagtagttcttgatttcattgtc 708 >gi|15042109|gb|AF292541.1|AF292541 Zea mays subsp. parviglumis PI133783 CI protein (c1) gene, partial cds Length = 740 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 495 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 436 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 435 cagccaccgcagccggcagctcttgccgcaccg 403 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 728 tgttccagtagttcttgatttcattgtc 701 >gi|15042107|gb|AF292540.1|AF292540 Zea mays subsp. parviglumis PI384061 CI protein (c1) gene, partial cds Length = 740 Score = 89.7 bits (45), Expect = 7e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 890 gatgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagtt 949 |||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 495 gatgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagtt 436 Query: 950 gatccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 435 cagccaccgcagccggcagctcttgccgcaccg 403 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 728 tgttccagtagttcttgatttcattgtc 701 >gi|57790136|gb|AC149815.2| Zea mays clone ZMMBBb0305O08, *** SEQUENCING IN PROGRESS ***, 9 ordered pieces Length = 137065 Score = 89.7 bits (45), Expect = 7e-16 Identities = 78/89 (87%) Strand = Plus / Plus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 |||||||||| ||||| ||||| ||||| ||||| |||||||||||||| | ||||||| Sbjct: 127467 tcctcgtcgggggtgatcttgccccgcttgaggtccggccggaggtagttcacccaccgc 127526 Query: 960 agccggcagctcttgccgcaccgcagcag 988 |||||||||||||| |||| |||| |||| Sbjct: 127527 agccggcagctcttcccgctccgccgcag 127555 Score = 63.9 bits (32), Expect = 4e-08 Identities = 35/36 (97%) Strand = Plus / Plus Query: 800 ccagtagttcttgatctcgttgtccgtccgccccgg 835 ||||||||||||||||||||||||||||| |||||| Sbjct: 127112 ccagtagttcttgatctcgttgtccgtcctccccgg 127147 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 424 tgctgctgctgcagctgc 441 |||||||||||||||||| Sbjct: 126978 tgctgctgctgcagctgc 126995 >gi|19436176|gb|BM952586.1|BM952586 952076A07.x1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 373 Score = 87.7 bits (44), Expect = 3e-15 Identities = 84/96 (87%), Gaps = 1/96 (1%) Strand = Plus / Minus Query: 913 tgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctct 972 |||||||||||||||| | ||| || || ||||||||||||| ||| ||||||||||||| Sbjct: 133 tgaagttgccgcgcttgatgtccgggcgcaggtagttgatcc-ccggagccggcagctct 75 Query: 973 tgccgcaccgcagcaggcccgccgccttgggcagcg 1008 |||||||||||||||| || || ||||||||||| Sbjct: 74 tgccgcaccgcagcagcccggcttgcttgggcagcg 39 >gi|71774057|gb|DR971943.1|DR971943 ZM_BFb0094O01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 634 Score = 87.7 bits (44), Expect = 3e-15 Identities = 59/64 (92%) Strand = Plus / Minus Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973 |||| ||||| |||||||| | |||||||||||||||||||||||||||| ||||||||| Sbjct: 326 gaaggtgccgtgcttcaggcccggccggaggtagttgatccaccgcagcctgcagctctt 267 Query: 974 gccg 977 |||| Sbjct: 266 gccg 263 >gi|46981881|gb|AY530950.1| Zea mays putative zinc finger protein (Z438D03.1), unknown (Z438D03.5), epsilon-COP (Z438D03.6), putative kinase (Z438D03.7), unknown (Z438D03.25), and C1-B73 (Z438D03.27) genes, complete cds Length = 185988 Score = 87.7 bits (44), Expect = 3e-15 Identities = 80/92 (86%) Strand = Plus / Plus Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 ||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 158174 atgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagttc 158233 Query: 951 atccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 158234 agccaccgcagccggcagctcttgccgcaccg 158265 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Plus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 157929 tgttccagtagttcttgatttcattgtc 157956 >gi|19072745|gb|AF474121.1| Zea mays typical P-type R2R3 Myb protein (Myb37) gene, partial cds Length = 1748 Score = 87.7 bits (44), Expect = 3e-15 Identities = 80/92 (86%) Strand = Plus / Minus Query: 891 atgaggtcgtcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttg 950 ||||| || ||||||||| || || |||||||||| | | || ||||||||||||||| Sbjct: 1296 atgagatcctcctcgtcgtaggagatgttgccgcgcctgatgttgggccggaggtagttc 1237 Query: 951 atccaccgcagccggcagctcttgccgcaccg 982 | |||||||||||||||||||||||||||||| Sbjct: 1236 agccaccgcagccggcagctcttgccgcaccg 1205 Score = 40.1 bits (20), Expect = 0.59 Identities = 26/28 (92%) Strand = Plus / Minus Query: 796 tgttccagtagttcttgatctcgttgtc 823 ||||||||||||||||||| || ||||| Sbjct: 1541 tgttccagtagttcttgatttcattgtc 1514 >gi|19072735|gb|AF474116.1| Zea mays typical P-type R2R3 Myb protein (Myb3) gene, partial cds Length = 2138 Score = 87.7 bits (44), Expect = 3e-15 Identities = 56/60 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850 ||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||| Sbjct: 1996 gtgcgtgttccagtagttcttgatctcgttgtccgtccggccagggagctgcgccgcgat 1937 Score = 75.8 bits (38), Expect = 1e-11 Identities = 56/62 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| | ||| |||||||||||||| |||||||||| |||||||||||||||||| Sbjct: 1519 ccgcgcttgatgtccggccggaggtagttcgtccaccgcagtcggcagctcttgccgcac 1460 Query: 981 cg 982 || Sbjct: 1459 cg 1458 >gi|5268844|gb|AI770808.1|AI770808 606058F03.x2 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 593 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 387 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 328 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 327 cgcagcaggcc 317 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 517 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 480 >gi|37417369|gb|CF646337.1|CF646337 3530_1_112_1_E06.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 335 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 321 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 262 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 261 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 202 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 201 tcctccttggtccac 187 >gi|50338321|gb|CO533447.1|CO533447 3530_1_220_1_A11.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 470 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 364 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 305 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 304 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 245 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 244 tcctccttggtccac 230 >gi|71299306|gb|DR785666.1|DR785666 ZM_BFb0002E13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 856 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 474 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 415 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 414 cgcagcaggcc 404 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 604 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 567 >gi|71304173|gb|DR788206.1|DR788206 ZM_BFb0006B24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 805 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 274 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 215 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 214 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 155 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 154 tcctccttggtccac 140 Score = 50.1 bits (25), Expect = 6e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| |||||||||||| |||||||||||||| Sbjct: 425 gtgcgagttccagtagtttttgatctcgttgtc 393 >gi|71436530|gb|DR817580.1|DR817580 ZM_BFb0051B11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 687 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 602 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 543 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 542 cgcagcaggcc 532 >gi|71438159|gb|DR819209.1|DR819209 ZM_BFb0055F10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 626 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 279 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 220 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 219 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 160 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 159 tcctccttggtccac 145 Score = 50.1 bits (25), Expect = 6e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| |||||||||||| |||||||||||||| Sbjct: 430 gtgcgagttccagtagtttttgatctcgttgtc 398 >gi|78090893|gb|DV519267.1|DV519267 ZM_BFb0203J22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 532 Score = 85.7 bits (43), Expect = 1e-14 Identities = 73/83 (87%) Strand = Plus / Minus Query: 900 tcctcgtcggcggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgc 959 ||||| ||||| |||||| |||||||| | ||| ||||||||||||||| |||||||| Sbjct: 452 tcctcctcggctgtgaagggcccgcgcttgatgtccggccggaggtagttggtccaccgc 393 Query: 960 agccggcagctcttgccgcaccg 982 || |||||||||||||||||||| Sbjct: 392 agtcggcagctcttgccgcaccg 370 >gi|78111891|gb|DV530288.1|DV530288 ZM_BFb0220A08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 569 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 510 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 509 cgcagcaggcc 499 Score = 38.2 bits (19), Expect = 2.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 806 gttcttgatctcgttgtccgtcc 828 |||||||||||||||||| |||| Sbjct: 684 gttcttgatctcgttgtcagtcc 662 >gi|78120398|gb|DV538782.1|DV538782 ZM_BFb0232F19.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 743 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 338 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 279 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 278 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 219 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 218 tcctccttggtccac 204 Score = 50.1 bits (25), Expect = 6e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| |||||||||||| |||||||||||||| Sbjct: 489 gtgcgagttccagtagtttttgatctcgttgtc 457 >gi|78122337|gb|DV540721.1|DV540721 ZM_BFb0235C23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 623 Score = 85.7 bits (43), Expect = 1e-14 Identities = 61/67 (91%) Strand = Plus / Minus Query: 922 cgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcacc 981 ||||||||||||| ||||||||||||||||||| ||| || ||||||||||||||||| | Sbjct: 190 cgcgcttcaggtccggccggaggtagttgatcccccggaggcggcagctcttgccgcagc 131 Query: 982 gcagcag 988 || |||| Sbjct: 130 gctgcag 124 >gi|91049867|gb|EB160285.1|EB160285 ZM_BFb0298A24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 803 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 596 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 537 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 536 cgcagcaggcc 526 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 726 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 689 >gi|28610109|gb|AF521880.1| Zea mays R2R3 Myb transcription factor MYB-IF35 mRNA, complete cds Length = 1038 Score = 85.7 bits (43), Expect = 1e-14 Identities = 112/135 (82%) Strand = Plus / Minus Query: 942 aggtagttgatccaccgcagccggcagctcttgccgcaccgcagcaggcccgccgccttg 1001 |||||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 182 aggtagttgatccaccgcagcctgcagctcttcccgcaccgcagcagcccggcattcttg 123 Query: 1002 ggcagcgaccgccagcacccttcgccgtgcgcgcggatgtaggccaccaggcgctcgtcc 1061 ||||| |||| ||| | ||||| |||||| | |||||| | ||||| ||||||| Sbjct: 122 ggcagtgacctccacgatccttccccgtgctccttgatgtacctcgccaggacctcgtcc 63 Query: 1062 tcctccttggtccac 1076 ||||||||||||||| Sbjct: 62 tcctccttggtccac 48 Score = 50.1 bits (25), Expect = 6e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtc 823 ||||| |||||||||||| |||||||||||||| Sbjct: 333 gtgcgagttccagtagtttttgatctcgttgtc 301 >gi|21216231|gb|AY111641.1| Zea mays CL1341_1 mRNA sequence Length = 608 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 392 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 333 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 332 cgcagcaggcc 322 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 522 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 485 >gi|42794335|gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, complete cds Length = 1417 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 387 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 328 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 327 cgcagcaggcc 317 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 517 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 480 >gi|42794337|gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, complete cds Length = 1164 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 387 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 328 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 327 cgcagcaggcc 317 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 517 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 480 >gi|42794337|gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, complete cds Length = 1164 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 387 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 328 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 327 cgcagcaggcc 317 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 517 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 480 >gi|42794335|gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, complete cds Length = 1417 Score = 85.7 bits (43), Expect = 1e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 921 ccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcac 980 |||||||| ||||| || |||||||||||| |||| ||||| ||||||||||||||||| Sbjct: 387 ccgcgcttgaggtccgggcggaggtagttggtccagcgcaggcggcagctcttgccgcag 328 Query: 981 cgcagcaggcc 991 ||||||||||| Sbjct: 327 cgcagcaggcc 317 Score = 60.0 bits (30), Expect = 6e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtcc 828 |||||||||||||| |||||||||||||||||| |||| Sbjct: 517 gtgcgtgttccagtggttcttgatctcgttgtcagtcc 480 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 921,149 Number of Sequences: 836351 Number of extensions: 921149 Number of successful extensions: 135580 Number of sequences better than 10.0: 2029 Number of HSP's better than 10.0 without gapping: 2024 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 128920 Number of HSP's gapped (non-prelim): 6461 length of query: 1121 length of database: 669,372,029 effective HSP length: 19 effective length of query: 1102 effective length of database: 653,481,360 effective search space: 720136458720 effective search space used: 720136458720 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)