BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 2823202.2.1 (529 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|5325042|gb|AI783233.1|AI783233 614007D09.x2 614 - root cDNA l... 1005 0.0 gi|78023033|gb|DV491420.1|DV491420 1000043-F02.T7-1 UGI-Reseq Ze... 1003 0.0 gi|5770159|gb|AI973333.1|AI973333 614007D09.x3 614 - root cDNA l... 985 0.0 gi|15427118|gb|BI542940.1|BI542940 949074G12.x2 949 - Juvenile l... 979 0.0 gi|45848087|gb|CN072030.1|CN072030 1021023G12.x1 1021 - Unigene ... 952 0.0 gi|5846854|gb|AI999937.1|AI999937 614007D09.y1 614 - root cDNA l... 938 0.0 gi|56382502|gb|CV985171.1|CV985171 EST4708 Zea mays embryo sac c... 823 0.0 gi|37378501|gb|CF625942.1|CF625942 zmrws05_0B10-007-g05.s1 zmrws... 821 0.0 gi|37380671|gb|CF627162.1|CF627162 zmrws05_0B20-007-g05.s1 zmrws... 821 0.0 gi|86468225|gb|DY234595.1|DY234595 ZM_BFb0244M24.f ZM_BFb Zea ma... 777 0.0 gi|32850685|gb|CD990366.1|CD990366 QAW3a01.yg QAW Zea mays cDNA ... 674 0.0 gi|21211581|gb|AY108503.1| Zea mays PCO102923 mRNA sequence 613 e-173 gi|21211581|gb|AY108503.1| Zea mays PCO102923 mRNA sequence 613 e-173 gi|6022526|gb|AW067559.1|AW067559 614040D03.y1 614 - root cDNA l... 593 e-168 gi|15353077|gb|BI502688.1|BI502688 949074G12.x1 949 - Juvenile l... 519 e-145 gi|71773137|gb|DR971051.1|DR971051 ZM_BFb0093J07.f ZM_BFb Zea ma... 517 e-145 gi|78108175|gb|DV526593.1|DV526593 ZM_BFb0214E12.f ZM_BFb Zea ma... 462 e-128 gi|78108176|gb|DV526594.1|DV526594 ZM_BFb0214E12.r ZM_BFb Zea ma... 462 e-128 gi|5714304|gb|AI944289.1|AI944289 614040D03.x1 614 - root cDNA l... 391 e-107 gi|71773138|gb|DR971052.1|DR971052 ZM_BFb0093J07.r ZM_BFb Zea ma... 357 9e-97 gi|4299140|gb|AI438862.1|AI438862 486013H05.x1 486 - leaf primor... 36 4.3 gi|4574115|gb|AI587674.1|AI587674 486013H10.x2 486 - leaf primor... 36 4.3 gi|4628304|gb|AI619178.1|AI619178 486086E06.x1 486 - leaf primor... 36 4.3 gi|4646706|gb|AI491569.2|AI491569 486024G03.x1 486 - leaf primor... 36 4.3 gi|4804355|gb|AI666221.1|AI666221 606006D10.x1 606 - Ear tissue ... 36 4.3 gi|4827743|gb|AI668435.1|AI668435 605032C11.x1 605 - Endosperm c... 36 4.3 gi|5124438|gb|AI746174.1|AI746174 605082B02.x1 605 - Endosperm c... 36 4.3 gi|5439319|gb|AI820240.1|AI820240 605087G07.x3 605 - Endosperm c... 36 4.3 gi|5499316|gb|AI855183.1|AI855183 603009E12.x1 603 - stressed ro... 36 4.3 gi|5688733|gb|AI941748.1|AI941748 618034F03.x1 618 - Inbred Tass... 36 4.3 gi|6653878|gb|AW267283.1|AW267283 618061D12.x1 618 - Inbred Tass... 36 4.3 gi|7844052|gb|AW787255.1|AW787255 945001E09.X1 945 - Mixed adult... 36 4.3 gi|7844469|gb|AW787691.1|AW787691 945001E09.X3 945 - Mixed adult... 36 4.3 gi|8665653|gb|BE186469.1|BE186469 946006G03.X3 946 - tassel prim... 36 4.3 gi|9028638|gb|BE238678.1|BE238678 946006G03.y1 946 - tassel prim... 36 4.3 gi|9254269|gb|BE344737.1|BE344737 946028E10.x1 946 - tassel prim... 36 4.3 gi|9254270|gb|BE344738.1|BE344738 946028E10.y1 946 - tassel prim... 36 4.3 gi|9254394|gb|BE344862.1|BE344862 946029E06.x1 946 - tassel prim... 36 4.3 gi|9254395|gb|BE344863.1|BE344863 946029E06.y1 946 - tassel prim... 36 4.3 gi|9254526|gb|BE344994.1|BE344994 946030E09.x1 946 - tassel prim... 36 4.3 gi|9254527|gb|BE344995.1|BE344995 946030E09.y1 946 - tassel prim... 36 4.3 gi|9732720|gb|BE511472.1|BE511472 946061B03.y1 946 - tassel prim... 36 4.3 gi|9733597|gb|BE512349.1|BE512349 946069E06.x1 946 - tassel prim... 36 4.3 gi|9794827|gb|BE553135.1|BE553135 946089F06.x1 946 - tassel prim... 36 4.3 gi|9952100|gb|BE638683.1|BE638683 946012F06.y1 946 - tassel prim... 36 4.3 gi|14245058|gb|BG873640.1|BG873640 MEST8-D10.T7-1 ISUM3-TL Zea m... 36 4.3 gi|15632318|gb|BI679411.1|BI679411 949001D12.y1 949 - Juvenile l... 36 4.3 gi|17930776|gb|BM267736.1|BM267736 MEST371-D06.T3 ISUM5-RN Zea m... 36 4.3 gi|17930916|gb|BM267876.1|BM267876 MEST373-D09.T3 ISUM5-RN Zea m... 36 4.3 gi|18162183|gb|BM332022.1|BM332022 MEST174-B06.T3 ISUM5-RN Zea m... 36 4.3 gi|18162390|gb|BM332229.1|BM332229 MEST154-B03.T3 ISUM5-RN Zea m... 36 4.3 gi|18162942|gb|BM332781.1|BM332781 MEST177-E03.T3 ISUM5-RN Zea m... 36 4.3 gi|18163866|gb|BM333705.1|BM333705 MEST159-G04.T3 ISUM5-RN Zea m... 36 4.3 gi|18164983|gb|BM334822.1|BM334822 MEST142-F03.T3 ISUM5-RN Zea m... 36 4.3 gi|18165376|gb|BM335215.1|BM335215 MEST147-D06.T3 ISUM5-RN Zea m... 36 4.3 gi|18168825|gb|BM338665.1|BM338665 MEST230-D03.T3 ISUM5-RN Zea m... 36 4.3 gi|18174116|gb|BM349504.1|BM349504 MEST250-E10.T3 ISUM5-RN Zea m... 36 4.3 gi|18174289|gb|BM349677.1|BM349677 MEST254-A12.T3 ISUM5-RN Zea m... 36 4.3 gi|18174970|gb|BM350358.1|BM350358 MEST264-G01.T3 ISUM5-RN Zea m... 36 4.3 gi|18175029|gb|BM350417.1|BM350417 MEST265-G03.T3 ISUM5-RN Zea m... 36 4.3 gi|18175625|gb|BM350872.1|BM350872 MEST214-H06.T3 ISUM5-RN Zea m... 36 4.3 gi|18178187|gb|BM379397.1|BM379397 MEST505-A07.univ ISUM6 Zea ma... 36 4.3 gi|18178827|gb|BM380037.1|BM380037 MEST514-B02.univ ISUM6 Zea ma... 36 4.3 gi|18179286|gb|BM380496.1|BM380496 MEST520-G02.univ ISUM6 Zea ma... 36 4.3 gi|18180879|gb|BM382089.1|BM382089 MEST544-D12.univ ISUM6 Zea ma... 36 4.3 gi|18181140|gb|BM382350.1|BM382350 MEST548-C06.univ ISUM6 Zea ma... 36 4.3 gi|18181501|gb|BM382711.1|BM382711 MEST553-F09.univ ISUM6 Zea ma... 36 4.3 gi|20301493|gb|BQ164436.1|BQ164436 1091020C06.y3 1091 - Immature... 36 4.3 gi|20507442|gb|BQ279635.1|BQ279635 1091030B01.x2 1091 - Immature... 36 4.3 gi|21625996|gb|BQ620917.1|BQ620917 1091061G01.x1 1091 - Immature... 36 4.3 gi|21987335|gb|BQ778863.1|BQ778863 946114G12.y1 946 - tassel pri... 36 4.3 gi|21987662|gb|BQ779190.1|BQ779190 946117F03.x1 946 - tassel pri... 36 4.3 gi|21987663|gb|BQ779191.1|BQ779191 946117F03.y1 946 - tassel pri... 36 4.3 gi|26457404|gb|CA828987.1|CA828987 1114035H11.y2 1114 - Unigene ... 36 4.3 gi|28361659|gb|CB240015.1|CB240015 3529_1_16_1_G10.y_1 3529 - 2 ... 36 4.3 gi|28361847|gb|CB240203.1|CB240203 3529_1_20_1_G10.y_1 3529 - 2 ... 36 4.3 gi|28569023|gb|CB280898.1|CB280898 3529_1_16_1_H03.y_5 3529 - 2 ... 36 4.3 gi|28576137|gb|CB282029.1|CB282029 3529_1_16_1_H03.x_5 3529 - 2 ... 36 4.3 gi|28909651|gb|CB331034.1|CB331034 3529_1_28_1_C07.y_1 3529 - 2 ... 36 4.3 gi|28910085|gb|CB331254.1|CB331254 3529_1_35_1_C03.y_1 3529 - 2 ... 36 4.3 gi|28910995|gb|CB331718.1|CB331718 3529_1_35_1_C03.x_1 3529 - 2 ... 36 4.3 gi|28985477|gb|CB350659.1|CB350659 MEST254-A12.univ ISUM5-RN Zea... 36 4.3 gi|28911221|gb|BM333425.2|BM333425 MEST155-E11.T3 ISUM5-RN Zea m... 36 4.3 gi|28911374|gb|BM340856.2|BM340856 MEST326-G12.T3 ISUM5-RN Zea m... 36 4.3 gi|28911384|gb|BM341179.2|BM341179 MEST331-D10.T3 ISUM5-RN Zea m... 36 4.3 gi|30031556|gb|CB833407.1|CB833407 3529_1_81_1_A07.x_1 3529 - 2 ... 36 4.3 gi|30031557|gb|CB833408.1|CB833408 3529_1_81_1_A07.y_1 3529 - 2 ... 36 4.3 gi|30087145|gb|CB885353.1|CB885353 3529_1_86_1_C10.y_1 3529 - 2 ... 36 4.3 gi|30088330|gb|CB886535.1|CB886535 3529_1_96_1_D07.x_1 3529 - 2 ... 36 4.3 gi|29130188|gb|CB380892.1|CB380892 3529_1_42_1_E02.x_1 3529 - 2 ... 36 4.3 gi|29543411|gb|CB603807.1|CB603807 3529_1_54_1_H05.x_1 3529 - 2 ... 36 4.3 gi|29543578|gb|CB603958.1|CB603958 3529_1_53_1_C08.y_1 3529 - 2 ... 36 4.3 gi|29543736|gb|CB604116.1|CB604116 3529_1_54_1_H05.y_1 3529 - 2 ... 36 4.3 gi|29544088|gb|CB604468.1|CB604468 3529_1_63_1_G07.x_1 3529 - 2 ... 36 4.3 gi|29544228|gb|CB604608.1|CB604608 3529_1_61_1_G07.x_1 3529 - 2 ... 36 4.3 gi|29544441|gb|CB604821.1|CB604821 3529_1_61_1_G07.y_1 3529 - 2 ... 36 4.3 gi|29544571|gb|CB604951.1|CB604951 3529_1_63_1_G07.y_1 3529 - 2 ... 36 4.3 gi|29946231|gb|CB816045.1|CB816045 3529_1_79_1_B01.x_1 3529 - 2 ... 36 4.3 gi|29946980|gb|CB816422.1|CB816422 3529_1_79_1_B01.y_1 3529 - 2 ... 36 4.3 gi|31405828|gb|CD484560.1|CD484560 3529_1_115_1_E03.x_1 3529 - 2... 36 4.3 gi|31405829|gb|CD484561.1|CD484561 3529_1_115_1_E03.y_1 3529 - 2... 36 4.3 gi|31557993|gb|CD527205.1|CD527205 3529_1_116_1_H12.y_1 3529 - 2... 36 4.3 gi|31558790|gb|CD528002.1|CD528002 3529_1_124_1_E01.x_1 3529 - 2... 36 4.3 gi|31558791|gb|CD528003.1|CD528003 3529_1_124_1_E01.y_1 3529 - 2... 36 4.3 gi|31664496|gb|CD573429.1|CD573429 3529_1_127_1_D04.x_1 3529 - 2... 36 4.3 gi|32165096|gb|CD670414.1|CD670414 3529_1_137_1_F01.x_1 3529 - 2... 36 4.3 gi|50324883|gb|CO520009.1|CO520009 3530_1_131_1_G11.y_1 3530 - F... 36 4.3 gi|50327198|gb|CO522324.1|CO522324 3530_1_147_1_C12.y_1 3530 - F... 36 4.3 gi|60337151|gb|DN204124.1|DN204124 MEST956_H11.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60337952|gb|DN204925.1|DN204925 MEST811_D07.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60338021|gb|DN204994.1|DN204994 MEST812_B09.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60339770|gb|DN206743.1|DN206743 MEST838_H09.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60340322|gb|DN207295.1|DN207295 MEST846_D10.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60340394|gb|DN207367.1|DN207367 MEST847_G09.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60341460|gb|DN208433.1|DN208433 MEST869_G05.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60341684|gb|DN208657.1|DN208657 MEST872_A04.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60342082|gb|DN209055.1|DN209055 MEST880_B04.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60346004|gb|DN212977.1|DN212977 MEST951_F10.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60346902|gb|DN213875.1|DN213875 MEST988_G08.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60346969|gb|DN213942.1|DN213942 MEST989_C08.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60347284|gb|DN214257.1|DN214257 MEST996_C07.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60347702|gb|DN214675.1|DN214675 MEST863_H12.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60348008|gb|DN214981.1|DN214981 MEST906_B01.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60348588|gb|DN215561.1|DN215561 MEST966_F06.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60349405|gb|DN216378.1|DN216378 MEST1033_H11.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60349669|gb|DN216642.1|DN216642 MEST1038_H11.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60350561|gb|DN217534.1|DN217534 MEST1052_H08.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60350591|gb|DN217564.1|DN217564 MEST1053_G01.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60351038|gb|DN218011.1|DN218011 MEST1059_D08.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60352213|gb|DN219186.1|DN219186 MEST1078_B12.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60355424|gb|DN222397.1|DN222397 MEST1127_H07.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60355611|gb|DN222584.1|DN222584 MEST1130_D04.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60355766|gb|DN222739.1|DN222739 MEST1132_F05.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60355956|gb|DN222929.1|DN222929 MEST1135_E04.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60357579|gb|DN224552.1|DN224552 MEST1160_C07.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60394684|gb|DN227554.1|DN227554 MEST1207_G05.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60395104|gb|DN227973.1|DN227973 MEST1213_D04.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60396326|gb|DN229195.1|DN229195 MEST1014_H01.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60398489|gb|DN231305.1|DN231305 MEST1179_A05.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60398800|gb|DN231616.1|DN231616 MEST1167_A07.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60398825|gb|DN231641.1|DN231641 MEST1203_A07.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60398993|gb|DN231809.1|DN231809 MEST1190_A08.T7-1 UGA-ZmSAM-X... 36 4.3 gi|60400025|gb|DN232832.1|DN232832 MEST859_B11.T7-1 UGA-ZmSAM-XZ... 36 4.3 gi|60400719|gb|DN233526.1|DN233526 MEST1057_E09.T7-1 UGA-ZmSAM-X... 36 4.3 gi|71305526|gb|DR788906.1|DR788906 ZM_BFb0007C08.r ZM_BFb Zea ma... 36 4.3 gi|71309861|gb|DR791213.1|DR791213 ZM_BFb0010J07.f ZM_BFb Zea ma... 36 4.3 gi|71309863|gb|DR791214.1|DR791214 ZM_BFb0010J07.r ZM_BFb Zea ma... 36 4.3 gi|71319884|gb|DR796700.1|DR796700 ZM_BFb0018H14.r ZM_BFb Zea ma... 36 4.3 gi|71422524|gb|DR805759.1|DR805759 ZM_BFb0031G07.r ZM_BFb Zea ma... 36 4.3 gi|71434458|gb|DR815508.1|DR815508 ZM_BFb0045L05.f ZM_BFb Zea ma... 36 4.3 gi|71434459|gb|DR815509.1|DR815509 ZM_BFb0045L05.r ZM_BFb Zea ma... 36 4.3 gi|71437929|gb|DR818979.1|DR818979 ZM_BFb0054L10.r ZM_BFb Zea ma... 36 4.3 gi|71758937|gb|DR956874.1|DR956874 ZM_BFb0054L10.f ZM_BFb Zea ma... 36 4.3 gi|74242200|gb|DT650114.1|DT650114 ZM_BFb0113G08.r ZM_BFb Zea ma... 36 4.3 gi|76018638|gb|DT945808.1|DT945808 ZM_BFb0133D11.f ZM_BFb Zea ma... 36 4.3 gi|76018639|gb|DT945809.1|DT945809 ZM_BFb0133D11.r ZM_BFb Zea ma... 36 4.3 gi|78082909|gb|DV511302.1|DV511302 ZM_BFb0191G09.r ZM_BFb Zea ma... 36 4.3 gi|78082929|gb|DV511322.1|DV511322 ZM_BFb0191G20.f ZM_BFb Zea ma... 36 4.3 gi|78082930|gb|DV511323.1|DV511323 ZM_BFb0191G20.r ZM_BFb Zea ma... 36 4.3 gi|78105826|gb|DV524244.1|DV524244 ZM_BFb0210N18.f ZM_BFb Zea ma... 36 4.3 gi|78105827|gb|DV524245.1|DV524245 ZM_BFb0210N18.r ZM_BFb Zea ma... 36 4.3 gi|86471035|gb|DY237405.1|DY237405 ZM_BFb0254I07.r ZM_BFb Zea ma... 36 4.3 gi|86472631|gb|DY239001.1|DY239001 ZM_BFb0257D14.f ZM_BFb Zea ma... 36 4.3 gi|89249097|gb|DY620883.1|DY620883 ZM_BFb0280I23.f ZM_BFb Zea ma... 36 4.3 gi|89758864|gb|DY687885.1|DY687885 ZM_BFb0280I23.r ZM_BFb Zea ma... 36 4.3 gi|58082334|gb|AC155473.2| Zea mays strain B73 clone ZMMBBb0597K... 36 4.3 >gi|5325042|gb|AI783233.1|AI783233 614007D09.x2 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 529 Score = 1005 bits (507), Expect = 0.0 Identities = 509/510 (99%) Strand = Plus / Plus Query: 1 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 60 Query: 61 aggcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 aggcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagc 120 Query: 121 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 180 Query: 181 tcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcga 240 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 181 tcgccgcgctgccggtggttcagaagaggatcgcgcangggggcgtcaggctggccgcga 240 Query: 241 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 300 Query: 301 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 360 Query: 361 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 420 Query: 421 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 480 Query: 481 gaagcacttgtacgtactgtgcaatagaat 510 |||||||||||||||||||||||||||||| Sbjct: 481 gaagcacttgtacgtactgtgcaatagaat 510 >gi|78023033|gb|DV491420.1|DV491420 1000043-F02.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 526 Score = 1003 bits (506), Expect = 0.0 Identities = 509/510 (99%) Strand = Plus / Minus Query: 1 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 525 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 466 Query: 61 aggcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagc 120 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 465 aggcctgccgtagccggacaaagacttgtgctgacaagtacgctgcagagagcgcgaagc 406 Query: 121 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 405 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 346 Query: 181 tcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 345 tcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcga 286 Query: 241 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 226 Query: 301 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 166 Query: 361 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 106 Query: 421 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 105 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 46 Query: 481 gaagcacttgtacgtactgtgcaatagaat 510 |||||||||||||||||||||||||||||| Sbjct: 45 gaagcacttgtacgtactgtgcaatagaat 16 >gi|5770159|gb|AI973333.1|AI973333 614007D09.x3 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 497 Score = 985 bits (497), Expect = 0.0 Identities = 497/497 (100%) Strand = Plus / Minus Query: 1 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 497 gcaccagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtggg 438 Query: 61 aggcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 437 aggcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagc 378 Query: 121 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 377 tggcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttct 318 Query: 181 tcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 317 tcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcga 258 Query: 241 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 257 tcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcga 198 Query: 301 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 197 tccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtgggga 138 Query: 361 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 137 ggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgg 78 Query: 421 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 77 caatattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatc 18 Query: 481 gaagcacttgtacgtac 497 ||||||||||||||||| Sbjct: 17 gaagcacttgtacgtac 1 >gi|15427118|gb|BI542940.1|BI542940 949074G12.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 597 Score = 979 bits (494), Expect = 0.0 Identities = 500/502 (99%) Strand = Plus / Minus Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 502 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 443 Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 442 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 383 Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 382 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 323 Query: 188 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 247 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 322 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 263 Query: 248 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 262 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 203 Query: 308 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 202 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 143 Query: 368 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 427 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 142 acgtgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 83 Query: 428 gtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcac 487 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 82 gtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcac 23 Query: 488 ttgtacgtactgtgcaatagaa 509 |||||||||||||||||||||| Sbjct: 22 ttgtacgtactgtgcaatagaa 1 >gi|45848087|gb|CN072030.1|CN072030 1021023G12.x1 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 571 Score = 952 bits (480), Expect = 0.0 Identities = 492/496 (99%) Strand = Plus / Minus Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 514 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 455 Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 454 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcccgaagctggcctg 395 Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 394 cccggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 335 Query: 188 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 247 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 334 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 275 Query: 248 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 274 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 215 Query: 308 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 214 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 155 Query: 368 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 427 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 154 acgtgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 95 Query: 428 gtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcac 487 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 94 gtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcac 35 Query: 488 ttgtacgtactgtgca 503 |||||||||||||||| Sbjct: 34 ttgtacgtactgtgca 19 >gi|5846854|gb|AI999937.1|AI999937 614007D09.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 492 Score = 938 bits (473), Expect = 0.0 Identities = 489/492 (99%), Gaps = 3/492 (0%) Strand = Plus / Plus Query: 3 accagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggag 62 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 accagggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggag 60 Query: 63 gcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctg 122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 gcctgccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctg 120 Query: 123 gcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttc 182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gcctgcacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttc 180 Query: 183 gccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatc 242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatc 240 Query: 243 ctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatc 302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 ctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatc 300 Query: 303 catatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggagg 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 catatccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggagg 360 Query: 363 ggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtct-ggc 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 361 ggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctgggc 420 Query: 422 aa--tattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaat 479 || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 aanntattgtaacttcagtcttcagtaaccactagctcacgaattttattatttcagaat 480 Query: 480 cgaagcacttgt 491 |||||||||||| Sbjct: 481 cgaagcacttgt 492 >gi|56382502|gb|CV985171.1|CV985171 EST4708 Zea mays embryo sac cDNA library Zea mays cDNA clone ES10802 5' similar to endonuclease, mRNA sequence Length = 443 Score = 823 bits (415), Expect = 0.0 Identities = 415/415 (100%) Strand = Plus / Plus Query: 26 cacggaggagtgggctgatgaggagaagaagtgggaggcctgccgtagccggacaaagac 85 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cacggaggagtgggctgatgaggagaagaagtgggaggcctgccgtagccggacaaagac 60 Query: 86 ctgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacgagggtgt 145 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ctgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacgagggtgt 120 Query: 146 cgaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggttcagaa 205 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 cgaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggttcagaa 180 Query: 206 gaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatatttggtgggaa 265 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatatttggtgggaa 240 Query: 266 cagcagatcaggcttcagagcagttgattgatcgatccatatccataccagtagtagata 325 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 cagcagatcaggcttcagagcagttgattgatcgatccatatccataccagtagtagata 300 Query: 326 tcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatctgccatctga 385 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 tcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatctgccatctga 360 Query: 386 attagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtct 440 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 attagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtct 415 >gi|37378501|gb|CF625942.1|CF625942 zmrws05_0B10-007-g05.s1 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 480 Score = 821 bits (414), Expect = 0.0 Identities = 453/467 (97%), Gaps = 8/467 (1%) Strand = Plus / Minus Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67 |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct: 459 ggccatccagcagaacattacggaggaatgggctgatgaggagaagaagtgggaggcctg 400 Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 399 ccgtagccggacaaagacctgcgctgacaagtacgctgcagagagcgcgaagctggcctg 340 Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 339 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 280 Query: 188 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 247 ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 279 gctgccggtggttcagaagaggatcgcccaaggaggcgtcaggctggccgcgatcctcaa 220 Query: 248 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 219 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 160 Query: 308 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 159 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 100 Query: 368 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 427 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 99 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 40 Query: 428 gtaacttcagtcttcagtaaccactagctcacgaattttattatttc 474 ||||||||||| ||||||||||||||||||||||||||| Sbjct: 39 gtaacttcagt--------gccactagctcacgaattttattatttc 1 >gi|37380671|gb|CF627162.1|CF627162 zmrws05_0B20-007-g05.s1 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 480 Score = 821 bits (414), Expect = 0.0 Identities = 453/467 (97%), Gaps = 8/467 (1%) Strand = Plus / Minus Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67 |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct: 459 ggccatccagcagaacattacggaggaatgggctgatgaggagaagaagtgggaggcctg 400 Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 399 ccgtagccggacaaagacctgcgctgacaagtacgctgcagagagcgcgaagctggcctg 340 Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 339 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 280 Query: 188 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 247 ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 279 gctgccggtggttcagaagaggatcgcccaaggaggcgtcaggctggccgcgatcctcaa 220 Query: 248 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 219 caggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatat 160 Query: 308 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 159 ccataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcag 100 Query: 368 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 427 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 99 gcatgatctgccatctgaattagaataataagaggtatcttgttgccgtctggcaatatt 40 Query: 428 gtaacttcagtcttcagtaaccactagctcacgaattttattatttc 474 ||||||||||| ||||||||||||||||||||||||||| Sbjct: 39 gtaacttcagt--------gccactagctcacgaattttattatttc 1 >gi|86468225|gb|DY234595.1|DY234595 ZM_BFb0244M24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 506 Score = 777 bits (392), Expect = 0.0 Identities = 421/431 (97%), Gaps = 6/431 (1%) Strand = Plus / Minus Query: 80 aaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacga 139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 506 aaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacga 447 Query: 140 gggtgtcgaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggt 199 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 446 gggtgtcgaccaggactccaccttggaagatgactacttcttcgccgcgctgccggtggt 387 Query: 200 tcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatatttgg 259 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 386 tcagaagaggatcgcgcaaggaggcgtcaggctggccgcgatcctcaacaggatatttgg 327 Query: 260 tgggaacagcagatcaggcttcagagcagttgattgatcgatccatatccataccagtag 319 |||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 326 tgggaacagcagatcaggcttcagagcagttgattgatcg------atccataccagtag 273 Query: 320 tagatatcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatctgcc 379 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 272 tagatatcaaacgattggacatgtggaggagtgggtggggaggggcagacatgatctgcc 213 Query: 380 atctgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtc 439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 212 atctgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtc 153 Query: 440 ttcagtaaccactagctcacgaattttattatttcagaatcgaagcacttgtacgtactg 499 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 152 ttcagtagccactagctcacgaattttattatttcagaatcgaagcacttgtacgtactg 93 Query: 500 tgcaatagaat 510 ||||||||||| Sbjct: 92 tgcaatagaat 82 >gi|32850685|gb|CD990366.1|CD990366 QAW3a01.yg QAW Zea mays cDNA clone QAW3a01, mRNA sequence Length = 356 Score = 674 bits (340), Expect = 0.0 Identities = 352/356 (98%) Strand = Plus / Minus Query: 136 acgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgcgctgccgg 195 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 356 acgagggtgtcgaccaggactccaccttggaagatgactacttcttcgccgcgctgccgg 297 Query: 196 tggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatat 255 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 296 tggttcagaagaggatcgcgcaaggaggcgtcaggctggccgcgatcctcaacaggatat 237 Query: 256 ttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatatccatacca 315 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 236 ttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatatccatacca 177 Query: 316 gtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatc 375 |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| Sbjct: 176 gtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcagacgtgatc 117 Query: 376 tgccatctgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttc 435 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 116 tgccatctgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttc 57 Query: 436 agtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcacttgt 491 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 56 agtcttcagtaaccactagctcacgaattttattatttcagaatcgaagcacttgt 1 >gi|21211581|gb|AY108503.1| Zea mays PCO102923 mRNA sequence Length = 476 Score = 613 bits (309), Expect = e-173 Identities = 335/344 (97%), Gaps = 6/344 (1%) Strand = Plus / Plus Query: 167 agatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgt 226 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 19 agatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaaggaggcgt 78 Query: 227 caggctggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagc 286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 79 caggctggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagc 138 Query: 287 agttgattgatcgatccatatccataccagtagtagatatcaaacgattggacatgtgga 346 |||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 139 agttgattgatcgatccata------ccagtagtagatatcaaacgattggacatgtgga 192 Query: 347 ggagtgggtggggaggggcaggcatgatctgccatctgaattagaataataagaggtatc 406 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 193 ggagtgggtggggaggggcagacatgatctgccatctgaattagaataataagaggtatc 252 Query: 407 ttgttgccgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaatttt 466 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 253 ttgttgccgtctggcaatattgtaacttcagtcttcagtagccactagctcacgaatttt 312 Query: 467 attatttcagaatcgaagcacttgtacgtactgtgcaatagaat 510 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 313 attatttcagaatcgaagcacttgtacgtactgtgcaatagaat 356 >gi|21211581|gb|AY108503.1| Zea mays PCO102923 mRNA sequence Length = 476 Score = 613 bits (309), Expect = e-173 Identities = 335/344 (97%), Gaps = 6/344 (1%) Strand = Plus / Plus Query: 167 agatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgt 226 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 19 agatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaaggaggcgt 78 Query: 227 caggctggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagc 286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 79 caggctggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagc 138 Query: 287 agttgattgatcgatccatatccataccagtagtagatatcaaacgattggacatgtgga 346 |||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 139 agttgattgatcgatccata------ccagtagtagatatcaaacgattggacatgtgga 192 Query: 347 ggagtgggtggggaggggcaggcatgatctgccatctgaattagaataataagaggtatc 406 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 193 ggagtgggtggggaggggcagacatgatctgccatctgaattagaataataagaggtatc 252 Query: 407 ttgttgccgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaatttt 466 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 253 ttgttgccgtctggcaatattgtaacttcagtcttcagtagccactagctcacgaatttt 312 Query: 467 attatttcagaatcgaagcacttgtacgtactgtgcaatagaat 510 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 313 attatttcagaatcgaagcacttgtacgtactgtgcaatagaat 356 >gi|6022526|gb|AW067559.1|AW067559 614040D03.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 316 Score = 593 bits (299), Expect = e-168 Identities = 299/299 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggc 231 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 actacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggc 60 Query: 232 tggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttg 291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tggccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttg 120 Query: 292 attgatcgatccatatccataccagtagtagatatcaaacgattggacatgtggaggagt 351 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 attgatcgatccatatccataccagtagtagatatcaaacgattggacatgtggaggagt 180 Query: 352 gggtggggaggggcaggcatgatctgccatctgaattagaataataagaggtatcttgtt 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gggtggggaggggcaggcatgatctgccatctgaattagaataataagaggtatcttgtt 240 Query: 412 gccgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaattttatta 470 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 gccgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaattttatta 299 >gi|15353077|gb|BI502688.1|BI502688 949074G12.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 283 Score = 519 bits (262), Expect = e-145 Identities = 268/270 (99%) Strand = Plus / Minus Query: 234 gccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgat 293 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 283 gccgcgatcctcaacaggatatttggtgggaacagcagatcaggcttcagagcagttgat 224 Query: 294 tgatcgatccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgg 353 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 223 tgatcgatccatatccataccagtagtagatatcaaacgattggacatgtggaggagtgg 164 Query: 354 gtggggaggggcaggcatgatctgccatctgaattagaataataagaggtatcttgttgc 413 |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 163 gtggggaggggcagacgtgatctgccatctgaattagaataataagaggtatcttgttgc 104 Query: 414 cgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaattttattattt 473 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 103 cgtctggcaatattgtaacttcagtcttcagtaaccactagctcacgaattttattattt 44 Query: 474 cagaatcgaagcacttgtacgtactgtgca 503 |||||||||||||||||||||||||||||| Sbjct: 43 cagaatcgaagcacttgtacgtactgtgca 14 >gi|71773137|gb|DR971051.1|DR971051 ZM_BFb0093J07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 603 Score = 517 bits (261), Expect = e-145 Identities = 374/412 (90%), Gaps = 6/412 (1%) Strand = Plus / Minus Query: 10 ccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctgcc 69 ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| || Sbjct: 406 ccatccagcagaacatcacggaggagtgggctgatgaggagaaaaagtgggagccctccc 347 Query: 70 gtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctgca 129 ||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct: 346 gtacccggacaaagacctgtgttgacaagtacgctgcagagagcgggaagctggcctccc 287 Query: 130 cggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgcgc 189 |||||||||||||||||| ||| |||||| ||||||||||||| || || ||| |||||| Sbjct: 286 cggcgtacgagggtgtcgcccaggactcccccttggaagatgattattttttccccgcgc 227 Query: 190 tgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaaca 249 | ||||||||||| ||||||||||| ||||| |||||||||||| |||||||||||| || Sbjct: 226 tcccggtggttcaaaagaggatcgcccaaggaggcgtcaggctgcccgcgatcctcacca 167 Query: 250 ggatatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatatcc 309 |||||||||||||||||| |||||||||||||||| |||||||||||||| |||| Sbjct: 166 ggatatttggtgggaacaccagatcaggcttcagaccagttgattgatcg------atcc 113 Query: 310 ataccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcaggc 369 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 112 atcccagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcagcc 53 Query: 370 atgatctgccatctgaattagaataataagaggtatcttgttgccgtctggc 421 ||| ||| || | ||||||| ||||||||||||||||||||| || |||||| Sbjct: 52 atgttctcccttttgaattaaaataataagaggtatcttgttcccttctggc 1 >gi|78108175|gb|DV526593.1|DV526593 ZM_BFb0214E12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 266 Score = 462 bits (233), Expect = e-128 Identities = 262/272 (96%), Gaps = 6/272 (2%) Strand = Plus / Minus Query: 203 gaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatatttggtgg 262 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 266 gaagaggatcgcgcaaggaggcgtcaggctggccgcgatcctcaacaggatatttggtgg 207 Query: 263 gaacagcagatcaggcttcagagcagttgattgatcgatccatatccataccagtagtag 322 |||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 206 gaacagcagatcaggcttcagagcagttgattgatcgatccata------ccagtagtag 153 Query: 323 atatcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatctgccatc 382 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 152 atatcaaacgattggacatgtggaggagtgggtggggaggggcagacatgatctgccatc 93 Query: 383 tgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtcttc 442 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 92 tgaatcagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtcttc 33 Query: 443 agtaaccactagctcacgaattttattatttc 474 |||| ||||||||||||||||||||||||||| Sbjct: 32 agtagccactagctcacgaattttattatttc 1 >gi|78108176|gb|DV526594.1|DV526594 ZM_BFb0214E12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 266 Score = 462 bits (233), Expect = e-128 Identities = 262/272 (96%), Gaps = 6/272 (2%) Strand = Plus / Plus Query: 203 gaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggatatttggtgg 262 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gaagaggatcgcgcaaggaggcgtcaggctggccgcgatcctcaacaggatatttggtgg 60 Query: 263 gaacagcagatcaggcttcagagcagttgattgatcgatccatatccataccagtagtag 322 |||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 61 gaacagcagatcaggcttcagagcagttgattgatcgatccata------ccagtagtag 114 Query: 323 atatcaaacgattggacatgtggaggagtgggtggggaggggcaggcatgatctgccatc 382 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 115 atatcaaacgattggacatgtggaggagtgggtggggaggggcagacatgatctgccatc 174 Query: 383 tgaattagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtcttc 442 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 175 tgaatcagaataataagaggtatcttgttgccgtctggcaatattgtaacttcagtcttc 234 Query: 443 agtaaccactagctcacgaattttattatttc 474 |||| ||||||||||||||||||||||||||| Sbjct: 235 agtagccactagctcacgaattttattatttc 266 >gi|5714304|gb|AI944289.1|AI944289 614040D03.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 197 Score = 391 bits (197), Expect = e-107 Identities = 197/197 (100%) Strand = Plus / Minus Query: 192 ccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacagg 251 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 197 ccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacagg 138 Query: 252 atatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatatccat 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 137 atatttggtgggaacagcagatcaggcttcagagcagttgattgatcgatccatatccat 78 Query: 312 accagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcaggcat 371 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 77 accagtagtagatatcaaacgattggacatgtggaggagtgggtggggaggggcaggcat 18 Query: 372 gatctgccatctgaatt 388 ||||||||||||||||| Sbjct: 17 gatctgccatctgaatt 1 >gi|71773138|gb|DR971052.1|DR971052 ZM_BFb0093J07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 859 Score = 357 bits (180), Expect = 9e-97 Identities = 186/188 (98%) Strand = Plus / Plus Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 672 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 731 Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 732 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggtctg 791 Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 792 cacggcgtacgagggtgtcgaccaggactccaccttggaagatgactacttcttcgccgc 851 Query: 188 gctgccgg 195 |||||||| Sbjct: 852 gctgccgg 859 >gi|4299140|gb|AI438862.1|AI438862 486013H05.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 446 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 132 actacttcttcgccgcgc 149 >gi|4574115|gb|AI587674.1|AI587674 486013H10.x2 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 260 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 76 actacttcttcgccgcgc 93 >gi|4628304|gb|AI619178.1|AI619178 486086E06.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 280 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 123 actacttcttcgccgcgc 140 >gi|4646706|gb|AI491569.2|AI491569 486024G03.x1 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 512 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 76 actacttcttcgccgcgc 93 >gi|4804355|gb|AI666221.1|AI666221 606006D10.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 571 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 132 actacttcttcgccgcgc 149 >gi|4827743|gb|AI668435.1|AI668435 605032C11.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 603 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 176 actacttcttcgccgcgc 193 >gi|5124438|gb|AI746174.1|AI746174 605082B02.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 303 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 129 actacttcttcgccgcgc 146 >gi|5439319|gb|AI820240.1|AI820240 605087G07.x3 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 564 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 86 actacttcttcgccgcgc 103 >gi|5499316|gb|AI855183.1|AI855183 603009E12.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 572 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 135 actacttcttcgccgcgc 152 >gi|5688733|gb|AI941748.1|AI941748 618034F03.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 211 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 22 actacttcttcgccgcgc 39 >gi|6653878|gb|AW267283.1|AW267283 618061D12.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 230 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 119 actacttcttcgccgcgc 136 >gi|7844052|gb|AW787255.1|AW787255 945001E09.X1 945 - Mixed adult tissues from Walbot lab, same as 707 (SK) Zea mays cDNA, mRNA sequence Length = 569 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 514 actacttcttcgccgcgc 497 >gi|7844469|gb|AW787691.1|AW787691 945001E09.X3 945 - Mixed adult tissues from Walbot lab, same as 707 (SK) Zea mays cDNA, mRNA sequence Length = 586 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 510 actacttcttcgccgcgc 493 >gi|8665653|gb|BE186469.1|BE186469 946006G03.X3 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 222 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 148 actacttcttcgccgcgc 165 >gi|9028638|gb|BE238678.1|BE238678 946006G03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 578 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 553 actacttcttcgccgcgc 536 >gi|9254269|gb|BE344737.1|BE344737 946028E10.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 482 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 45 actacttcttcgccgcgc 62 >gi|9254270|gb|BE344738.1|BE344738 946028E10.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 550 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 415 actacttcttcgccgcgc 398 >gi|9254394|gb|BE344862.1|BE344862 946029E06.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 584 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 72 actacttcttcgccgcgc 89 >gi|9254395|gb|BE344863.1|BE344863 946029E06.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 598 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 565 actacttcttcgccgcgc 548 >gi|9254526|gb|BE344994.1|BE344994 946030E09.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 532 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 132 actacttcttcgccgcgc 149 >gi|9254527|gb|BE344995.1|BE344995 946030E09.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 524 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 524 actacttcttcgccgcgc 507 >gi|9732720|gb|BE511472.1|BE511472 946061B03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 611 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 525 actacttcttcgccgcgc 508 >gi|9733597|gb|BE512349.1|BE512349 946069E06.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 597 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 77 actacttcttcgccgcgc 94 >gi|9794827|gb|BE553135.1|BE553135 946089F06.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 107 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 63 actacttcttcgccgcgc 80 >gi|9952100|gb|BE638683.1|BE638683 946012F06.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 215 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 70 actacttcttcgccgcgc 53 >gi|14245058|gb|BG873640.1|BG873640 MEST8-D10.T7-1 ISUM3-TL Zea mays cDNA clone MEST8-D10 5', mRNA sequence Length = 573 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 557 actacttcttcgccgcgc 540 >gi|15632318|gb|BI679411.1|BI679411 949001D12.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 641 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 451 actacttcttcgccgcgc 434 >gi|17930776|gb|BM267736.1|BM267736 MEST371-D06.T3 ISUM5-RN Zea mays cDNA clone MEST371-D06 3', mRNA sequence Length = 535 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 128 actacttcttcgccgcgc 145 >gi|17930916|gb|BM267876.1|BM267876 MEST373-D09.T3 ISUM5-RN Zea mays cDNA clone MEST373-D09 3', mRNA sequence Length = 562 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 181 actacttcttcgccgcgc 198 >gi|18162183|gb|BM332022.1|BM332022 MEST174-B06.T3 ISUM5-RN Zea mays cDNA clone MEST174-B06 3', mRNA sequence Length = 600 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|18162390|gb|BM332229.1|BM332229 MEST154-B03.T3 ISUM5-RN Zea mays cDNA clone MEST154-B03 3', mRNA sequence Length = 494 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|18162942|gb|BM332781.1|BM332781 MEST177-E03.T3 ISUM5-RN Zea mays cDNA clone MEST177-E03 3', mRNA sequence Length = 596 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 128 actacttcttcgccgcgc 145 >gi|18163866|gb|BM333705.1|BM333705 MEST159-G04.T3 ISUM5-RN Zea mays cDNA clone MEST159-G04 3', mRNA sequence Length = 461 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 128 actacttcttcgccgcgc 145 >gi|18164983|gb|BM334822.1|BM334822 MEST142-F03.T3 ISUM5-RN Zea mays cDNA clone MEST142-F03 3', mRNA sequence Length = 469 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 124 actacttcttcgccgcgc 141 >gi|18165376|gb|BM335215.1|BM335215 MEST147-D06.T3 ISUM5-RN Zea mays cDNA clone MEST147-D06 3', mRNA sequence Length = 516 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 126 actacttcttcgccgcgc 143 >gi|18168825|gb|BM338665.1|BM338665 MEST230-D03.T3 ISUM5-RN Zea mays cDNA clone MEST230-D03 3', mRNA sequence Length = 303 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 125 actacttcttcgccgcgc 142 >gi|18174116|gb|BM349504.1|BM349504 MEST250-E10.T3 ISUM5-RN Zea mays cDNA clone MEST250-E10 3', mRNA sequence Length = 665 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 129 actacttcttcgccgcgc 146 >gi|18174289|gb|BM349677.1|BM349677 MEST254-A12.T3 ISUM5-RN Zea mays cDNA clone MEST254-A12 3', mRNA sequence Length = 699 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|18174970|gb|BM350358.1|BM350358 MEST264-G01.T3 ISUM5-RN Zea mays cDNA clone MEST264-G01 3', mRNA sequence Length = 582 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|18175029|gb|BM350417.1|BM350417 MEST265-G03.T3 ISUM5-RN Zea mays cDNA clone MEST265-G03 3', mRNA sequence Length = 622 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|18175625|gb|BM350872.1|BM350872 MEST214-H06.T3 ISUM5-RN Zea mays cDNA clone MEST214-H06 3', mRNA sequence Length = 529 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 128 actacttcttcgccgcgc 145 >gi|18178187|gb|BM379397.1|BM379397 MEST505-A07.univ ISUM6 Zea mays cDNA clone MEST505-A07 3', mRNA sequence Length = 558 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 121 actacttcttcgccgcgc 138 >gi|18178827|gb|BM380037.1|BM380037 MEST514-B02.univ ISUM6 Zea mays cDNA clone MEST514-B02 3', mRNA sequence Length = 558 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 121 actacttcttcgccgcgc 138 >gi|18179286|gb|BM380496.1|BM380496 MEST520-G02.univ ISUM6 Zea mays cDNA clone MEST520-G02 3', mRNA sequence Length = 538 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 138 actacttcttcgccgcgc 155 >gi|18180879|gb|BM382089.1|BM382089 MEST544-D12.univ ISUM6 Zea mays cDNA clone MEST544-D12 3', mRNA sequence Length = 612 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 119 actacttcttcgccgcgc 136 >gi|18181140|gb|BM382350.1|BM382350 MEST548-C06.univ ISUM6 Zea mays cDNA clone MEST548-C06 3', mRNA sequence Length = 456 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 128 actacttcttcgccgcgc 145 >gi|18181501|gb|BM382711.1|BM382711 MEST553-F09.univ ISUM6 Zea mays cDNA clone MEST553-F09 3', mRNA sequence Length = 528 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 141 actacttcttcgccgcgc 158 >gi|20301493|gb|BQ164436.1|BQ164436 1091020C06.y3 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 620 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 532 actacttcttcgccgcgc 515 >gi|20507442|gb|BQ279635.1|BQ279635 1091030B01.x2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 217 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 78 actacttcttcgccgcgc 95 >gi|21625996|gb|BQ620917.1|BQ620917 1091061G01.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 509 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 67 actacttcttcgccgcgc 84 >gi|21987335|gb|BQ778863.1|BQ778863 946114G12.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 586 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 552 actacttcttcgccgcgc 535 >gi|21987662|gb|BQ779190.1|BQ779190 946117F03.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 169 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 77 actacttcttcgccgcgc 94 >gi|21987663|gb|BQ779191.1|BQ779191 946117F03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 608 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 585 actacttcttcgccgcgc 568 >gi|26457404|gb|CA828987.1|CA828987 1114035H11.y2 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 526 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 526 actacttcttcgccgcgc 509 >gi|28361659|gb|CB240015.1|CB240015 3529_1_16_1_G10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 648 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 555 actacttcttcgccgcgc 538 >gi|28361847|gb|CB240203.1|CB240203 3529_1_20_1_G10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 617 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 573 actacttcttcgccgcgc 556 >gi|28569023|gb|CB280898.1|CB280898 3529_1_16_1_H03.y_5 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 600 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 547 actacttcttcgccgcgc 530 >gi|28576137|gb|CB282029.1|CB282029 3529_1_16_1_H03.x_5 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 599 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 74 actacttcttcgccgcgc 91 >gi|28909651|gb|CB331034.1|CB331034 3529_1_28_1_C07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 645 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 559 actacttcttcgccgcgc 542 >gi|28910085|gb|CB331254.1|CB331254 3529_1_35_1_C03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 590 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 563 actacttcttcgccgcgc 546 >gi|28910995|gb|CB331718.1|CB331718 3529_1_35_1_C03.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 160 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 92 actacttcttcgccgcgc 109 >gi|28985477|gb|CB350659.1|CB350659 MEST254-A12.univ ISUM5-RN Zea mays cDNA clone MEST254-A12 3', mRNA sequence Length = 689 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 129 actacttcttcgccgcgc 146 >gi|28911221|gb|BM333425.2|BM333425 MEST155-E11.T3 ISUM5-RN Zea mays cDNA clone MEST155-E11 3', mRNA sequence Length = 686 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 126 actacttcttcgccgcgc 143 >gi|28911374|gb|BM340856.2|BM340856 MEST326-G12.T3 ISUM5-RN Zea mays cDNA clone MEST326-G12 3', mRNA sequence Length = 684 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 124 actacttcttcgccgcgc 141 >gi|28911384|gb|BM341179.2|BM341179 MEST331-D10.T3 ISUM5-RN Zea mays cDNA clone MEST331-D10 3', mRNA sequence Length = 686 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 126 actacttcttcgccgcgc 143 >gi|30031556|gb|CB833407.1|CB833407 3529_1_81_1_A07.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 648 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 66 actacttcttcgccgcgc 83 >gi|30031557|gb|CB833408.1|CB833408 3529_1_81_1_A07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 564 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 548 actacttcttcgccgcgc 531 >gi|30087145|gb|CB885353.1|CB885353 3529_1_86_1_C10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 590 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 575 actacttcttcgccgcgc 558 >gi|30088330|gb|CB886535.1|CB886535 3529_1_96_1_D07.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 621 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 37 actacttcttcgccgcgc 54 >gi|29130188|gb|CB380892.1|CB380892 3529_1_42_1_E02.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 308 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 121 actacttcttcgccgcgc 138 >gi|29543411|gb|CB603807.1|CB603807 3529_1_54_1_H05.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 597 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 45 actacttcttcgccgcgc 62 >gi|29543578|gb|CB603958.1|CB603958 3529_1_53_1_C08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 604 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 561 actacttcttcgccgcgc 544 >gi|29543736|gb|CB604116.1|CB604116 3529_1_54_1_H05.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 593 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 578 actacttcttcgccgcgc 561 >gi|29544088|gb|CB604468.1|CB604468 3529_1_63_1_G07.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 593 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 41 actacttcttcgccgcgc 58 >gi|29544228|gb|CB604608.1|CB604608 3529_1_61_1_G07.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 465 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 39 actacttcttcgccgcgc 56 >gi|29544441|gb|CB604821.1|CB604821 3529_1_61_1_G07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 584 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 578 actacttcttcgccgcgc 561 >gi|29544571|gb|CB604951.1|CB604951 3529_1_63_1_G07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 463 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 448 actacttcttcgccgcgc 431 >gi|29946231|gb|CB816045.1|CB816045 3529_1_79_1_B01.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 650 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 71 actacttcttcgccgcgc 88 >gi|29946980|gb|CB816422.1|CB816422 3529_1_79_1_B01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 667 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 576 actacttcttcgccgcgc 559 >gi|31405828|gb|CD484560.1|CD484560 3529_1_115_1_E03.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 569 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 6 actacttcttcgccgcgc 23 >gi|31405829|gb|CD484561.1|CD484561 3529_1_115_1_E03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 620 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 526 actacttcttcgccgcgc 509 >gi|31557993|gb|CD527205.1|CD527205 3529_1_116_1_H12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 439 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 424 actacttcttcgccgcgc 407 >gi|31558790|gb|CD528002.1|CD528002 3529_1_124_1_E01.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 591 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 6 actacttcttcgccgcgc 23 >gi|31558791|gb|CD528003.1|CD528003 3529_1_124_1_E01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 542 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 515 actacttcttcgccgcgc 498 >gi|31664496|gb|CD573429.1|CD573429 3529_1_127_1_D04.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 509 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 7 actacttcttcgccgcgc 24 >gi|32165096|gb|CD670414.1|CD670414 3529_1_137_1_F01.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 533 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 15 actacttcttcgccgcgc 32 >gi|50324883|gb|CO520009.1|CO520009 3530_1_131_1_G11.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 609 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 469 actacttcttcgccgcgc 452 >gi|50327198|gb|CO522324.1|CO522324 3530_1_147_1_C12.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 665 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 561 actacttcttcgccgcgc 544 >gi|60337151|gb|DN204124.1|DN204124 MEST956_H11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 676 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 186 actacttcttcgccgcgc 203 >gi|60337952|gb|DN204925.1|DN204925 MEST811_D07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 214 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 7 actacttcttcgccgcgc 24 >gi|60338021|gb|DN204994.1|DN204994 MEST812_B09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 688 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 113 actacttcttcgccgcgc 130 >gi|60339770|gb|DN206743.1|DN206743 MEST838_H09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 668 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 101 actacttcttcgccgcgc 118 >gi|60340322|gb|DN207295.1|DN207295 MEST846_D10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 681 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 123 actacttcttcgccgcgc 140 >gi|60340394|gb|DN207367.1|DN207367 MEST847_G09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 558 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 117 actacttcttcgccgcgc 134 >gi|60341460|gb|DN208433.1|DN208433 MEST869_G05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 691 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 136 actacttcttcgccgcgc 153 >gi|60341684|gb|DN208657.1|DN208657 MEST872_A04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 703 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 131 actacttcttcgccgcgc 148 >gi|60342082|gb|DN209055.1|DN209055 MEST880_B04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 391 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 185 actacttcttcgccgcgc 202 >gi|60346004|gb|DN212977.1|DN212977 MEST951_F10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 667 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 134 actacttcttcgccgcgc 151 >gi|60346902|gb|DN213875.1|DN213875 MEST988_G08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 408 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 133 actacttcttcgccgcgc 150 >gi|60346969|gb|DN213942.1|DN213942 MEST989_C08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 683 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 114 actacttcttcgccgcgc 131 >gi|60347284|gb|DN214257.1|DN214257 MEST996_C07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 573 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 120 actacttcttcgccgcgc 137 >gi|60347702|gb|DN214675.1|DN214675 MEST863_H12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 641 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 68 actacttcttcgccgcgc 85 >gi|60348008|gb|DN214981.1|DN214981 MEST906_B01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 658 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 89 actacttcttcgccgcgc 106 >gi|60348588|gb|DN215561.1|DN215561 MEST966_F06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 449 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 122 actacttcttcgccgcgc 139 >gi|60349405|gb|DN216378.1|DN216378 MEST1033_H11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 602 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 136 actacttcttcgccgcgc 153 >gi|60349669|gb|DN216642.1|DN216642 MEST1038_H11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 674 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 105 actacttcttcgccgcgc 122 >gi|60350561|gb|DN217534.1|DN217534 MEST1052_H08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 689 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 123 actacttcttcgccgcgc 140 >gi|60350591|gb|DN217564.1|DN217564 MEST1053_G01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 684 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 115 actacttcttcgccgcgc 132 >gi|60351038|gb|DN218011.1|DN218011 MEST1059_D08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 614 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 110 actacttcttcgccgcgc 127 >gi|60352213|gb|DN219186.1|DN219186 MEST1078_B12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 114 actacttcttcgccgcgc 131 >gi|60355424|gb|DN222397.1|DN222397 MEST1127_H07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 707 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 117 actacttcttcgccgcgc 134 >gi|60355611|gb|DN222584.1|DN222584 MEST1130_D04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 671 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 560 actacttcttcgccgcgc 543 >gi|60355766|gb|DN222739.1|DN222739 MEST1132_F05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 127 actacttcttcgccgcgc 144 >gi|60355956|gb|DN222929.1|DN222929 MEST1135_E04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 672 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 103 actacttcttcgccgcgc 120 >gi|60357579|gb|DN224552.1|DN224552 MEST1160_C07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 663 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 115 actacttcttcgccgcgc 132 >gi|60394684|gb|DN227554.1|DN227554 MEST1207_G05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 133 actacttcttcgccgcgc 150 >gi|60395104|gb|DN227973.1|DN227973 MEST1213_D04.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 669 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 100 actacttcttcgccgcgc 117 >gi|60396326|gb|DN229195.1|DN229195 MEST1014_H01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 514 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 443 actacttcttcgccgcgc 426 >gi|60398489|gb|DN231305.1|DN231305 MEST1179_A05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 698 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 129 actacttcttcgccgcgc 146 >gi|60398800|gb|DN231616.1|DN231616 MEST1167_A07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 636 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 101 actacttcttcgccgcgc 118 >gi|60398825|gb|DN231641.1|DN231641 MEST1203_A07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 625 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 135 actacttcttcgccgcgc 152 >gi|60398993|gb|DN231809.1|DN231809 MEST1190_A08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 612 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 114 actacttcttcgccgcgc 131 >gi|60400025|gb|DN232832.1|DN232832 MEST859_B11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 671 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 92 actacttcttcgccgcgc 109 >gi|60400719|gb|DN233526.1|DN233526 MEST1057_E09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 572 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 85 actacttcttcgccgcgc 102 >gi|71305526|gb|DR788906.1|DR788906 ZM_BFb0007C08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 577 actacttcttcgccgcgc 560 >gi|71309861|gb|DR791213.1|DR791213 ZM_BFb0010J07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 737 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 238 actacttcttcgccgcgc 255 >gi|71309863|gb|DR791214.1|DR791214 ZM_BFb0010J07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 596 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 571 actacttcttcgccgcgc 554 >gi|71319884|gb|DR796700.1|DR796700 ZM_BFb0018H14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 675 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 580 actacttcttcgccgcgc 563 >gi|71422524|gb|DR805759.1|DR805759 ZM_BFb0031G07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 670 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 289 actacttcttcgccgcgc 272 >gi|71434458|gb|DR815508.1|DR815508 ZM_BFb0045L05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 686 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 113 actacttcttcgccgcgc 130 >gi|71434459|gb|DR815509.1|DR815509 ZM_BFb0045L05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 586 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 574 actacttcttcgccgcgc 557 >gi|71437929|gb|DR818979.1|DR818979 ZM_BFb0054L10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 688 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 576 actacttcttcgccgcgc 559 >gi|71758937|gb|DR956874.1|DR956874 ZM_BFb0054L10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 688 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 113 actacttcttcgccgcgc 130 >gi|74242200|gb|DT650114.1|DT650114 ZM_BFb0113G08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 670 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 531 actacttcttcgccgcgc 514 >gi|76018638|gb|DT945808.1|DT945808 ZM_BFb0133D11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 686 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 113 actacttcttcgccgcgc 130 >gi|76018639|gb|DT945809.1|DT945809 ZM_BFb0133D11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 686 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 574 actacttcttcgccgcgc 557 >gi|78082909|gb|DV511302.1|DV511302 ZM_BFb0191G09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 711 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 580 actacttcttcgccgcgc 563 >gi|78082929|gb|DV511322.1|DV511322 ZM_BFb0191G20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 672 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 113 actacttcttcgccgcgc 130 >gi|78082930|gb|DV511323.1|DV511323 ZM_BFb0191G20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 689 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 576 actacttcttcgccgcgc 559 >gi|78105826|gb|DV524244.1|DV524244 ZM_BFb0210N18.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 676 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 97 actacttcttcgccgcgc 114 >gi|78105827|gb|DV524245.1|DV524245 ZM_BFb0210N18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 676 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 580 actacttcttcgccgcgc 563 >gi|86471035|gb|DY237405.1|DY237405 ZM_BFb0254I07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 669 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 577 actacttcttcgccgcgc 560 >gi|86472631|gb|DY239001.1|DY239001 ZM_BFb0257D14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 359 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 97 actacttcttcgccgcgc 114 >gi|89249097|gb|DY620883.1|DY620883 ZM_BFb0280I23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 445 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 97 actacttcttcgccgcgc 114 >gi|89758864|gb|DY687885.1|DY687885 ZM_BFb0280I23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 672 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 172 actacttcttcgccgcgc 189 |||||||||||||||||| Sbjct: 576 actacttcttcgccgcgc 559 >gi|58082334|gb|AC155473.2| Zea mays strain B73 clone ZMMBBb0597K14, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces Length = 128132 Score = 36.2 bits (18), Expect = 4.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 281 cagagcagttgattgatc 298 |||||||||||||||||| Sbjct: 99745 cagagcagttgattgatc 99728 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 188,463 Number of Sequences: 836351 Number of extensions: 188463 Number of successful extensions: 15571 Number of sequences better than 10.0: 166 Number of HSP's better than 10.0 without gapping: 166 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 15395 Number of HSP's gapped (non-prelim): 175 length of query: 529 length of database: 669,372,029 effective HSP length: 19 effective length of query: 510 effective length of database: 653,481,360 effective search space: 333275493600 effective search space used: 333275493600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)