BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 2478113.2.1 (796 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|32919702|gb|CF024514.1|CF024514 QBS6a04.xg QBS Zea mays cDNA ... 1114 0.0 gi|37376340|gb|CF624686.1|CF624686 zmrws05_0A20-007-e04.s3 zmrws... 1104 0.0 gi|4730395|gb|AI649561.1|AI649561 603006C09.x1 603 - stressed ro... 1086 0.0 gi|32919701|gb|CF024513.1|CF024513 QBS6a04.pg QBS Zea mays cDNA ... 896 0.0 gi|78022631|gb|DV491018.1|DV491018 1000124-F06.T7-1 UGI-Reseq Ze... 527 e-148 gi|47080524|gb|BV144421.1| PZA02428-75927-W22_R-scm2 Zea mays W2... 428 e-118 gi|47080523|gb|BV144420.1| PZA02428-75916-Tx501 Zea mays Tx501 Z... 428 e-118 gi|47080522|gb|BV144419.1| PZA02428-75925-Tx303 Zea mays Tx303 Z... 428 e-118 gi|47080521|gb|BV144418.1| PZA02428-75926-NC7A Zea mays NC7A Zea... 428 e-118 gi|47080520|gb|BV144417.1| PZA02428-75915-Mp708 Zea mays Mp708 Z... 428 e-118 gi|47080519|gb|BV144416.1| PZA02428-75928-Mo17 Zea mays Mo17 Zea... 428 e-118 gi|47080518|gb|BV144415.1| PZA02428-75924-Mo17 Zea mays Mo17 Zea... 428 e-118 gi|47080517|gb|BV144414.1| PZA02428-75913-GT119 Zea mays GT119 Z... 428 e-118 gi|47080516|gb|BV144413.1| PZA02428-75914-CO159 Zea mays CO159 Z... 428 e-118 gi|47080515|gb|BV144412.1| PZA02428-75917-B73 Zea mays B73 Zea m... 428 e-118 gi|47080514|gb|BV144411.1| PZA02428-75912-B73 Zea mays B73 Zea m... 428 e-118 gi|33100026|gb|CF059986.1|CF059986 QCS19f02.yg QCS Zea mays cDNA... 147 2e-33 gi|32860652|gb|CF000334.1|CF000334 QBG14h08.xg QBG Zea mays cDNA... 137 2e-30 gi|67029090|gb|CO457839.1|CO457839 MZCCL20015B03.g Maize Endospe... 137 2e-30 gi|67034311|gb|CO462861.1|CO462861 MZCCL20030B01.g Maize Endospe... 137 2e-30 gi|60395787|gb|DN228657.1|DN228657 MEST1001_B12.T7-1 UGA-ZmSAM-X... 129 6e-28 gi|60399697|gb|DN232507.1|DN232507 MEST1054_C10.T7-1 UGA-ZmSAM-X... 129 6e-28 gi|78104780|gb|DV523198.1|DV523198 ZM_BFb0209F03.r ZM_BFb Zea ma... 129 6e-28 gi|15177406|gb|BI398345.1|BI398345 949054B10.y1 949 - Juvenile l... 70 5e-10 gi|15499292|gb|BI595805.1|BI595805 949023B06.y1 949 - Juvenile l... 70 5e-10 gi|45847112|gb|CN071055.1|CN071055 1021007C01.x3 1021 - Unigene ... 62 1e-07 gi|60346372|gb|DN213345.1|DN213345 MEST963_H12.T7-1 UGA-ZmSAM-XZ... 50 4e-04 gi|14202531|gb|BG836208.1|BG836208 Zm06_03a02_R Zm06_AAFC_ECORC_... 44 0.027 gi|71761194|gb|DR959131.1|DR959131 ZM_BFb0065E24.f ZM_BFb Zea ma... 44 0.027 gi|5398745|gb|AI812210.1|AI812210 605086H08.y1 605 - Endosperm c... 42 0.11 gi|9952614|gb|BE639302.1|BE639302 946020E10.y2 946 - tassel prim... 42 0.11 gi|15499634|gb|BI596147.1|BI596147 949078E10.y1 949 - Juvenile l... 42 0.11 gi|15632652|gb|BI679745.1|BI679745 949078E10.y2 949 - Juvenile l... 42 0.11 gi|21432126|gb|BQ547616.1|BQ547616 1091059C05.y1 1091 - Immature... 42 0.11 gi|21987339|gb|BQ778867.1|BQ778867 946114H03.y1 946 - tassel pri... 42 0.11 gi|22133554|gb|BQ833771.1|BQ833771 946125E10.y1 946 - tassel pri... 42 0.11 gi|22472163|gb|BU036643.1|BU036643 946128F03.y1 946 - tassel pri... 42 0.11 gi|22546206|gb|BU098532.1|BU098532 946135H08.y1 946 - tassel pri... 42 0.11 gi|60349413|gb|DN216386.1|DN216386 MEST1034_C01.T7-1 UGA-ZmSAM-X... 42 0.11 gi|60355275|gb|DN222248.1|DN222248 MEST1125_E06.T7-1 UGA-ZmSAM-X... 42 0.11 gi|78026001|gb|DV494388.1|DV494388 1000119-F04.T7-1 UGI-Reseq Ze... 42 0.11 gi|67040056|gb|CO466311.1|CO466311 MZCCL20036H08.g Maize Endospe... 40 0.42 gi|78087385|gb|DV515778.1|DV515778 ZM_BFb0198I03.r ZM_BFb Zea ma... 40 0.42 gi|78106610|gb|DV525028.1|DV525028 ZM_BFb0212A08.r ZM_BFb Zea ma... 40 0.42 gi|51315582|gb|AC147789.2| Zea mays clone ZMMBBb0355N05, *** SEQ... 40 0.42 gi|5268365|gb|AI770329.1|AI770329 606061B01.x1 606 - Ear tissue ... 38 1.7 gi|5499546|gb|AI855413.1|AI855413 603016D03.x1 603 - stressed ro... 38 1.7 gi|5525279|gb|AI861118.1|AI861118 603012D05.x1 603 - stressed ro... 38 1.7 gi|6021626|gb|AW066554.1|AW066554 683002B08.x1 683 - 14 day imma... 38 1.7 gi|9794788|gb|BE553096.1|BE553096 946089C06.y1 946 - tassel prim... 38 1.7 gi|12971518|gb|BG267522.1|BG267522 1000126H12.x2 1000 - Unigene ... 38 1.7 gi|15177490|gb|BI398429.1|BI398429 949055B10.y1 949 - Juvenile l... 38 1.7 gi|15545654|gb|BI643448.1|BI643448 949076E11.y1 949 - Juvenile l... 38 1.7 gi|15590319|gb|BI674935.1|BI674935 949076E11.y2 949 - Juvenile l... 38 1.7 gi|21621229|gb|BQ619235.1|BQ619235 RNOSEQ5C10_SK.ab1 Salt stress... 38 1.7 gi|31353226|gb|CD437583.1|CD437583 EL01N0502F04.b Endosperm_5 Ze... 38 1.7 gi|50327623|gb|CO522749.1|CO522749 3530_1_150_1_B05.y_1 3530 - F... 38 1.7 gi|67031472|gb|CO460221.1|CO460221 MZCCL15022C10.g Maize Endospe... 38 1.7 gi|71429168|gb|DR810218.1|DR810218 ZM_BFb0037M18.r ZM_BFb Zea ma... 38 1.7 gi|76011907|gb|DT939077.1|DT939077 ZM_BFb0120M21.r ZM_BFb Zea ma... 38 1.7 gi|76015062|gb|DT942232.1|DT942232 ZM_BFb0127E14.r ZM_BFb Zea ma... 38 1.7 gi|76910588|gb|DV163935.1|DV163935 ZM_BFb0160C20.r ZM_BFb Zea ma... 38 1.7 gi|78022711|gb|DV491098.1|DV491098 1000126-H12.T7-1 UGI-Reseq Ze... 38 1.7 gi|78105252|gb|DV523670.1|DV523670 ZM_BFb0209P20.r ZM_BFb Zea ma... 38 1.7 gi|78116936|gb|DV535323.1|DV535323 ZM_BFb0227F02.r ZM_BFb Zea ma... 38 1.7 gi|86472051|gb|DY238421.1|DY238421 ZM_BFb0256E09.r ZM_BFb Zea ma... 38 1.7 gi|93011916|gb|EB637436.1|EB637436 ZM_BFb0323C04.r ZM_BFb Zea ma... 38 1.7 gi|93014899|gb|EB640419.1|EB640419 ZM_BFb0329E16.r ZM_BFb Zea ma... 38 1.7 gi|13447798|gb|AF326490.1|AF326490 Zea mays plasma membrane inte... 38 1.7 gi|21209094|gb|AY106016.1| Zea mays PCO107590 mRNA sequence 38 1.7 gi|21212050|gb|AY108802.1| Zea mays PCO110359 mRNA sequence 38 1.7 gi|13469965|gb|G67984.1|G67984 umc1645 SSR containing sequences ... 38 1.7 gi|21212050|gb|AY108802.1| Zea mays PCO110359 mRNA sequence 38 1.7 gi|21209094|gb|AY106016.1| Zea mays PCO107590 mRNA sequence 38 1.7 gi|13447798|gb|AF326490.1|AF326490 Zea mays plasma membrane inte... 38 1.7 gi|85861405|gb|AC177895.1| Zea mays chromosome UNK clone CH201-2... 38 1.7 gi|58082413|gb|AC155554.2| Zea mays strain B73 clone ZMMBBc0161G... 38 1.7 gi|8930270|gb|BE225034.1|BE225034 946015E03.x2 946 - tassel prim... 36 6.5 gi|9952318|gb|BE638901.1|BE638901 946015E03.y1 946 - tassel prim... 36 6.5 gi|9953164|gb|BE639747.1|BE639747 946037H12.y1 946 - tassel prim... 36 6.5 gi|14243437|gb|BG841103.2|BG841103 MEST15-F08.T3 ISUM4-TN Zea ma... 36 6.5 gi|20506619|gb|BQ279271.1|BQ279271 1091029B11.x1 1091 - Immature... 36 6.5 gi|21481371|gb|BQ578054.1|BQ578054 3524_1_52_1_E03.y_1 3524 - Ma... 36 6.5 gi|21626451|gb|BQ621372.1|BQ621372 3524_1_48_1_H04.y_1 3524 - Ma... 36 6.5 gi|22472284|gb|BU036764.1|BU036764 946129E03.y1 946 - tassel pri... 36 6.5 gi|22542796|gb|BU093234.1|BU093234 1091057H08.x1 1091 - Immature... 36 6.5 gi|22546341|gb|BU098652.1|BU098652 946129E03.y3 946 - tassel pri... 36 6.5 gi|26455512|gb|CA827095.1|CA827095 1114009G07.y1 1114 - Unigene ... 36 6.5 gi|26455613|gb|CA827196.1|CA827196 1114011C04.y1 1114 - Unigene ... 36 6.5 gi|31355218|gb|CD439575.1|CD439575 EL01N0526E04.b Endosperm_5 Ze... 36 6.5 gi|32797880|gb|CD950116.1|CD950116 SAP_108 GeneTag2 Zea mays cDN... 36 6.5 gi|32797959|gb|CD950195.1|CD950195 SAP_225 GeneTag2 Zea mays cDN... 36 6.5 gi|32800688|gb|CD952924.1|CD952924 SBF_113 GeneTag2 Zea mays cDN... 36 6.5 gi|32800779|gb|CD953015.1|CD953015 SBF_42 GeneTag2 Zea mays cDNA... 36 6.5 gi|33104070|gb|CF064030.1|CF064030 QCU6c11.yg QCU Zea mays cDNA ... 36 6.5 gi|33466621|gb|CF243670.1|CF243670 3530_1_23_1_A10.y_1 3530 - Fu... 36 6.5 gi|33467781|gb|CF244830.1|CF244830 3530_1_5_1_B06.y_2 3530 - Ful... 36 6.5 gi|40334106|gb|CK368176.1|CK368176 zmrws055_0A11-005-d03.s0 zmrw... 36 6.5 gi|40334861|gb|CK368931.1|CK368931 zmrws055_0B20-001-a03.s0 zmrw... 36 6.5 gi|50326419|gb|CO521545.1|CO521545 3530_1_142_1_C09.y_1 3530 - F... 36 6.5 gi|50331289|gb|CO526415.1|CO526415 3530_1_175_1_F12.y_1 3530 - F... 36 6.5 gi|50335083|gb|CO530209.1|CO530209 3530_1_19_1_A10.y_1 3530 - Fu... 36 6.5 gi|50335848|gb|CO530974.1|CO530974 3530_1_204_1_D08.x_1 3530 - F... 36 6.5 gi|50335849|gb|CO530975.1|CO530975 3530_1_204_1_D08.y_1 3530 - F... 36 6.5 gi|50338805|gb|CO533931.1|CO533931 3530_1_223_1_G09.y_1 3530 - F... 36 6.5 gi|60337350|gb|DN204323.1|DN204323 MEST802_D08.T7-1 UGA-ZmSAM-XZ... 36 6.5 gi|60340516|gb|DN207489.1|DN207489 MEST850_C02.T7-1 UGA-ZmSAM-XZ... 36 6.5 gi|67012379|gb|CO441128.1|CO441128 MZCCL10027E05.g Maize Endospe... 36 6.5 gi|67012770|gb|CO441519.1|CO441519 MZCCL10032G06.g Maize Endospe... 36 6.5 gi|67015824|gb|CO444573.1|CO444573 MZCCL10073C11.g Maize Endospe... 36 6.5 gi|71316297|gb|DR794836.1|DR794836 ZM_BFb0015L09.r ZM_BFb Zea ma... 36 6.5 gi|71329637|gb|DR801545.1|DR801545 ZM_BFb0025G18.r ZM_BFb Zea ma... 36 6.5 gi|71330936|gb|DR802274.1|DR802274 ZM_BFb0026H13.r ZM_BFb Zea ma... 36 6.5 gi|71423557|gb|DR806077.1|DR806077 ZM_BFb0031N10.r ZM_BFb Zea ma... 36 6.5 gi|71445391|gb|DR826441.1|DR826441 ZM_BFb0069D10.r ZM_BFb Zea ma... 36 6.5 gi|71449761|gb|DR830811.1|DR830811 ZM_BFb0079C13.r ZM_BFb Zea ma... 36 6.5 gi|71769277|gb|DR967214.1|DR967214 ZM_BFb0087P17.r ZM_BFb Zea ma... 36 6.5 gi|71773143|gb|DR971057.1|DR971057 ZM_BFb0093J10.r ZM_BFb Zea ma... 36 6.5 gi|74035110|gb|DT535600.1|DT535600 E1897 Zea mays egg cell cDNA ... 36 6.5 gi|74238488|gb|DT646402.1|DT646402 ZM_BFb0106O02.r ZM_BFb Zea ma... 36 6.5 gi|74245747|gb|DT653661.1|DT653661 ZM_BFb0125I09.f ZM_BFb Zea ma... 36 6.5 gi|74245813|gb|DT653727.1|DT653727 ZM_BFb0125K05.r ZM_BFb Zea ma... 36 6.5 gi|78077757|gb|DV506189.1|DV506189 ZM_BFb0183M23.r ZM_BFb Zea ma... 36 6.5 gi|78081590|gb|DV510002.1|DV510002 ZM_BFb0189G16.f ZM_BFb Zea ma... 36 6.5 gi|78087539|gb|DV515932.1|DV515932 ZM_BFb0198L11.r ZM_BFb Zea ma... 36 6.5 gi|78089106|gb|DV517494.1|DV517494 ZM_BFb0201A15.r ZM_BFb Zea ma... 36 6.5 gi|78544132|gb|DV621630.1|DV621630 IV-1091-404C-C08.T7-1 UGIV-10... 36 6.5 gi|78544830|gb|DV622328.1|DV622328 IV-1091-404B-C07.T7-1 UGIV-10... 36 6.5 gi|87154694|gb|DY399483.1|DY399483 IV-3524-3A-G07.T3 UGIV-3524-R... 36 6.5 gi|87154707|gb|DY399496.1|DY399496 IV-3524-3D-C04.T3 UGIV-3524-R... 36 6.5 gi|89247793|gb|DY619579.1|DY619579 ZM_BFb0277K09.r ZM_BFb Zea ma... 36 6.5 gi|89760569|gb|DY688925.1|DY688925 ZM_BFb0284F21.r ZM_BFb Zea ma... 36 6.5 gi|91049516|gb|EB159934.1|EB159934 ZM_BFb0296H12.f ZM_BFb Zea ma... 36 6.5 gi|91049517|gb|EB159935.1|EB159935 ZM_BFb0296H12.r ZM_BFb Zea ma... 36 6.5 gi|93012566|gb|EB638086.1|EB638086 ZM_BFb0325A12.r ZM_BFb Zea ma... 36 6.5 gi|54653773|gb|BT018992.1| Zea mays clone Contig480.F mRNA sequence 36 6.5 gi|67043717|gb|DQ002407.1| Zea mays copia retrotransposon opie1,... 36 6.5 gi|47101218|gb|BV151761.1| PZA02164-68921-Tx501 Zea mays Tx501 Z... 36 6.5 gi|47101216|gb|BV151759.1| PZA02164-68930-T218 Zea mays T218 Zea... 36 6.5 gi|47101215|gb|BV151758.1| PZA02164-68920-Mp708 Zea mays Mp708 Z... 36 6.5 gi|47101213|gb|BV151756.1| PZA02164-68918-GT119 Zea mays GT119 Z... 36 6.5 gi|47101212|gb|BV151755.1| PZA02164-68919-CO159 Zea mays CO159 Z... 36 6.5 gi|54653773|gb|BT018992.1| Zea mays clone Contig480.F mRNA sequence 36 6.5 gi|93004171|gb|AC185500.1| Zea mays chromosome 3 clone CH201-528... 36 6.5 gi|92900807|gb|AC185471.1| Zea mays chromosome 4 clone CH201-266... 36 6.5 gi|92900715|gb|AC185464.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|92900439|gb|AC185452.1| Zea mays chromosome UNK clone CH201-3... 36 6.5 gi|92899955|gb|AC185435.1| Zea mays chromosome UNK clone CH201-4... 36 6.5 gi|92110185|gb|AC185322.1| Zea mays chromosome UNK clone CH201-1... 36 6.5 gi|92110167|gb|AC185304.1| Zea mays chromosome UNK clone CH201-3... 36 6.5 gi|91982826|gb|AC185282.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|91065006|gb|AC184782.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|90992704|gb|AC184707.1| Zea mays chromosome UNK clone CH201-1... 36 6.5 gi|90992702|gb|AC184705.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|90963039|gb|AC184167.1| Zea mays chromosome UNK clone ZMMBBb-... 36 6.5 gi|90855891|gb|AC184140.1| Zea mays chromosome UNK clone CH201-3... 36 6.5 gi|90855887|gb|AC184136.1| Zea mays chromosome UNK clone CH201-3... 36 6.5 gi|90855867|gb|AC184116.1| Zea mays chromosome UNK clone ZMMBBb-... 36 6.5 gi|90659936|gb|AC183973.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|90568160|gb|AC183948.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|90093414|gb|AC183822.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|89515021|gb|AC183658.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|89337324|gb|AC183519.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|88900607|gb|AC182604.2| Zea mays chromosome UNK clone CH201-4... 36 6.5 gi|89257785|gb|AC182112.2| Zea mays chromosome UNK clone CH201-1... 36 6.5 gi|89257758|gb|AC182107.2| Zea mays chromosome UNK clone ZMMBBb-... 36 6.5 gi|85861444|gb|AC177934.1| Zea mays chromosome UNK clone CH201-1... 36 6.5 gi|89257733|gb|AC177862.2| Zea mays chromosome UNK clone CH201-4... 36 6.5 gi|85861362|gb|AC177852.1| Zea mays chromosome UNK clone CH201-9... 36 6.5 gi|85861337|gb|AC177827.1| Zea mays chromosome UNK clone CH201-2... 36 6.5 gi|62238005|gb|AC159612.1| Zea mays chromosome 5S clone ZMMBBb05... 36 6.5 gi|58082480|gb|AC155621.2| Zea mays strain B73 clone ZMMBBc0364F... 36 6.5 gi|58082459|gb|AC155600.2| Zea mays strain B73 clone ZMMBBc0222B... 36 6.5 gi|58082442|gb|AC155583.2| Zea mays strain B73 clone ZMMBBc0196E... 36 6.5 gi|58082417|gb|AC155558.2| Zea mays strain B73 clone ZMMBBc0169G... 36 6.5 gi|58082380|gb|AC155520.2| Zea mays strain B73 clone ZMMBBc0111D... 36 6.5 gi|58082379|gb|AC155519.2| Zea mays strain B73 clone ZMMBBc0106G... 36 6.5 gi|58082369|gb|AC155509.2| Zea mays strain B73 clone ZMMBBc0049G... 36 6.5 gi|58082351|gb|AC155491.2| Zea mays strain B73 clone ZMMBBc0016P... 36 6.5 gi|58082327|gb|AC155466.2| Zea mays strain B73 clone ZMMBBb0521N... 36 6.5 gi|58082319|gb|AC155458.2| Zea mays strain B73 clone ZMMBBb0459N... 36 6.5 gi|58082305|gb|AC155444.2| Zea mays strain B73 clone ZMMBBb0290C... 36 6.5 gi|58082293|gb|AC155431.2| Zea mays strain B73 clone ZMMBBb0240E... 36 6.5 gi|58082271|gb|AC155409.2| Zea mays strain B73 clone ZMMBBb0189A... 36 6.5 gi|58082265|gb|AC155403.2| Zea mays strain B73 clone ZMMBBb0174A... 36 6.5 gi|58082246|gb|AC155384.2| Zea mays strain B73 clone ZMMBBb0139F... 36 6.5 gi|58082243|gb|AC155381.2| Zea mays strain B73 clone ZMMBBb0133B... 36 6.5 gi|57862898|gb|AC155377.1| Zea mays strain B73 clone ZMMBBb0129I... 36 6.5 gi|58082237|gb|AC155374.2| Zea mays strain B73 clone ZMMBBb0121F... 36 6.5 gi|58082232|gb|AC155369.2| Zea mays strain B73 clone ZMMBBb0101F... 36 6.5 gi|58082225|gb|AC155362.2| Zea mays strain B73 clone ZMMBBb0048H... 36 6.5 gi|57790133|gb|AC149812.2| Zea mays clone ZMMBBb0125F17, *** SEQ... 36 6.5 gi|57790131|gb|AC149810.2| Zea mays clone ZMMBBb0018A20, *** SEQ... 36 6.5 gi|58531545|gb|AC149309.3| Zea mays clone ZMMBBc0079F17, *** SEQ... 36 6.5 gi|48762579|gb|AC148167.6| Zea mays clone ZMMBBc0448A01, *** SEQ... 36 6.5 gi|48762577|gb|AC147504.6| Zea mays clone ZMMBBc0289B19, *** SEQ... 36 6.5 >gi|32919702|gb|CF024514.1|CF024514 QBS6a04.xg QBS Zea mays cDNA clone QBS6a04, mRNA sequence Length = 584 Score = 1114 bits (562), Expect = 0.0 Identities = 576/583 (98%) Strand = Plus / Minus Query: 211 gggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacgacggcga 270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 584 gggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacgacggcga 525 Query: 271 cgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgcgcacgaa 330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 524 cgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgcgcacgaa 465 Query: 331 cttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcgatgaacag 390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 464 cttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcgatgaacag 405 Query: 391 cagcttgagctcgtaccagatggggatccagtatatgagggactcgaggagcatctccat 450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 404 cagcttgagctcgtaccagatggggatccagtatatgagggactcgaggagcatctccat 345 Query: 451 gagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtcgtccagcttgga 510 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 344 gagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtcgtccagcttgga 285 Query: 511 cgggctctccatcgcccgcacggacgcgtacagagggtacagcagcatcaccgttggccc 570 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 284 cgggctctccatcgcccgcacggacgcgtacagagggtacagcagcatcaccgttggccc 225 Query: 571 tgctagggagtggaggtgagtgaggatcgtccacagcttgcccatcctgtctgcgaactt 630 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 224 tgctagggagtggaggtgagtgaggatcgtccacagcttgcccatcctgtctgcgaactt 165 Query: 631 cttctcacagctcggtggtggtgtgttgtctggttgtggtgtcgcttgccgctctcactg 690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 164 cttctcacagctcggtggtggtgtgttgtctggttgtggtgtcgcttgccgctctcactg 105 Query: 691 gaagctgctagctagagatgatggacggacaggacaatctatgagcgagtgagtgtgagt 750 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 104 gaagctgctagctagagatgatggacggacaggacaatctatgagcgagtgagtgtgagt 45 Query: 751 gagtgagccaannnnnnnctgcttctctgcttgggtttgggcc 793 ||||||||||| ||||||||||||||||||||||||| Sbjct: 44 gagtgagccaaatggtctctgcttctctgcttgggtttgggcc 2 >gi|37376340|gb|CF624686.1|CF624686 zmrws05_0A20-007-e04.s3 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 574 Score = 1104 bits (557), Expect = 0.0 Identities = 569/573 (99%) Strand = Plus / Plus Query: 1 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 60 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2 gcaccgaaagttggctcttgtctccattccatgttagagttgatgctcacacatacagaa 61 Query: 61 tggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatct 120 ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| Sbjct: 62 tggccatacacacatcgtacaggctctatttcaagtcgagaacaaacacaacagaaatct 121 Query: 121 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 122 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 181 Query: 181 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 182 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 241 Query: 241 gggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtgag 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 242 gggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtgag 301 Query: 301 gccgtgcttccggagctgctcgcgcacgaacttgtcgtagatgaaggcggcgcccctgaa 360 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 302 gccgtgcttccggagctgctcgcgcacgaacttgtcgtagatgaaggcggcggccctgaa 361 Query: 361 gttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatcca 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 362 gttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatcca 421 Query: 421 gtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccagta 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 422 gtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccagta 481 Query: 481 ggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacgcgta 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 482 ggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacgcgta 541 Query: 541 cagagggtacagcagcatcaccgttggccctgc 573 ||||||||||||||||||||||||||||||||| Sbjct: 542 cagagggtacagcagcatcaccgttggccctgc 574 >gi|4730395|gb|AI649561.1|AI649561 603006C09.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 551 Score = 1086 bits (548), Expect = 0.0 Identities = 550/551 (99%) Strand = Plus / Plus Query: 1 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 60 Query: 61 tggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatct 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatct 120 Query: 121 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 180 Query: 181 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 240 Query: 241 gggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtgag 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 gggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtgag 300 Query: 301 gccgtgcttccggagctgctcgcgcacgaacttgtcgtagatgaaggcggcgcccctgaa 360 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 gccgngcttccggagctgctcgcgcacgaacttgtcgtagatgaaggcggcgcccctgaa 360 Query: 361 gttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatcca 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 gttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatcca 420 Query: 421 gtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccagta 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 gtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccagta 480 Query: 481 ggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacgcgta 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 481 ggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacgcgta 540 Query: 541 cagagggtaca 551 ||||||||||| Sbjct: 541 cagagggtaca 551 >gi|32919701|gb|CF024513.1|CF024513 QBS6a04.pg QBS Zea mays cDNA clone QBS6a04, mRNA sequence Length = 551 Score = 896 bits (452), Expect = 0.0 Identities = 481/488 (98%), Gaps = 2/488 (0%) Strand = Plus / Plus Query: 1 gcaccgaaag-ttggcacttgtctccattccatgttagagttgatgctcacacatacaga 59 |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 64 gcaccgaaaggttggctcttgtctccattccatgttagagttgatgctcacacatacaga 123 Query: 60 atggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatc 119 |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 124 atggccatacacacatcgtacaggctctatttcaagtcgagaacaaacacaacagaaatc 183 Query: 120 tagtggagtgcactacagctacaggttgccgggacatggtccaggaatggg-atcactgc 178 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 184 tagtggagtgcactacagctacaggttgccgggacatggtccaggaatggggatcactgc 243 Query: 179 aacccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttc 238 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 244 aacccacttcagtaagctccatgatccttcttgggcgtgacgaaggcgaggaacttgttc 303 Query: 239 ttgggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtg 298 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 304 ttgggcttgtccttgtccttggacgacggcgacgacgacttgacggagccggcggcggtg 363 Query: 299 aggccgtgcttccggagctgctcgcgcacgaacttgtcgtagatgaaggcggcgcccctg 358 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 364 aggccgtgcttccggagctgctcgcgcacgaacttgtcgtaaatgaaggcggcgcccctg 423 Query: 359 aagttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatc 418 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 424 aagttggggagcacgagccacgcgatgaacagcagcttgagctcgtaccagatggggatc 483 Query: 419 cagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccag 478 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 484 cagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatccag 543 Query: 479 taggcgag 486 |||||||| Sbjct: 544 taggcgag 551 >gi|78022631|gb|DV491018.1|DV491018 1000124-F06.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 281 Score = 527 bits (266), Expect = e-148 Identities = 266/266 (100%) Strand = Plus / Plus Query: 1 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 16 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 75 Query: 61 tggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatct 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 76 tggccatacacacatcgtagaggctctatttcatgtcgagaacaaacacaacagaaatct 135 Query: 121 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 136 agtggagtgcactacagctacaggttgccgggacatggtccaggaatgggatcactgcaa 195 Query: 181 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 196 cccacttcagtaagcttcatgatccttcttgggcgtgacgaaggcgaggaacttgttctt 255 Query: 241 gggcttgtccttgtccttggacgacg 266 |||||||||||||||||||||||||| Sbjct: 256 gggcttgtccttgtccttggacgacg 281 >gi|47080524|gb|BV144421.1| PZA02428-75927-W22_R-scm2 Zea mays W22_R-scm2 Zea mays STS genomic, sequence tagged site Length = 372 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 45 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 104 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 105 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 164 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 224 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 225 tgaacagcagcttgagctcgtaccagatggggatcc 260 Score = 44.1 bits (22), Expect = 0.027 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgagg 439 |||||||||||||||||||||| Sbjct: 351 ccagtatatgagggactcgagg 372 >gi|47080523|gb|BV144420.1| PZA02428-75916-Tx501 Zea mays Tx501 Zea mays STS genomic, sequence tagged site Length = 378 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 63 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 122 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 182 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 242 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 243 tgaacagcagcttgagctcgtaccagatggggatcc 278 >gi|47080522|gb|BV144419.1| PZA02428-75925-Tx303 Zea mays Tx303 Zea mays STS genomic, sequence tagged site Length = 461 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 101 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 160 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 161 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 220 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 221 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 280 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 281 tgaacagcagcttgagctcgtaccagatggggatcc 316 Score = 109 bits (55), Expect = 5e-22 Identities = 55/55 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagagg 472 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 407 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagagg 461 >gi|47080521|gb|BV144418.1| PZA02428-75926-NC7A Zea mays NC7A Zea mays STS genomic, sequence tagged site Length = 484 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 138 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 197 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 198 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 257 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 258 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 317 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 318 tgaacagcagcttgagctcgtaccagatggggatcc 353 Score = 81.8 bits (41), Expect = 1e-13 Identities = 41/41 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtga 458 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 444 ccagtatatgagggactcgaggagcatctccatgagcgtga 484 >gi|47080520|gb|BV144417.1| PZA02428-75915-Mp708 Zea mays Mp708 Zea mays STS genomic, sequence tagged site Length = 491 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 43 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 102 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 103 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 162 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 163 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 222 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 223 tgaacagcagcttgagctcgtaccagatggggatcc 258 Score = 258 bits (130), Expect = 1e-66 Identities = 133/134 (99%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 477 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 349 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 408 Query: 478 gtaggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacgc 537 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 409 gtaggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacgggcgc 468 Query: 538 gtacagagggtaca 551 |||||||||||||| Sbjct: 469 gtacagagggtaca 482 >gi|47080519|gb|BV144416.1| PZA02428-75928-Mo17 Zea mays Mo17 Zea mays STS genomic, sequence tagged site Length = 620 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 171 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 230 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 231 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 290 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 291 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 350 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 351 tgaacagcagcttgagctcgtaccagatggggatcc 386 Score = 242 bits (122), Expect = 6e-62 Identities = 135/138 (97%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtag-aggatcc 476 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 477 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtaggaggatcc 536 Query: 477 agtaggcgagccactgctcgtcgtccagcttggacgggctctccatcgcccgcacggacg 536 ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| Sbjct: 537 agtaggcgagccactgctcgtcgtcgagcttggacgggctctccatcgcccgcagggacg 596 Query: 537 cgtacagagggtacagca 554 |||||||||||||||||| Sbjct: 597 cgtacagagggtacagca 614 Score = 63.9 bits (32), Expect = 3e-08 Identities = 32/32 (100%) Strand = Plus / Plus Query: 175 ctgcaacccacttcagtaagcttcatgatcct 206 |||||||||||||||||||||||||||||||| Sbjct: 7 ctgcaacccacttcagtaagcttcatgatcct 38 >gi|47080518|gb|BV144415.1| PZA02428-75924-Mo17 Zea mays Mo17 Zea mays STS genomic, sequence tagged site Length = 383 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 37 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 96 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 97 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 156 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 157 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 216 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 217 tgaacagcagcttgagctcgtaccagatggggatcc 252 Score = 81.8 bits (41), Expect = 1e-13 Identities = 41/41 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtga 458 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 343 ccagtatatgagggactcgaggagcatctccatgagcgtga 383 >gi|47080517|gb|BV144414.1| PZA02428-75913-GT119 Zea mays GT119 Zea mays STS genomic, sequence tagged site Length = 355 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 45 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 104 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 105 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 164 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 224 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 225 tgaacagcagcttgagctcgtaccagatggggatcc 260 >gi|47080516|gb|BV144413.1| PZA02428-75914-CO159 Zea mays CO159 Zea mays STS genomic, sequence tagged site Length = 388 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 25 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 84 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 85 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 144 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 145 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 204 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 205 tgaacagcagcttgagctcgtaccagatggggatcc 240 Score = 115 bits (58), Expect = 9e-24 Identities = 58/58 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatc 475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 331 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatc 388 >gi|47080515|gb|BV144412.1| PZA02428-75917-B73 Zea mays B73 Zea mays STS genomic, sequence tagged site Length = 495 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 81 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 140 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 141 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 200 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 201 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 260 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 261 tgaacagcagcttgagctcgtaccagatggggatcc 296 Score = 194 bits (98), Expect = 1e-47 Identities = 107/109 (98%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 477 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 387 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 446 Query: 478 gtaggcgagccactgctcgtcgtccagcttggac-gggctctccatcgc 525 ||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 447 ntaggcgagccactgctcgtcgtccagcttggacggggctctccatcgc 495 >gi|47080514|gb|BV144411.1| PZA02428-75912-B73 Zea mays B73 Zea mays STS genomic, sequence tagged site Length = 550 Score = 428 bits (216), Expect = e-118 Identities = 216/216 (100%) Strand = Plus / Plus Query: 204 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 142 ccttcttgggcgtgacgaaggcgaggaacttgttcttgggcttgtccttgtccttggacg 201 Query: 264 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 202 acggcgacgacgacttgacggagccggcggcggtgaggccgtgcttccggagctgctcgc 261 Query: 324 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 262 gcacgaacttgtcgtagatgaaggcggcgcccctgaagttggggagcacgagccacgcga 321 Query: 384 tgaacagcagcttgagctcgtaccagatggggatcc 419 |||||||||||||||||||||||||||||||||||| Sbjct: 322 tgaacagcagcttgagctcgtaccagatggggatcc 357 Score = 190 bits (96), Expect = 2e-46 Identities = 96/96 (100%) Strand = Plus / Plus Query: 418 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 477 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 448 ccagtatatgagggactcgaggagcatctccatgagcgtgacgaaggagtagaggatcca 507 Query: 478 gtaggcgagccactgctcgtcgtccagcttggacgg 513 |||||||||||||||||||||||||||||||||||| Sbjct: 508 gtaggcgagccactgctcgtcgtccagcttggacgg 543 >gi|33100026|gb|CF059986.1|CF059986 QCS19f02.yg QCS Zea mays cDNA clone QCS19f02, mRNA sequence Length = 129 Score = 147 bits (74), Expect = 2e-33 Identities = 77/78 (98%) Strand = Plus / Minus Query: 1 gcaccgaaagttggcacttgtctccattccatgttagagttgatgctcacacatacagaa 60 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 78 gcaccgaaagttggctcttgtctccattccatgttagagttgatgctcacacatacagaa 19 Query: 61 tggccatacacacatcgt 78 |||||||||||||||||| Sbjct: 18 tggccatacacacatcgt 1 >gi|32860652|gb|CF000334.1|CF000334 QBG14h08.xg QBG Zea mays cDNA clone QBG14h08, mRNA sequence Length = 609 Score = 137 bits (69), Expect = 2e-30 Identities = 105/117 (89%) Strand = Plus / Minus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||||| |||||||||||||| Sbjct: 312 gagcatctccaggagggtgacgaaggagtgtatgatccagtaggacagccactgctcgtc 253 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 252 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 196 >gi|67029090|gb|CO457839.1|CO457839 MZCCL20015B03.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 821 Score = 137 bits (69), Expect = 2e-30 Identities = 105/117 (89%) Strand = Plus / Minus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||||| |||||||||||||| Sbjct: 320 gagcatctccaggagggtgacgaaggagtgtatgatccagtaggacagccactgctcgtc 261 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 260 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 204 >gi|67034311|gb|CO462861.1|CO462861 MZCCL20030B01.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 851 Score = 137 bits (69), Expect = 2e-30 Identities = 105/117 (89%) Strand = Plus / Minus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||||| |||||||||||||| Sbjct: 278 gagcatctccaggagggtgacgaaggagtgtatgatccagtaggacagccactgctcgtc 219 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 218 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 162 >gi|60395787|gb|DN228657.1|DN228657 MEST1001_B12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 650 Score = 129 bits (65), Expect = 6e-28 Identities = 104/117 (88%) Strand = Plus / Plus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||| | |||||||||||||| Sbjct: 512 gagcatctccaggagggtgacgaaggagtgtatgatccagtatgacagccactgctcgtc 571 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 572 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 628 >gi|60399697|gb|DN232507.1|DN232507 MEST1054_C10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 725 Score = 129 bits (65), Expect = 6e-28 Identities = 104/117 (88%) Strand = Plus / Plus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||| | |||||||||||||| Sbjct: 512 gagcatctccaggagggtgacgaaggagtgtatgatccagtatgacagccactgctcgtc 571 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 572 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 628 >gi|78104780|gb|DV523198.1|DV523198 ZM_BFb0209F03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 643 Score = 129 bits (65), Expect = 6e-28 Identities = 104/117 (88%) Strand = Plus / Minus Query: 439 gagcatctccatgagcgtgacgaaggagtagaggatccagtaggcgagccactgctcgtc 498 ||||||||||| ||| ||||||||||||| | ||||||||| | |||||||||||||| Sbjct: 178 gagcatctccaggagggtgacgaaggagtgtatgatccagtatgacagccactgctcgtc 119 Query: 499 gtccagcttggacgggctctccatcgcccgcacggacgcgtacagagggtacagcag 555 |||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||| Sbjct: 118 gtccgccttggacgggctctccatcgcgcacaccgacgcgtacagagggtacagcag 62 >gi|15177406|gb|BI398345.1|BI398345 949054B10.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 523 Score = 69.9 bits (35), Expect = 5e-10 Identities = 83/99 (83%) Strand = Plus / Minus Query: 464 gagtagaggatccagtaggcgagccactgctcgtcgtccagcttggacgggctctccatc 523 ||||| |||| |||||||| ||||||||||| ||||||||| || |||||||| || Sbjct: 224 gagtacaggacccagtaggtgagccactgctggtcgtccagggaagaagggctctcgatg 165 Query: 524 gcccgcacggacgcgtacagagggtacagcagcatcacc 562 || |||| ||||||||| ||||| || |||||||||||| Sbjct: 164 gcgcgcatggacgcgtagagaggataaagcagcatcacc 126 >gi|15499292|gb|BI595805.1|BI595805 949023B06.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 332 Score = 69.9 bits (35), Expect = 5e-10 Identities = 83/99 (83%) Strand = Plus / Minus Query: 464 gagtagaggatccagtaggcgagccactgctcgtcgtccagcttggacgggctctccatc 523 ||||| |||| |||||||| ||||||||||| ||||||||| || |||||||| || Sbjct: 239 gagtacaggacccagtaggtgagccactgctggtcgtccagggaagaagggctctcgatg 180 Query: 524 gcccgcacggacgcgtacagagggtacagcagcatcacc 562 || |||| ||||||||| ||||| || |||||||||||| Sbjct: 179 gcgcgcatggacgcgtagagaggataaagcagcatcacc 141 >gi|45847112|gb|CN071055.1|CN071055 1021007C01.x3 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 556 Score = 61.9 bits (31), Expect = 1e-07 Identities = 82/99 (82%) Strand = Plus / Plus Query: 464 gagtagaggatccagtaggcgagccactgctcgtcgtccagcttggacgggctctccatc 523 ||||| |||| |||||||| ||||||||||| |||| |||| || |||||||| || Sbjct: 441 gagtacaggacccagtaggtgagccactgctggtcgcccagggaagaagggctctcgatg 500 Query: 524 gcccgcacggacgcgtacagagggtacagcagcatcacc 562 || |||| ||||||||| ||||| || |||||||||||| Sbjct: 501 gcgcgcatggacgcgtagagaggataaagcagcatcacc 539 >gi|60346372|gb|DN213345.1|DN213345 MEST963_H12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 600 Score = 50.1 bits (25), Expect = 4e-04 Identities = 37/41 (90%) Strand = Plus / Plus Query: 464 gagtagaggatccagtaggcgagccactgctcgtcgtccag 504 ||||| |||| |||||||| ||||||||||| ||||||||| Sbjct: 549 gagtacaggacccagtaggtgagccactgctggtcgtccag 589 >gi|14202531|gb|BG836208.1|BG836208 Zm06_03a02_R Zm06_AAFC_ECORC_Fusarium_graminearum_inoculated_corn_ear tip Zea mays cDNA clone Zm06_03a02, mRNA sequence Length = 638 Score = 44.1 bits (22), Expect = 0.027 Identities = 22/22 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgacttg 280 |||||||||||||||||||||| Sbjct: 89 ggacgacggcgacgacgacttg 68 >gi|71761194|gb|DR959131.1|DR959131 ZM_BFb0065E24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 679 Score = 44.1 bits (22), Expect = 0.027 Identities = 22/22 (100%) Strand = Plus / Plus Query: 286 gccggcggcggtgaggccgtgc 307 |||||||||||||||||||||| Sbjct: 437 gccggcggcggtgaggccgtgc 458 >gi|5398745|gb|AI812210.1|AI812210 605086H08.y1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 614 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 71 ggacgacggcgacgacgactt 51 >gi|9952614|gb|BE639302.1|BE639302 946020E10.y2 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 455 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 42 ggacgacggcgacgacgactt 22 >gi|15499634|gb|BI596147.1|BI596147 949078E10.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 585 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 70 ggacgacggcgacgacgactt 50 >gi|15632652|gb|BI679745.1|BI679745 949078E10.y2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 615 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 67 ggacgacggcgacgacgactt 47 >gi|21432126|gb|BQ547616.1|BQ547616 1091059C05.y1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 654 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 68 ggacgacggcgacgacgactt 48 >gi|21987339|gb|BQ778867.1|BQ778867 946114H03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 614 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 103 ggacgacggcgacgacgactt 83 >gi|22133554|gb|BQ833771.1|BQ833771 946125E10.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 560 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 71 ggacgacggcgacgacgactt 51 >gi|22472163|gb|BU036643.1|BU036643 946128F03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 575 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 46 ggacgacggcgacgacgactt 26 >gi|22546206|gb|BU098532.1|BU098532 946135H08.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 593 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 99 ggacgacggcgacgacgactt 79 >gi|60349413|gb|DN216386.1|DN216386 MEST1034_C01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 711 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Plus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 681 ggacgacggcgacgacgactt 701 >gi|60355275|gb|DN222248.1|DN222248 MEST1125_E06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 688 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Plus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 653 ggacgacggcgacgacgactt 673 >gi|78026001|gb|DV494388.1|DV494388 1000119-F04.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 732 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Plus Query: 259 ggacgacggcgacgacgactt 279 ||||||||||||||||||||| Sbjct: 701 ggacgacggcgacgacgactt 721 >gi|67040056|gb|CO466311.1|CO466311 MZCCL20036H08.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 826 Score = 40.1 bits (20), Expect = 0.42 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacgac 277 |||||||||||||||||||| Sbjct: 556 tggacgacggcgacgacgac 575 >gi|78087385|gb|DV515778.1|DV515778 ZM_BFb0198I03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 884 Score = 40.1 bits (20), Expect = 0.42 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacgac 277 |||||||||||||||||||| Sbjct: 537 tggacgacggcgacgacgac 556 >gi|78106610|gb|DV525028.1|DV525028 ZM_BFb0212A08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 851 Score = 40.1 bits (20), Expect = 0.42 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacgac 277 |||||||||||||||||||| Sbjct: 481 tggacgacggcgacgacgac 500 >gi|51315582|gb|AC147789.2| Zea mays clone ZMMBBb0355N05, *** SEQUENCING IN PROGRESS *** Length = 169761 Score = 40.1 bits (20), Expect = 0.42 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 gaacttgttcttgggcttgt 248 |||||||||||||||||||| Sbjct: 25349 gaacttgttcttgggcttgt 25330 >gi|5268365|gb|AI770329.1|AI770329 606061B01.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 526 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 207 atgatggacggacaggaca 189 >gi|5499546|gb|AI855413.1|AI855413 603016D03.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 593 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 220 ttgtcgtagatgatggcggcgcc 242 >gi|5525279|gb|AI861118.1|AI861118 603012D05.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 569 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 345 ttgtcgtagatgatggcggcgcc 367 >gi|6021626|gb|AW066554.1|AW066554 683002B08.x1 683 - 14 day immature embryo from Hake lab (HS) Zea mays cDNA, mRNA sequence Length = 562 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 196 atgatggacggacaggaca 178 >gi|9794788|gb|BE553096.1|BE553096 946089C06.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 471 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 174 atgatggacggacaggaca 156 >gi|12971518|gb|BG267522.1|BG267522 1000126H12.x2 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 514 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 212 ttgtcgtagatgatggcggcgcc 234 >gi|15177490|gb|BI398429.1|BI398429 949055B10.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 287 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttggg 791 ||||||||||||||||||| Sbjct: 30 ttctctgcttgggtttggg 12 >gi|15545654|gb|BI643448.1|BI643448 949076E11.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 514 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttggg 791 ||||||||||||||||||| Sbjct: 59 ttctctgcttgggtttggg 41 >gi|15590319|gb|BI674935.1|BI674935 949076E11.y2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 587 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttggg 791 ||||||||||||||||||| Sbjct: 45 ttctctgcttgggtttggg 27 >gi|21621229|gb|BQ619235.1|BQ619235 RNOSEQ5C10_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ5C10_SK.ab1 similar to (AF244693) glutathione S-transferase GST 28 [Zea mays], mRNA sequence Length = 865 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 284 gagccggcggcggtgaggc 302 ||||||||||||||||||| Sbjct: 93 gagccggcggcggtgaggc 111 >gi|31353226|gb|CD437583.1|CD437583 EL01N0502F04.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 887 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 186 atgatggacggacaggaca 168 >gi|50327623|gb|CO522749.1|CO522749 3530_1_150_1_B05.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 745 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 284 gagccggcggcggtgaggc 302 ||||||||||||||||||| Sbjct: 69 gagccggcggcggtgaggc 87 >gi|67031472|gb|CO460221.1|CO460221 MZCCL15022C10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 882 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 212 atgatggacggacaggaca 194 >gi|71429168|gb|DR810218.1|DR810218 ZM_BFb0037M18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 755 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 179 atgatggacggacaggaca 161 >gi|76011907|gb|DT939077.1|DT939077 ZM_BFb0120M21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 713 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 195 atgatggacggacaggaca 177 >gi|76015062|gb|DT942232.1|DT942232 ZM_BFb0127E14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 791 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 284 gagccggcggcggtgaggc 302 ||||||||||||||||||| Sbjct: 32 gagccggcggcggtgaggc 50 >gi|76910588|gb|DV163935.1|DV163935 ZM_BFb0160C20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 822 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 165 atgatggacggacaggaca 147 >gi|78022711|gb|DV491098.1|DV491098 1000126-H12.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 675 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 266 ttgtcgtagatgatggcggcgcc 288 >gi|78105252|gb|DV523670.1|DV523670 ZM_BFb0209P20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 455 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 152 atgatggacggacaggaca 134 >gi|78116936|gb|DV535323.1|DV535323 ZM_BFb0227F02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 884 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 183 atgatggacggacaggaca 165 >gi|86472051|gb|DY238421.1|DY238421 ZM_BFb0256E09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 589 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 54 atgatggacggacaggaca 36 >gi|93011916|gb|EB637436.1|EB637436 ZM_BFb0323C04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 803 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 135 atgatggacggacaggaca 117 >gi|93014899|gb|EB640419.1|EB640419 ZM_BFb0329E16.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 453 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 201 atgatggacggacaggaca 183 >gi|13447798|gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Minus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 968 ttgtcgtagatgatggcggcgcc 946 >gi|21209094|gb|AY106016.1| Zea mays PCO107590 mRNA sequence Length = 718 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 232 atgatggacggacaggaca 214 >gi|21212050|gb|AY108802.1| Zea mays PCO110359 mRNA sequence Length = 927 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 284 gagccggcggcggtgaggc 302 ||||||||||||||||||| Sbjct: 114 gagccggcggcggtgaggc 132 >gi|13469965|gb|G67984.1|G67984 umc1645 SSR containing sequences from Monsanto Zea mays STS genomic, sequence tagged site Length = 320 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 739 gtgagtgtgagtgagtgag 757 ||||||||||||||||||| Sbjct: 40 gtgagtgtgagtgagtgag 22 >gi|21212050|gb|AY108802.1| Zea mays PCO110359 mRNA sequence Length = 927 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 284 gagccggcggcggtgaggc 302 ||||||||||||||||||| Sbjct: 114 gagccggcggcggtgaggc 132 >gi|21209094|gb|AY106016.1| Zea mays PCO107590 mRNA sequence Length = 718 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 708 atgatggacggacaggaca 726 ||||||||||||||||||| Sbjct: 232 atgatggacggacaggaca 214 >gi|13447798|gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Minus Query: 332 ttgtcgtagatgaaggcggcgcc 354 ||||||||||||| ||||||||| Sbjct: 968 ttgtcgtagatgatggcggcgcc 946 >gi|85861405|gb|AC177895.1| Zea mays chromosome UNK clone CH201-205J24; ZMMBBc0205J24, *** SEQUENCING IN PROGRESS ***, 7 unordered pieces Length = 175961 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacgac 277 ||||||||||||||||||| Sbjct: 110932 ggacgacggcgacgacgac 110914 >gi|58082413|gb|AC155554.2| Zea mays strain B73 clone ZMMBBc0161G04, *** SEQUENCING IN PROGRESS ***, 13 unordered pieces Length = 186094 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgact 278 ||||||||||||||||||| Sbjct: 116556 gacgacggcgacgacgact 116538 >gi|8930270|gb|BE225034.1|BE225034 946015E03.x2 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 587 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 295 gagtgagtgtgagtgagt 312 >gi|9952318|gb|BE638901.1|BE638901 946015E03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 583 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 561 gagtgagtgtgagtgagt 544 >gi|9953164|gb|BE639747.1|BE639747 946037H12.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 150 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 38 ttctctgcttgggtttgg 21 >gi|14243437|gb|BG841103.2|BG841103 MEST15-F08.T3 ISUM4-TN Zea mays cDNA clone MEST15-F08 3', mRNA sequence Length = 357 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 40 tggacgacggcgacgacg 57 >gi|20506619|gb|BQ279271.1|BQ279271 1091029B11.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 482 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 325 gagtgagtgtgagtgagt 342 >gi|21481371|gb|BQ578054.1|BQ578054 3524_1_52_1_E03.y_1 3524 - Mature pollen from Sheila McCormick's lab Zea mays cDNA, mRNA sequence Length = 512 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 128 ggacgacggcgacgacga 111 >gi|21626451|gb|BQ621372.1|BQ621372 3524_1_48_1_H04.y_1 3524 - Mature pollen from Sheila McCormick's lab Zea mays cDNA, mRNA sequence Length = 546 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 118 ggacgacggcgacgacga 101 >gi|22472284|gb|BU036764.1|BU036764 946129E03.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 639 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 55 ttctctgcttgggtttgg 38 >gi|22542796|gb|BU093234.1|BU093234 1091057H08.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 536 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 326 gagtgagtgtgagtgagt 343 >gi|22546341|gb|BU098652.1|BU098652 946129E03.y3 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 477 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 99 ttctctgcttgggtttgg 82 >gi|26455512|gb|CA827095.1|CA827095 1114009G07.y1 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 505 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 129 ggacgacggcgacgacga 112 >gi|26455613|gb|CA827196.1|CA827196 1114011C04.y1 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 542 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 118 ggacgacggcgacgacga 101 >gi|31355218|gb|CD439575.1|CD439575 EL01N0526E04.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 850 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 379 cgcgatgaacagcagcttgagc 400 ||||| |||||||||||||||| Sbjct: 378 cgcgaggaacagcagcttgagc 399 >gi|32797880|gb|CD950116.1|CD950116 SAP_108 GeneTag2 Zea mays cDNA, mRNA sequence Length = 163 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 126 gacggagccggcggcggagagg 105 >gi|32797959|gb|CD950195.1|CD950195 SAP_225 GeneTag2 Zea mays cDNA, mRNA sequence Length = 231 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 38 gacggagccggcggcggagagg 59 >gi|32800688|gb|CD952924.1|CD952924 SBF_113 GeneTag2 Zea mays cDNA, mRNA sequence Length = 230 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 193 gacggagccggcggcggagagg 172 >gi|32800779|gb|CD953015.1|CD953015 SBF_42 GeneTag2 Zea mays cDNA, mRNA sequence Length = 231 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 38 gacggagccggcggcggagagg 59 >gi|33104070|gb|CF064030.1|CF064030 QCU6c11.yg QCU Zea mays cDNA clone QCU6c11, mRNA sequence Length = 403 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 667 tggtgtcgcttgccgctctcac 688 |||||| ||||||||||||||| Sbjct: 254 tggtgtagcttgccgctctcac 233 >gi|33466621|gb|CF243670.1|CF243670 3530_1_23_1_A10.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 89 ggacgacggcgacgacga 72 >gi|33467781|gb|CF244830.1|CF244830 3530_1_5_1_B06.y_2 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 609 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 323 gacgacggcgacgacgac 340 >gi|40334106|gb|CK368176.1|CK368176 zmrws055_0A11-005-d03.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 435 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 104 gacgacggcgacgacgac 87 >gi|40334861|gb|CK368931.1|CK368931 zmrws055_0B20-001-a03.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 597 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 188 ggacgacggcgacgacga 205 >gi|50326419|gb|CO521545.1|CO521545 3530_1_142_1_C09.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 549 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 315 gacgacggcgacgacgac 332 >gi|50331289|gb|CO526415.1|CO526415 3530_1_175_1_F12.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 800 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 322 gacgacggcgacgacgac 339 >gi|50335083|gb|CO530209.1|CO530209 3530_1_19_1_A10.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 89 ggacgacggcgacgacga 72 >gi|50335848|gb|CO530974.1|CO530974 3530_1_204_1_D08.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 456 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 412 tggacgacggcgacgacg 395 >gi|50335849|gb|CO530975.1|CO530975 3530_1_204_1_D08.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 497 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 63 tggacgacggcgacgacg 80 >gi|50338805|gb|CO533931.1|CO533931 3530_1_223_1_G09.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 648 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 318 gacgacggcgacgacgac 335 >gi|60337350|gb|DN204323.1|DN204323 MEST802_D08.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 489 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 320 tggacgacggcgacgacg 303 >gi|60340516|gb|DN207489.1|DN207489 MEST850_C02.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 536 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 296 tggacgacggcgacgacg 279 >gi|67012379|gb|CO441128.1|CO441128 MZCCL10027E05.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 803 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 44 ttctctgcttgggtttgg 27 >gi|67012770|gb|CO441519.1|CO441519 MZCCL10032G06.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 820 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 84 ttctctgcttgggtttgg 67 >gi|67015824|gb|CO444573.1|CO444573 MZCCL10073C11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 902 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 773 ttctctgcttgggtttgg 790 |||||||||||||||||| Sbjct: 91 ttctctgcttgggtttgg 74 >gi|71316297|gb|DR794836.1|DR794836 ZM_BFb0015L09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 699 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 291 cggcggtgaggccgtgcttccg 312 |||||| ||||||||||||||| Sbjct: 615 cggcggcgaggccgtgcttccg 594 >gi|71329637|gb|DR801545.1|DR801545 ZM_BFb0025G18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 811 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 412 ggacgacggcgacgacga 395 >gi|71330936|gb|DR802274.1|DR802274 ZM_BFb0026H13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 818 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 315 gacgacggcgacgacgac 332 >gi|71423557|gb|DR806077.1|DR806077 ZM_BFb0031N10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 894 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 554 ggacgacggcgacgacga 537 >gi|71445391|gb|DR826441.1|DR826441 ZM_BFb0069D10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 850 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 325 gacgacggcgacgacgac 342 >gi|71449761|gb|DR830811.1|DR830811 ZM_BFb0079C13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 822 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 315 gacgacggcgacgacgac 332 >gi|71769277|gb|DR967214.1|DR967214 ZM_BFb0087P17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 830 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 322 gacgacggcgacgacgac 339 >gi|71773143|gb|DR971057.1|DR971057 ZM_BFb0093J10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 790 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 316 gacgacggcgacgacgac 333 >gi|74035110|gb|DT535600.1|DT535600 E1897 Zea mays egg cell cDNA library Zea mays cDNA clone 3113 5', mRNA sequence Length = 388 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 124 gacgacggcgacgacgac 141 >gi|74238488|gb|DT646402.1|DT646402 ZM_BFb0106O02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 634 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 329 aacttgtcgtagatgaaggcgg 350 |||||||||| ||||||||||| Sbjct: 491 aacttgtcgtcgatgaaggcgg 470 >gi|74245747|gb|DT653661.1|DT653661 ZM_BFb0125I09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 633 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 255 tggacgacggcgacgacg 238 >gi|74245813|gb|DT653727.1|DT653727 ZM_BFb0125K05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 912 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 291 cggcggtgaggccgtgcttccg 312 |||||| ||||||||||||||| Sbjct: 642 cggcggcgaggccgtgcttccg 621 >gi|78077757|gb|DV506189.1|DV506189 ZM_BFb0183M23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 860 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 324 gacgacggcgacgacgac 341 >gi|78081590|gb|DV510002.1|DV510002 ZM_BFb0189G16.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 492 Score = 36.2 bits (18), Expect = 6.5 Identities = 24/26 (92%) Strand = Plus / Plus Query: 331 cttgtcgtagatgaaggcggcgcccc 356 ||||| |||||||| ||||||||||| Sbjct: 432 cttgttgtagatgacggcggcgcccc 457 >gi|78087539|gb|DV515932.1|DV515932 ZM_BFb0198L11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 810 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 318 gacgacggcgacgacgac 335 >gi|78089106|gb|DV517494.1|DV517494 ZM_BFb0201A15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 885 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 318 gacgacggcgacgacgac 335 >gi|78544132|gb|DV621630.1|DV621630 IV-1091-404C-C08.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 678 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 360 gagtgagtgtgagtgagt 377 >gi|78544830|gb|DV622328.1|DV622328 IV-1091-404B-C07.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 589 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 737 gagtgagtgtgagtgagt 754 |||||||||||||||||| Sbjct: 351 gagtgagtgtgagtgagt 368 >gi|87154694|gb|DY399483.1|DY399483 IV-3524-3A-G07.T3 UGIV-3524-Reseq Zea mays cDNA, mRNA sequence Length = 603 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 130 ggacgacggcgacgacga 113 >gi|87154707|gb|DY399496.1|DY399496 IV-3524-3D-C04.T3 UGIV-3524-Reseq Zea mays cDNA, mRNA sequence Length = 570 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 ggacgacggcgacgacga 276 |||||||||||||||||| Sbjct: 118 ggacgacggcgacgacga 101 >gi|89247793|gb|DY619579.1|DY619579 ZM_BFb0277K09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 765 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 446 gacgacggcgacgacgac 463 >gi|89760569|gb|DY688925.1|DY688925 ZM_BFb0284F21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 844 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 275 gacttgacggagccggcggcgg 296 |||||||||||| ||||||||| Sbjct: 162 gacttgacggaggcggcggcgg 141 >gi|91049516|gb|EB159934.1|EB159934 ZM_BFb0296H12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 403 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 255 tggacgacggcgacgacg 238 >gi|91049517|gb|EB159935.1|EB159935 ZM_BFb0296H12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 695 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 567 tggacgacggcgacgacg 584 >gi|93012566|gb|EB638086.1|EB638086 ZM_BFb0325A12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 698 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 291 cggcggtgaggccgtgcttccg 312 |||||| ||||||||||||||| Sbjct: 642 cggcggcgaggccgtgcttccg 621 >gi|54653773|gb|BT018992.1| Zea mays clone Contig480.F mRNA sequence Length = 1472 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 379 cgcgatgaacagcagcttgagc 400 ||||| |||||||||||||||| Sbjct: 378 cgcgaggaacagcagcttgagc 399 >gi|67043717|gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retrotransposon grande1, xilon1 retrotransposon, helitron B73_14578, gypsy retrotransposon huck1 and ruda retrotransposon, complete sequence Length = 152384 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 67669 gacgacggcgacgacgac 67686 >gi|47101218|gb|BV151761.1| PZA02164-68921-Tx501 Zea mays Tx501 Zea mays STS genomic, sequence tagged site Length = 354 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 149 gacggagccggcggcggagagg 170 >gi|47101216|gb|BV151759.1| PZA02164-68930-T218 Zea mays T218 Zea mays STS genomic, sequence tagged site Length = 387 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 176 gacggagccggcggcggagagg 197 >gi|47101215|gb|BV151758.1| PZA02164-68920-Mp708 Zea mays Mp708 Zea mays STS genomic, sequence tagged site Length = 344 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 164 gacggagccggcggcggagagg 185 >gi|47101213|gb|BV151756.1| PZA02164-68918-GT119 Zea mays GT119 Zea mays STS genomic, sequence tagged site Length = 346 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 167 gacggagccggcggcggagagg 188 >gi|47101212|gb|BV151755.1| PZA02164-68919-CO159 Zea mays CO159 Zea mays STS genomic, sequence tagged site Length = 346 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 280 gacggagccggcggcggtgagg 301 ||||||||||||||||| |||| Sbjct: 167 gacggagccggcggcggagagg 188 >gi|54653773|gb|BT018992.1| Zea mays clone Contig480.F mRNA sequence Length = 1472 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 379 cgcgatgaacagcagcttgagc 400 ||||| |||||||||||||||| Sbjct: 378 cgcgaggaacagcagcttgagc 399 >gi|93004171|gb|AC185500.1| Zea mays chromosome 3 clone CH201-528O18; ZMMBBc0528O18, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 183134 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 152303 gacgacggcgacgacgac 152286 >gi|92900807|gb|AC185471.1| Zea mays chromosome 4 clone CH201-266M17; ZMMBBc0266M17, *** SEQUENCING IN PROGRESS ***, 14 unordered pieces Length = 172243 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 102303 gacgacggcgacgacgac 102320 >gi|92900715|gb|AC185464.1| Zea mays chromosome UNK clone CH201-280A19; ZMMBBc0280A19, *** SEQUENCING IN PROGRESS ***, 29 unordered pieces Length = 186800 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 159554 gacgacggcgacgacgac 159571 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 104156 gacgacggcgacgacgac 104173 >gi|92900439|gb|AC185452.1| Zea mays chromosome UNK clone CH201-324B19; ZMMBBc0324B19, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 189965 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 176003 gacgacggcgacgacgac 175986 >gi|92899955|gb|AC185435.1| Zea mays chromosome UNK clone CH201-472P11; ZMMBBc0472P11, *** SEQUENCING IN PROGRESS ***, 24 unordered pieces Length = 182241 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 171799 gacgacggcgacgacgac 171816 >gi|92110185|gb|AC185322.1| Zea mays chromosome UNK clone CH201-153E14; ZMMBBc0153E14, *** SEQUENCING IN PROGRESS ***, 19 unordered pieces Length = 182772 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 102 acaaacacaacagaaatc 119 |||||||||||||||||| Sbjct: 26116 acaaacacaacagaaatc 26099 >gi|92110167|gb|AC185304.1| Zea mays chromosome UNK clone CH201-399A2; ZMMBBc0399A02, *** SEQUENCING IN PROGRESS ***, 16 unordered pieces Length = 175453 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 97466 gacgacggcgacgacgac 97449 >gi|91982826|gb|AC185282.1| Zea mays chromosome UNK clone CH201-298P2; ZMMBBc0298P02, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 162293 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 86917 gacgacggcgacgacgac 86900 >gi|91065006|gb|AC184782.1| Zea mays chromosome UNK clone CH201-206K3; ZMMBBc0206K03, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 186842 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 160976 gacgacggcgacgacgac 160959 >gi|90992704|gb|AC184707.1| Zea mays chromosome UNK clone CH201-128F20; ZMMBBc0128F20, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 160971 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 160843 gacgacggcgacgacgac 160826 >gi|90992702|gb|AC184705.1| Zea mays chromosome UNK clone CH201-26G10; ZMMBBc0026G10, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 145458 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 110811 gacgacggcgacgacgac 110828 >gi|90963039|gb|AC184167.1| Zea mays chromosome UNK clone ZMMBBb-494J20; ZMMBBb0494J20, *** SEQUENCING IN PROGRESS ***, 13 unordered pieces Length = 140929 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 261 acgacggcgacgacgact 278 |||||||||||||||||| Sbjct: 99463 acgacggcgacgacgact 99480 >gi|90855891|gb|AC184140.1| Zea mays chromosome UNK clone CH201-36G22; ZMMBBc0036G22, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces Length = 77341 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 47865 gacgacggcgacgacgac 47848 >gi|90855887|gb|AC184136.1| Zea mays chromosome UNK clone CH201-346F12; ZMMBBc0346F12, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 140545 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 125593 gacgacggcgacgacgac 125610 >gi|90855867|gb|AC184116.1| Zea mays chromosome UNK clone ZMMBBb-610C10; ZMMBBb0610C10, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces Length = 141699 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 92376 gacgacggcgacgacgac 92393 >gi|90659936|gb|AC183973.1| Zea mays chromosome UNK clone CH201-281K14; ZMMBBc0281K14, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 150253 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 144363 gacgacggcgacgacgac 144380 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 131056 gacgacggcgacgacgac 131073 >gi|90568160|gb|AC183948.1| Zea mays chromosome UNK clone CH201-226O18; ZMMBBc0226O18, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces Length = 193842 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 97865 gacgacggcgacgacgac 97848 >gi|90093414|gb|AC183822.1| Zea mays chromosome UNK clone CH201-282F23; ZMMBBc0282F23, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 131828 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 40947 gacgacggcgacgacgac 40964 >gi|89515021|gb|AC183658.1| Zea mays chromosome UNK clone CH201-286J2; ZMMBBc0286J02, *** SEQUENCING IN PROGRESS ***, 27 unordered pieces Length = 133224 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 51955 gacgacggcgacgacgac 51938 >gi|89337324|gb|AC183519.1| Zea mays chromosome UNK clone CH201-239H2; ZMMBBc0239H02, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 153587 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 115661 gacgacggcgacgacgac 115678 >gi|88900607|gb|AC182604.2| Zea mays chromosome UNK clone CH201-454O12; ZMMBBc0454O12, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces Length = 153174 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 76971 gacgacggcgacgacgac 76988 >gi|89257785|gb|AC182112.2| Zea mays chromosome UNK clone CH201-154N24; ZMMBBc0154N24, *** SEQUENCING IN PROGRESS ***, 16 unordered pieces Length = 190124 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 135807 gacgacggcgacgacgac 135824 >gi|89257758|gb|AC182107.2| Zea mays chromosome UNK clone ZMMBBb-106M23; ZMMBBb0106M23, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces Length = 171547 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 157881 gacgacggcgacgacgac 157864 >gi|85861444|gb|AC177934.1| Zea mays chromosome UNK clone CH201-116E17; ZMMBBc0116E17, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces Length = 177641 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 109528 gacgacggcgacgacgac 109545 >gi|89257733|gb|AC177862.2| Zea mays chromosome UNK clone CH201-435C24; ZMMBBc0435C24, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 190463 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 160638 gacgacggcgacgacgac 160655 >gi|85861362|gb|AC177852.1| Zea mays chromosome UNK clone CH201-9K17; ZMMBBc0009K17, *** SEQUENCING IN PROGRESS ***, 3 unordered pieces Length = 201701 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 92462 gacgacggcgacgacgac 92479 >gi|85861337|gb|AC177827.1| Zea mays chromosome UNK clone CH201-270F23; ZMMBBc0270F23, *** SEQUENCING IN PROGRESS ***, 19 unordered pieces Length = 208731 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 258 tggacgacggcgacgacg 275 |||||||||||||||||| Sbjct: 140335 tggacgacggcgacgacg 140352 >gi|62238005|gb|AC159612.1| Zea mays chromosome 5S clone ZMMBBb0511I12 map bin: 5.00, complete sequence Length = 50000 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 4381 gacgacggcgacgacgac 4364 >gi|58082480|gb|AC155621.2| Zea mays strain B73 clone ZMMBBc0364F23, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces Length = 202998 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 161943 gacgacggcgacgacgac 161926 >gi|58082459|gb|AC155600.2| Zea mays strain B73 clone ZMMBBc0222B11, *** SEQUENCING IN PROGRESS ***, 27 unordered pieces Length = 173668 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 90028 gacgacggcgacgacgac 90011 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 90010 gacgacggcgacgacgac 89993 >gi|58082442|gb|AC155583.2| Zea mays strain B73 clone ZMMBBc0196E08, *** SEQUENCING IN PROGRESS ***, 33 unordered pieces Length = 210240 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 79396 gacgacggcgacgacgac 79379 >gi|58082417|gb|AC155558.2| Zea mays strain B73 clone ZMMBBc0169G08, *** SEQUENCING IN PROGRESS ***, 27 unordered pieces Length = 171363 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 144313 gacgacggcgacgacgac 144330 >gi|58082380|gb|AC155520.2| Zea mays strain B73 clone ZMMBBc0111D02, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 182471 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 152110 gacgacggcgacgacgac 152093 >gi|58082379|gb|AC155519.2| Zea mays strain B73 clone ZMMBBc0106G04, *** SEQUENCING IN PROGRESS ***, 24 unordered pieces Length = 167078 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 3170 gacgacggcgacgacgac 3153 >gi|58082369|gb|AC155509.2| Zea mays strain B73 clone ZMMBBc0049G23, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 208224 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 195488 gacgacggcgacgacgac 195471 >gi|58082351|gb|AC155491.2| Zea mays strain B73 clone ZMMBBc0016P24, *** SEQUENCING IN PROGRESS ***, 26 unordered pieces Length = 211193 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 4491 gacgacggcgacgacgac 4474 >gi|58082327|gb|AC155466.2| Zea mays strain B73 clone ZMMBBb0521N19, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 128254 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 27696 gacgacggcgacgacgac 27679 >gi|58082319|gb|AC155458.2| Zea mays strain B73 clone ZMMBBb0459N17, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 115779 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 51478 gacgacggcgacgacgac 51495 >gi|58082305|gb|AC155444.2| Zea mays strain B73 clone ZMMBBb0290C08, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 134017 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 108197 gacgacggcgacgacgac 108214 >gi|58082293|gb|AC155431.2| Zea mays strain B73 clone ZMMBBb0240E24, *** SEQUENCING IN PROGRESS ***, 28 unordered pieces Length = 225628 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 98049 gacgacggcgacgacgac 98032 >gi|58082271|gb|AC155409.2| Zea mays strain B73 clone ZMMBBb0189A07, *** SEQUENCING IN PROGRESS ***, 27 unordered pieces Length = 115455 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 86676 gacgacggcgacgacgac 86659 >gi|58082265|gb|AC155403.2| Zea mays strain B73 clone ZMMBBb0174A23, *** SEQUENCING IN PROGRESS ***, 7 unordered pieces Length = 124402 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 2682 gacgacggcgacgacgac 2699 >gi|58082246|gb|AC155384.2| Zea mays strain B73 clone ZMMBBb0139F04, *** SEQUENCING IN PROGRESS ***, 29 unordered pieces Length = 127549 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 71599 gacgacggcgacgacgac 71582 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 3998 gacgacggcgacgacgac 3981 >gi|58082243|gb|AC155381.2| Zea mays strain B73 clone ZMMBBb0133B08, *** SEQUENCING IN PROGRESS ***, 39 unordered pieces Length = 118664 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 78386 gacgacggcgacgacgac 78403 >gi|57862898|gb|AC155377.1| Zea mays strain B73 clone ZMMBBb0129I15, *** SEQUENCING IN PROGRESS *** Length = 130617 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 86615 gacgacggcgacgacgac 86598 >gi|58082237|gb|AC155374.2| Zea mays strain B73 clone ZMMBBb0121F22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces Length = 121887 Score = 36.2 bits (18), Expect = 6.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 275 gacttgacggagccggcggcgg 296 |||||||||||| ||||||||| Sbjct: 78449 gacttgacggaggcggcggcgg 78428 >gi|58082232|gb|AC155369.2| Zea mays strain B73 clone ZMMBBb0101F20, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces Length = 103732 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 68931 gacgacggcgacgacgac 68948 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 40543 gacgacggcgacgacgac 40560 >gi|58082225|gb|AC155362.2| Zea mays strain B73 clone ZMMBBb0048H01, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 143862 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 94698 gacgacggcgacgacgac 94715 >gi|57790133|gb|AC149812.2| Zea mays clone ZMMBBb0125F17, *** SEQUENCING IN PROGRESS ***, 14 unordered pieces Length = 120676 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 117021 gacgacggcgacgacgac 117004 >gi|57790131|gb|AC149810.2| Zea mays clone ZMMBBb0018A20, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 156501 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 46452 gacgacggcgacgacgac 46469 >gi|58531545|gb|AC149309.3| Zea mays clone ZMMBBc0079F17, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces Length = 192565 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 127020 gacgacggcgacgacgac 127037 >gi|48762579|gb|AC148167.6| Zea mays clone ZMMBBc0448A01, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces Length = 165168 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 23923 gacgacggcgacgacgac 23906 >gi|48762577|gb|AC147504.6| Zea mays clone ZMMBBc0289B19, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces Length = 67198 Score = 36.2 bits (18), Expect = 6.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 260 gacgacggcgacgacgac 277 |||||||||||||||||| Sbjct: 61591 gacgacggcgacgacgac 61608 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 383,800 Number of Sequences: 836351 Number of extensions: 383800 Number of successful extensions: 35848 Number of sequences better than 10.0: 199 Number of HSP's better than 10.0 without gapping: 197 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 35396 Number of HSP's gapped (non-prelim): 447 length of query: 796 length of database: 669,372,029 effective HSP length: 19 effective length of query: 777 effective length of database: 653,481,360 effective search space: 507755016720 effective search space used: 507755016720 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)