BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 2478075.2.1 (807 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|5740674|gb|AI948364.1|AI948364 603043G03.x1 603 - stressed ro... 1287 0.0 gi|4730357|gb|AI649523.1|AI649523 603005G02.x1 603 - stressed ro... 1100 0.0 gi|21216148|gb|AY111558.1| Zea mays CL31592_1 mRNA sequence 708 0.0 gi|21216148|gb|AY111558.1| Zea mays CL31592_1 mRNA sequence 708 0.0 gi|61236650|gb|DN586396.1|DN586396 EST6387 Zea mays embryo sac c... 581 e-164 gi|85152682|gb|DW587817.1|DW587817 E3540 Zea mays egg cell cDNA ... 559 e-157 gi|78021451|gb|DV489838.1|DV489838 1000131-G08.T7-1 UGI-Reseq Ze... 553 e-155 gi|32789576|gb|CD941812.1|CD941812 RBK_30 GeneTag1 Zea mays cDNA... 440 e-121 gi|32799627|gb|CD951863.1|CD951863 SAZ_158 GeneTag2 Zea mays cDN... 440 e-121 gi|32790115|gb|CD942351.1|CD942351 RBU_39 GeneTag1 Zea mays cDNA... 436 e-120 gi|78086913|gb|DV515306.1|DV515306 ZM_BFb0197N06.f ZM_BFb Zea ma... 426 e-117 gi|76282101|gb|DV021669.1|DV021669 ZM_BFb0140I08.f ZM_BFb Zea ma... 418 e-115 gi|21843238|gb|BQ703819.1|BQ703819 946106C10.y1 946 - tassel pri... 402 e-110 gi|26557810|gb|CA830045.1|CA830045 1117001E07.y1 1117 - Unigene ... 402 e-110 gi|87157112|gb|DY401901.1|DY401901 V-946-1A-E07.T7-1 UGV-Reseq Z... 402 e-110 gi|61119146|gb|DN560107.1|DN560107 E11-G02-T3 E7PCR Zea mays cDN... 394 e-108 gi|21891422|gb|BQ744635.1|BQ744635 946106C10.x1 946 - tassel pri... 113 4e-23 gi|6918860|gb|AW400390.1|AW400390 707062G06.x1 707 - Mixed adult... 50 4e-04 gi|7304697|gb|AW600636.1|AW600636 707104C10.x1 707 - Mixed adult... 50 4e-04 gi|12046369|gb|BF728508.1|BF728508 1000063D08.x1 1000 - Unigene ... 50 4e-04 gi|13149335|gb|BG319657.1|BG319657 Zm03_06g10_A Zm03_AAFC_ECORC_... 50 4e-04 gi|17932057|gb|BM269017.1|BM269017 MEST403-G12.univ ISUM5-RN Zea... 50 4e-04 gi|18660949|gb|BM501133.1|BM501133 PAC000000001181 Pioneer AF-1 ... 50 4e-04 gi|56462108|gb|CK986406.1|CK986406 WSEST0174 water stress specif... 50 4e-04 gi|21212773|gb|AY109289.1| Zea mays PCO135820 mRNA sequence 50 4e-04 gi|21212773|gb|AY109289.1| Zea mays PCO135820 mRNA sequence 50 4e-04 gi|29162717|emb|AX660953.1| Sequence 1310 from Patent WO03000906 50 4e-04 gi|4174509|gb|AI374565.1|AI374565 MEST5-E7.POLYT-N.Seq ISUM2 Zea... 48 0.002 gi|6952592|gb|AW424660.1|AW424660 707020H08.y1 707 - Mixed adult... 48 0.002 gi|18180587|gb|BM381797.1|BM381797 MEST540-C07.univ ISUM6 Zea ma... 48 0.002 gi|86467494|gb|DY233864.1|DY233864 ZM_BFb0243L05.f ZM_BFb Zea ma... 48 0.002 gi|91049150|gb|EB159568.1|EB159568 ZM_BFb0295I05.f ZM_BFb Zea ma... 48 0.002 gi|29162720|emb|AX660956.1| Sequence 1313 from Patent WO03000906 48 0.002 gi|18171925|gb|BM347313.1|BM347313 MEST275-F11.T3 ISUM5-RN Zea m... 46 0.007 gi|168394|gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs 44 0.027 gi|21216265|gb|AY111675.1| Zea mays CL1243_1 mRNA sequence 44 0.027 gi|1839590|gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9}... 44 0.027 gi|1839590|gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9}... 44 0.027 gi|168394|gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs 44 0.027 gi|77862322|gb|DQ147111.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862320|gb|DQ147110.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862318|gb|DQ147109.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862316|gb|DQ147108.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862314|gb|DQ147107.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862312|gb|DQ147106.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862310|gb|DQ147105.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862308|gb|DQ147104.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862306|gb|DQ147103.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862304|gb|DQ147102.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862302|gb|DQ147101.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862300|gb|DQ147100.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862298|gb|DQ147099.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|77862296|gb|DQ147098.1| Zea mays subsp. parviglumis isolate p... 44 0.027 gi|21216265|gb|AY111675.1| Zea mays CL1243_1 mRNA sequence 44 0.027 gi|18178283|gb|BM379493.1|BM379493 MEST506-C09.univ ISUM6 Zea ma... 42 0.11 gi|74236304|gb|DT644218.1|DT644218 ZM_BFb0103J09.f ZM_BFb Zea ma... 42 0.11 gi|91872390|gb|EB402347.1|EB402347 ZM_BFb0309B14.f ZM_BFb Zea ma... 42 0.11 gi|89572702|gb|AC183756.1| Zea mays chromosome UNK clone CH201-2... 42 0.11 gi|58082248|gb|AC155386.2| Zea mays strain B73 clone ZMMBBb0151L... 42 0.11 gi|57790147|gb|AC149826.2| Zea mays clone ZMMBBc0046N19, *** SEQ... 42 0.11 gi|58531567|gb|AC149034.3| Zea mays clone ZMMBBc0088M21, *** SEQ... 42 0.11 gi|6536597|gb|AW224910.1|AW224910 687047D11.y1 687 - Early embry... 40 0.43 gi|37378752|gb|CF626083.1|CF626083 zmrws05_0B10-009-e08.s3 zmrws... 40 0.43 gi|37383450|gb|CF628741.1|CF628741 zmrws48_0A10-009-d01.s3 zmrws... 40 0.43 gi|37392245|gb|CF633371.1|CF633371 zmrws48_0B20-015-b05.s3 zmrws... 40 0.43 gi|40302809|gb|CK347196.1|CK347196 zmrsub1_0A10-004-a01.s4 zmrsu... 40 0.43 gi|50329342|gb|CO524468.1|CO524468 3530_1_162_1_A01.y_1 3530 - F... 40 0.43 gi|60349528|gb|DN216501.1|DN216501 MEST1035_E10.T7-1 UGA-ZmSAM-X... 40 0.43 gi|67017556|gb|CO446305.1|CO446305 MZCCL10101C01.g Maize Endospe... 40 0.43 gi|67022628|gb|CO451377.1|CO451377 MZCCL10152C10.g Maize Endospe... 40 0.43 gi|78088058|gb|DV516451.1|DV516451 ZM_BFb0199I10.f ZM_BFb Zea ma... 40 0.43 gi|78092993|gb|DV521367.1|DV521367 ZM_BFb0206K08.r ZM_BFb Zea ma... 40 0.43 gi|21214367|gb|AY110207.1| Zea mays CL23834_1 mRNA sequence 40 0.43 gi|47100717|gb|BV151260.1| PZA02122-72583-W22_R-scm2 Zea mays W2... 40 0.43 gi|47100716|gb|BV151259.1| PZA02122-72571-Tx501 Zea mays Tx501 Z... 40 0.43 gi|47100715|gb|BV151258.1| PZA02122-72581-Tx303 Zea mays Tx303 Z... 40 0.43 gi|47100714|gb|BV151257.1| PZA02122-72580-T218 Zea mays T218 Zea... 40 0.43 gi|47100713|gb|BV151256.1| PZA02122-72582-NC7A Zea mays NC7A Zea... 40 0.43 gi|47100712|gb|BV151255.1| PZA02122-72570-Mp708 Zea mays Mp708 Z... 40 0.43 gi|47100711|gb|BV151254.1| PZA02122-72579-Mo17 Zea mays Mo17 Zea... 40 0.43 gi|47100710|gb|BV151253.1| PZA02122-72584-ILO Zea mays ILO Zea m... 40 0.43 gi|47100709|gb|BV151252.1| PZA02122-72572-IHO Zea mays IHO Zea m... 40 0.43 gi|47100708|gb|BV151251.1| PZA02122-72568-GT119 Zea mays GT119 Z... 40 0.43 gi|47100707|gb|BV151250.1| PZA02122-72569-CO159 Zea mays CO159 Z... 40 0.43 gi|47100706|gb|BV151249.1| PZA02122-72567-B73 Zea mays B73 Zea m... 40 0.43 gi|21214367|gb|AY110207.1| Zea mays CL23834_1 mRNA sequence 40 0.43 gi|91065007|gb|AC184783.1| Zea mays chromosome UNK clone CH201-1... 40 0.43 gi|21987524|gb|BQ779052.1|BQ779052 946116E10.y1 946 - tassel pri... 38 1.7 gi|60343489|gb|DN210462.1|DN210462 MEST898_D07.T7-1 UGA-ZmSAM-XZ... 38 1.7 gi|60348079|gb|DN215052.1|DN215052 MEST906_A12.T7-1 UGA-ZmSAM-XZ... 38 1.7 gi|60355586|gb|DN222559.1|DN222559 MEST1129_D12.T7-1 UGA-ZmSAM-X... 38 1.7 gi|60358424|gb|DN225397.1|DN225397 MEST1174_F02.T7-1 UGA-ZmSAM-X... 38 1.7 gi|71313724|gb|DR793451.1|DR793451 ZM_BFb0013L13.f ZM_BFb Zea ma... 38 1.7 gi|71429079|gb|DR810129.1|DR810129 ZM_BFb0037K14.r ZM_BFb Zea ma... 38 1.7 gi|76923577|gb|DV169556.1|DV169556 ZM_BFb0168L09.f ZM_BFb Zea ma... 38 1.7 gi|78086501|gb|DV514894.1|DV514894 ZM_BFb0197D20.f ZM_BFb Zea ma... 38 1.7 gi|78086502|gb|DV514895.1|DV514895 ZM_BFb0197D20.r ZM_BFb Zea ma... 38 1.7 gi|78120748|gb|DV539132.1|DV539132 ZM_BFb0232N15.f ZM_BFb Zea ma... 38 1.7 gi|21206645|gb|AY103567.1| Zea mays PCO116252 mRNA sequence 38 1.7 gi|21206645|gb|AY103567.1| Zea mays PCO116252 mRNA sequence 38 1.7 gi|17082476|gb|AF391808.2| Zea mays chromosome 9S bz genomic reg... 38 1.7 gi|93004174|gb|AC185503.1| Zea mays chromosome 4 clone CH201-287... 38 1.7 gi|90659929|gb|AC183966.1| Zea mays chromosome UNK clone ZMMBBb-... 38 1.7 gi|58082382|gb|AC155522.2| Zea mays strain B73 clone ZMMBBc0113E... 38 1.7 gi|3157222|gb|AA979844.1|AA979844 MEST2-C3.TW1412.Seq ISUM2 Zea ... 36 6.6 gi|8368955|gb|BE051900.1|BE051900 za89g09.g50 Maize Glume cDNAs ... 36 6.6 gi|8577276|gb|BE129913.1|BE129913 945032F10.X1 945 - Mixed adult... 36 6.6 gi|13149756|gb|BG320078.1|BG320078 Zm03_01c11_A Zm03_AAFC_ECORC_... 36 6.6 gi|13149824|gb|BG320146.1|BG320146 Zm03_04g08_A Zm03_AAFC_ECORC_... 36 6.6 gi|13198723|gb|BG354525.1|BG354525 947038E01.y1 947 - 2 week sho... 36 6.6 gi|14204094|gb|BG837771.1|BG837771 Zm10_06a10_A Zm10_AAFC_ECORC_... 36 6.6 gi|15082857|gb|BI389541.1|BI389541 949062G08.x1 949 - Juvenile l... 36 6.6 gi|15209102|gb|BI430986.1|BI430986 949063G08.y1 949 - Juvenile l... 36 6.6 gi|15353079|gb|BI502690.1|BI502690 949074H03.x1 949 - Juvenile l... 36 6.6 gi|15427120|gb|BI542942.1|BI542942 949074H03.x2 949 - Juvenile l... 36 6.6 gi|15427334|gb|BI543156.1|BI543156 949074H03.y1 949 - Juvenile l... 36 6.6 gi|15499556|gb|BI596069.1|BI596069 949077A10.y1 949 - Juvenile l... 36 6.6 gi|15590400|gb|BI675016.1|BI675016 949077A10.y2 949 - Juvenile l... 36 6.6 gi|16379109|gb|BI992757.1|BI992757 1020067F09.x3 1020 - Unigene ... 36 6.6 gi|19437165|gb|BM953575.1|BM953575 952063H10.y1 952 - BMS tissue... 36 6.6 gi|22490856|gb|BU050779.1|BU050779 1111033E12.y1 1111 - Unigene ... 36 6.6 gi|22491113|gb|BU051036.1|BU051036 1111037F07.y2 1111 - Unigene ... 36 6.6 gi|22935623|gb|BU571898.1|BU571898 946166B02.y1 946 - tassel pri... 36 6.6 gi|26558852|gb|CA831087.1|CA831087 1117015D05.y1 1117 - Unigene ... 36 6.6 gi|26559588|gb|CA831823.1|CA831823 1117024B10.y1 1117 - Unigene ... 36 6.6 gi|31351194|gb|CD435551.1|CD435551 EL01N0362E02.b Endosperm_3 Ze... 36 6.6 gi|31353663|gb|CD438020.1|CD438020 EL01N0508C08.b Endosperm_5 Ze... 36 6.6 gi|31910964|gb|CD651687.1|CD651687 3529_1_135_1_G03.x_1 3529 - 2... 36 6.6 gi|31998266|gb|CD662001.1|CD662001 3529_1_135_1_G03.y_1 3529 - 2... 36 6.6 gi|32789985|gb|CD942221.1|CD942221 RBP_85 GeneTag1 Zea mays cDNA... 36 6.6 gi|32801099|gb|CD953335.1|CD953335 SBH_238 GeneTag2 Zea mays cDN... 36 6.6 gi|32803528|gb|CD955764.1|CD955764 SBX_203 GeneTag2 Zea mays cDN... 36 6.6 gi|32803568|gb|CD955804.1|CD955804 SBX_32 GeneTag2 Zea mays cDNA... 36 6.6 gi|33467062|gb|CF244111.1|CF244111 3530_1_26_1_G07.x_1 3530 - Fu... 36 6.6 gi|33467464|gb|CF244513.1|CF244513 3530_1_2_1_F09.y_2 3530 - Ful... 36 6.6 gi|37373650|gb|CF623134.1|CF623134 zmrws05_0A10-004-c11.s0 zmrws... 36 6.6 gi|37376584|gb|CF624834.1|CF624834 zmrws05_0A20-009-h02.s0 zmrws... 36 6.6 gi|37377784|gb|CF625530.1|CF625530 zmrws05_0A21-002-a02.s0 zmrws... 36 6.6 gi|37386145|gb|CF630249.1|CF630249 zmrws48_0A20-010-f04.s0 zmrws... 36 6.6 gi|37418142|gb|CF646735.1|CF646735 3530_1_32_1_C06.x_1 3530 - Fu... 36 6.6 gi|38688211|gb|CK145242.1|CK145242 3530_1_16_1_E07.y_11 3530 - F... 36 6.6 gi|40334024|gb|CK368094.1|CK368094 zmrws055_0A11-004-c11.s0 zmrw... 36 6.6 gi|50326598|gb|CO521724.1|CO521724 3530_1_143_1_D11.x_1 3530 - F... 36 6.6 gi|50337455|gb|CO532581.1|CO532581 3530_1_214_1_D07.y_1 3530 - F... 36 6.6 gi|50338366|gb|CO533492.1|CO533492 3530_1_220_1_D02.x_1 3530 - F... 36 6.6 gi|60340978|gb|DN207951.1|DN207951 MEST862_B06.T7-1 UGA-ZmSAM-XZ... 36 6.6 gi|60347391|gb|DN214364.1|DN214364 MEST997_A12.T7-1 UGA-ZmSAM-XZ... 36 6.6 gi|60347788|gb|DN214761.1|DN214761 MEST890_F02.T7-1 UGA-ZmSAM-XZ... 36 6.6 gi|60348827|gb|DN215800.1|DN215800 MEST987_G09.T7-1 UGA-ZmSAM-XZ... 36 6.6 gi|67031559|gb|CO460308.1|CO460308 MZCCL15024H01.g Maize Endospe... 36 6.6 gi|71312702|gb|DR792875.1|DR792875 ZM_BFb0012O08.r ZM_BFb Zea ma... 36 6.6 gi|71323651|gb|DR798502.1|DR798502 ZM_BFb0021A21.f ZM_BFb Zea ma... 36 6.6 gi|71326992|gb|DR800146.1|DR800146 ZM_BFb0023G13.r ZM_BFb Zea ma... 36 6.6 gi|71329566|gb|DR801503.1|DR801503 ZM_BFb0025F17.f ZM_BFb Zea ma... 36 6.6 gi|71429696|gb|DR810746.1|DR810746 ZM_BFb0038K03.r ZM_BFb Zea ma... 36 6.6 gi|71434039|gb|DR815089.1|DR815089 ZM_BFb0045B04.f ZM_BFb Zea ma... 36 6.6 gi|71436607|gb|DR817657.1|DR817657 ZM_BFb0051E17.r ZM_BFb Zea ma... 36 6.6 gi|71437089|gb|DR818139.1|DR818139 ZM_BFb0052K04.r ZM_BFb Zea ma... 36 6.6 gi|71440719|gb|DR821769.1|DR821769 ZM_BFb0061G11.r ZM_BFb Zea ma... 36 6.6 gi|71442670|gb|DR823720.1|DR823720 ZM_BFb0064P19.f ZM_BFb Zea ma... 36 6.6 gi|71449300|gb|DR830350.1|DR830350 ZM_BFb0078A17.r ZM_BFb Zea ma... 36 6.6 gi|71758939|gb|DR956876.1|DR956876 ZM_BFb0054L13.f ZM_BFb Zea ma... 36 6.6 gi|71761734|gb|DR959671.1|DR959671 ZM_BFb0072C23.f ZM_BFb Zea ma... 36 6.6 gi|71764340|gb|DR962277.1|DR962277 ZM_BFb0080L02.r ZM_BFb Zea ma... 36 6.6 gi|71766501|gb|DR964438.1|DR964438 ZM_BFb0083N22.r ZM_BFb Zea ma... 36 6.6 gi|71770974|gb|DR968911.1|DR968911 ZM_BFb0090G20.r ZM_BFb Zea ma... 36 6.6 gi|74237769|gb|DT645683.1|DT645683 ZM_BFb0105N02.r ZM_BFb Zea ma... 36 6.6 gi|74241742|gb|DT649656.1|DT649656 ZM_BFb0112I08.f ZM_BFb Zea ma... 36 6.6 gi|74244014|gb|DT651928.1|DT651928 ZM_BFb0116H10.r ZM_BFb Zea ma... 36 6.6 gi|74245503|gb|DT653417.1|DT653417 ZM_BFb0125B07.f ZM_BFb Zea ma... 36 6.6 gi|74246410|gb|DT654324.1|DT654324 ZM_BFb0127L13.f ZM_BFb Zea ma... 36 6.6 gi|76011448|gb|DT938618.1|DT938618 ZM_BFb0120C15.r ZM_BFb Zea ma... 36 6.6 gi|76016531|gb|DT943701.1|DT943701 ZM_BFb0129M06.r ZM_BFb Zea ma... 36 6.6 gi|76020474|gb|DT947644.1|DT947644 ZM_BFb0135P02.r ZM_BFb Zea ma... 36 6.6 gi|76287442|gb|DV027010.1|DV027010 ZM_BFb0148E12.f ZM_BFb Zea ma... 36 6.6 gi|76289280|gb|DV028848.1|DV028848 ZM_BFb0151A07.r ZM_BFb Zea ma... 36 6.6 gi|76293760|gb|DV033328.1|DV033328 ZM_BFb0157I06.r ZM_BFb Zea ma... 36 6.6 gi|76909823|gb|DV163555.1|DV163555 ZM_BFb0159J18.r ZM_BFb Zea ma... 36 6.6 gi|76921697|gb|DV168656.1|DV168656 ZM_BFb0167G06.f ZM_BFb Zea ma... 36 6.6 gi|76922201|gb|DV168898.1|DV168898 ZM_BFb0167L18.r ZM_BFb Zea ma... 36 6.6 gi|76924407|gb|DV169938.1|DV169938 ZM_BFb0169E03.r ZM_BFb Zea ma... 36 6.6 gi|76926393|gb|DV170839.1|DV170839 ZM_BFb0170L10.r ZM_BFb Zea ma... 36 6.6 gi|76935004|gb|DV174130.1|DV174130 ZM_BFb0177J01.r ZM_BFb Zea ma... 36 6.6 gi|78083744|gb|DV512137.1|DV512137 ZM_BFb0192K17.r ZM_BFb Zea ma... 36 6.6 gi|78084582|gb|DV512975.1|DV512975 ZM_BFb0193O06.r ZM_BFb Zea ma... 36 6.6 gi|78088238|gb|DV516631.1|DV516631 ZM_BFb0199M24.r ZM_BFb Zea ma... 36 6.6 gi|78089932|gb|DV518306.1|DV518306 ZM_BFb0202E03.r ZM_BFb Zea ma... 36 6.6 gi|78104285|gb|DV522703.1|DV522703 ZM_BFb0208J12.r ZM_BFb Zea ma... 36 6.6 gi|78111348|gb|DV529745.1|DV529745 ZM_BFb0218M04.r ZM_BFb Zea ma... 36 6.6 gi|78112087|gb|DV530483.1|DV530483 ZM_BFb0220E14.r ZM_BFb Zea ma... 36 6.6 gi|78118598|gb|DV536982.1|DV536982 ZM_BFb0229L09.r ZM_BFb Zea ma... 36 6.6 gi|78123473|gb|DV541857.1|DV541857 ZM_BFb0236M15.f ZM_BFb Zea ma... 36 6.6 gi|78180583|gb|DV550911.1|DV550911 1000077-C03.GAD10-F UGI-Reseq... 36 6.6 gi|83279146|gb|DV943154.1|DV943154 1000142-H09.T7-1 UGI-Reseq Ze... 36 6.6 gi|86466478|gb|DY232848.1|DY232848 ZM_BFb0242C20.f ZM_BFb Zea ma... 36 6.6 gi|86466975|gb|DY233345.1|DY233345 ZM_BFb0242N24.r ZM_BFb Zea ma... 36 6.6 gi|86469574|gb|DY235944.1|DY235944 ZM_BFb0246O20.r ZM_BFb Zea ma... 36 6.6 gi|86471303|gb|DY237673.1|DY237673 ZM_BFb0254P12.r ZM_BFb Zea ma... 36 6.6 gi|86474342|gb|DY240712.1|DY240712 ZM_BFb0260I07.f ZM_BFb Zea ma... 36 6.6 gi|86475273|gb|DY241643.1|DY241643 ZM_BFb0262F03.r ZM_BFb Zea ma... 36 6.6 gi|87152637|gb|DY397426.1|DY397426 III-952-10A-F07.M13-R UGIII-R... 36 6.6 gi|87152122|gb|DY396911.1|DY396911 III-952-9A-E12.M13-R UGIII-Re... 36 6.6 gi|87157247|gb|DY402036.1|DY402036 V-946-6C-B10.Gal4-R UGV-Reseq... 36 6.6 gi|87157333|gb|DY402122.1|DY402122 V-946-4D-D05.Gal4-R UGV-Reseq... 36 6.6 gi|88757966|gb|DY542107.1|DY542107 ZM_BFb0367H15.r ZM_BFb Zea ma... 36 6.6 gi|89756359|gb|DY686409.1|DY686409 ZM_BFb0274O03.r ZM_BFb Zea ma... 36 6.6 gi|89756703|gb|DY686637.1|DY686637 ZM_BFb0275I23.r ZM_BFb Zea ma... 36 6.6 gi|91052622|gb|EB163040.1|EB163040 ZM_BFb0303M19.f ZM_BFb Zea ma... 36 6.6 gi|91874924|gb|EB404881.1|EB404881 ZM_BFb0314H18.r ZM_BFb Zea ma... 36 6.6 gi|91877742|gb|EB407699.1|EB407699 ZM_BFb0320B15.f ZM_BFb Zea ma... 36 6.6 gi|93011776|gb|EB637296.1|EB637296 ZM_BFb0322J07.f ZM_BFb Zea ma... 36 6.6 gi|93012228|gb|EB637748.1|EB637748 ZM_BFb0324A06.r ZM_BFb Zea ma... 36 6.6 gi|500852|gb|L33913.1|MZEAKHDA Zea mays (clone pAKHSDH2) asparta... 36 6.6 gi|517257|emb|X66076.1|ZMMNB1A Z.mays MNB1a mRNA for DNA-binding... 36 6.6 gi|54651557|gb|BT016776.1| Zea mays clone Contig609 mRNA sequence 36 6.6 gi|58866284|gb|AY850138.1| Zea mays senescence-inducible chlorop... 36 6.6 gi|21209341|gb|AY106263.1| Zea mays PCO149364 mRNA sequence 36 6.6 gi|21210247|gb|AY107169.1| Zea mays PCO151038 mRNA sequence 36 6.6 gi|21215928|gb|AY111338.1| Zea mays CL2352_-1 mRNA sequence 36 6.6 gi|71159403|gb|AY108158.2| Zea mays PCO072790 mRNA sequence 36 6.6 gi|517257|emb|X66076.1|ZMMNB1A Z.mays MNB1a mRNA for DNA-binding... 36 6.6 gi|500852|gb|L33913.1|MZEAKHDA Zea mays (clone pAKHSDH2) asparta... 36 6.6 gi|83957658|dbj|DD159361.1| A potato having enhanced starch cont... 36 6.6 gi|54651557|gb|BT016776.1| Zea mays clone Contig609 mRNA sequence 36 6.6 gi|58866284|gb|AY850138.1| Zea mays senescence-inducible chlorop... 36 6.6 gi|55741096|gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, co... 36 6.6 gi|55741072|gb|AY664416.1| Zea mays cultivar Mo17 locus bz, comp... 36 6.6 gi|55741054|gb|AY664415.1| Zea mays cultivar B73 locus 9009, com... 36 6.6 gi|21215928|gb|AY111338.1| Zea mays CL2352_-1 mRNA sequence 36 6.6 gi|71159403|gb|AY108158.2| Zea mays PCO072790 mRNA sequence 36 6.6 gi|21210247|gb|AY107169.1| Zea mays PCO151038 mRNA sequence 36 6.6 gi|21209341|gb|AY106263.1| Zea mays PCO149364 mRNA sequence 36 6.6 gi|29162697|emb|AX660933.1| Sequence 1290 from Patent WO03000906 36 6.6 gi|18092333|gb|AF448416.1| Zea mays B73 chromosome 9S bz genomic... 36 6.6 gi|93004171|gb|AC185500.1| Zea mays chromosome 3 clone CH201-528... 36 6.6 gi|92900759|gb|AC185469.1| Zea mays chromosome 4 clone CH201-272... 36 6.6 gi|92110181|gb|AC185318.1| Zea mays chromosome UNK clone CH201-5... 36 6.6 gi|91982798|gb|AC185254.1| Zea mays chromosome UNK clone CH201-4... 36 6.6 gi|91630512|gb|AC185125.1| Zea mays chromosome UNK clone CH201-3... 36 6.6 gi|90855892|gb|AC184141.1| Zea mays chromosome UNK clone CH201-1... 36 6.6 gi|89274339|gb|AC182818.2| Zea mays chromosome UNK clone ZMMBBb-... 36 6.6 gi|89274337|gb|AC182438.3| Zea mays chromosome UNK clone ZMMBBb-... 36 6.6 gi|89257788|gb|AC177911.2| Zea mays chromosome UNK clone CH201-1... 36 6.6 gi|89257779|gb|AC177900.2| Zea mays chromosome UNK clone CH201-1... 36 6.6 gi|89257732|gb|AC177860.2| Zea mays chromosome UNK clone CH201-3... 36 6.6 gi|85861337|gb|AC177827.1| Zea mays chromosome UNK clone CH201-2... 36 6.6 gi|58082478|gb|AC155619.2| Zea mays strain B73 clone ZMMBBc0347P... 36 6.6 gi|58082446|gb|AC155587.2| Zea mays strain B73 clone ZMMBBc0199C... 36 6.6 gi|58082434|gb|AC155575.2| Zea mays strain B73 clone ZMMBBc0180B... 36 6.6 gi|48762560|gb|AC148179.4| Zea mays clone ZMMBBb0356A09, *** SEQ... 36 6.6 gi|51556349|gb|AC148173.2| Zea mays clone ZMMBBc0434A01, *** SEQ... 36 6.6 >gi|5740674|gb|AI948364.1|AI948364 603043G03.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 661 Score = 1287 bits (649), Expect = 0.0 Identities = 652/653 (99%) Strand = Plus / Minus Query: 1 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 661 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 602 Query: 61 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 601 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 542 Query: 121 cattcttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 541 cattcttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttc 482 Query: 181 tgacattatgataatcagggtctgtagggcccacccaacccggcgccggcgccgcgtcga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 481 tgacattatgataatcagggtctgtagggcccacccaacccggcgccggcgccgcgtcga 422 Query: 241 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 362 Query: 301 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggagaccggct 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggagaccggct 302 Query: 361 ggccgtcggccggcggcgagggcgccagcgtggagaacgcggcggcgtacaacaacaacg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 ggccgtcggccggcggcgagggcgccagcgtggagaacgcggcggcgtacaacaacaacg 242 Query: 421 tggtgcggcacgtcgacggcggcacccctcggcggcccgggaaggccctggagacctacc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 tggtgcggcacgtcgacggcggcacccctcggcggcccgggaaggccctggagacctacc 182 Query: 481 tgttcgccatgttcaacgagaacggcaaggccgagggcgtggagcagcacttcggcctct 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tgttcgccatgttcaacgagaacggcaaggccgagggcgtggagcagcacttcggcctct 122 Query: 541 tccagccggacatgagcgaggtctaccacgtcgacttcacggcgggatccccctagggag 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tccagccggacatgagcgaggtctaccacgtcgacttcacggcgggatccccctagggag 62 Query: 601 gctcacccgcttctgtgtttactttatttatgtagtaggaatgatcattcttc 653 |||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 61 gctcacccgcttctgtgtttactttatttatgtagtaggaatgatcgttcttc 9 >gi|4730357|gb|AI649523.1|AI649523 603005G02.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 620 Score = 1100 bits (555), Expect = 0.0 Identities = 555/555 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgtcgacggtgacggacggcggggcggtgtacactaacatgttcg 279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 583 ccggcgccggcgccgcgtcgacggtgacggacggcggggcggtgtacactaacatgttcg 524 Query: 280 acgcgatcgtggacgcgacgcacgcggcggtggagaaggccggggtgcaggggctggagc 339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 523 acgcgatcgtggacgcgacgcacgcggcggtggagaaggccggggtgcaggggctggagc 464 Query: 340 tggtggtgtcggagaccggctggccgtcggccggcggcgagggcgccagcgtggagaacg 399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 463 tggtggtgtcggagaccggctggccgtcggccggcggcgagggcgccagcgtggagaacg 404 Query: 400 cggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcggcggcccg 459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 403 cggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcggcggcccg 344 Query: 460 ggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggccgagggcg 519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 343 ggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggccgagggcg 284 Query: 520 tggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcgacttca 579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 283 tggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcgacttca 224 Query: 580 cggcgggatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtagg 639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 223 cggcgggatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtagg 164 Query: 640 aatgatcattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcg 699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 163 aatgatcattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcg 104 Query: 700 gcgcggataggcttactgcgtactggtagtattgttggagacttggagtagcattactat 759 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 103 gcgcggataggcttactgcgtactggtagtattgttggagacttggagtagcattactat 44 Query: 760 cgacgtgattcatta 774 ||||||||||||||| Sbjct: 43 cgacgtgattcatta 29 >gi|21216148|gb|AY111558.1| Zea mays CL31592_1 mRNA sequence Length = 818 Score = 708 bits (357), Expect = 0.0 Identities = 367/372 (98%) Strand = Plus / Minus Query: 392 ggagaacgcggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcg 451 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 418 ggagaacgcggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcg 359 Query: 452 gcggcccgggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggc 511 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 358 gcggcccgggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggc 299 Query: 512 cgagggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgt 571 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 298 cgagggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgt 239 Query: 572 cgacttcacggcgggatccccctagggaggctcacccgcttctgtgtttactttatttat 631 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 238 cgacttcacggcgggatnnnnntagggaggctcacccgcttctgtgtttactttatttat 179 Query: 632 gtagtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgata 691 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 178 gtagtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgata 119 Query: 692 ctcgagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagc 751 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118 ctcgagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagc 59 Query: 752 attactatcgac 763 |||||||||||| Sbjct: 58 attactatcgac 47 Score = 353 bits (178), Expect = 2e-95 Identities = 188/193 (97%) Strand = Plus / Minus Query: 1 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 809 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 750 Query: 61 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 749 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 690 Query: 121 cattcttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttc 180 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 689 cattcttgatcagtgctaagttctccaactcatgcctcttggacnnnnncttgaactttc 630 Query: 181 tgacattatgata 193 ||||||||||||| Sbjct: 629 tgacattatgata 617 Score = 224 bits (113), Expect = 1e-56 Identities = 113/113 (100%) Strand = Plus / Minus Query: 241 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 569 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 510 Query: 301 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggag 353 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 509 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggag 457 >gi|21216148|gb|AY111558.1| Zea mays CL31592_1 mRNA sequence Length = 818 Score = 708 bits (357), Expect = 0.0 Identities = 367/372 (98%) Strand = Plus / Minus Query: 392 ggagaacgcggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcg 451 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 418 ggagaacgcggcggcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcg 359 Query: 452 gcggcccgggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggc 511 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 358 gcggcccgggaaggccctggagacctacctgttcgccatgttcaacgagaacggcaaggc 299 Query: 512 cgagggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgt 571 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 298 cgagggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgt 239 Query: 572 cgacttcacggcgggatccccctagggaggctcacccgcttctgtgtttactttatttat 631 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 238 cgacttcacggcgggatnnnnntagggaggctcacccgcttctgtgtttactttatttat 179 Query: 632 gtagtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgata 691 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 178 gtagtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgata 119 Query: 692 ctcgagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagc 751 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118 ctcgagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagc 59 Query: 752 attactatcgac 763 |||||||||||| Sbjct: 58 attactatcgac 47 Score = 353 bits (178), Expect = 2e-95 Identities = 188/193 (97%) Strand = Plus / Minus Query: 1 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 809 atgtagtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttca 750 Query: 61 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 749 tgtaatgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagtt 690 Query: 121 cattcttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttc 180 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 689 cattcttgatcagtgctaagttctccaactcatgcctcttggacnnnnncttgaactttc 630 Query: 181 tgacattatgata 193 ||||||||||||| Sbjct: 629 tgacattatgata 617 Score = 224 bits (113), Expect = 1e-56 Identities = 113/113 (100%) Strand = Plus / Minus Query: 241 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 569 cggtgacggacggcggggcggtgtacactaacatgttcgacgcgatcgtggacgcgacgc 510 Query: 301 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggag 353 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 509 acgcggcggtggagaaggccggggtgcaggggctggagctggtggtgtcggag 457 >gi|61236650|gb|DN586396.1|DN586396 EST6387 Zea mays embryo sac cDNA library Zea mays cDNA clone ES14216 5' similar to glucan endo-1,3-beta-D-glucosidase, mRNA sequence Length = 523 Score = 581 bits (293), Expect = e-164 Identities = 293/293 (100%) Strand = Plus / Plus Query: 515 gggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcga 574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gggcgtggagcagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcga 60 Query: 575 cttcacggcgggatccccctagggaggctcacccgcttctgtgtttactttatttatgta 634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cttcacggcgggatccccctagggaggctcacccgcttctgtgtttactttatttatgta 120 Query: 635 gtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgatactc 694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gtaggaatgatcattcttcattcagagactgatcgacttcatcggagctgctcgatactc 180 Query: 695 gagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagcatt 754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gagcggcgcggataggcttactgcgtactggtagtattgttggagacttggagtagcatt 240 Query: 755 actatcgacgtgattcattacagtgcatgtcgttacacggcgccatggattta 807 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 actatcgacgtgattcattacagtgcatgtcgttacacggcgccatggattta 293 >gi|85152682|gb|DW587817.1|DW587817 E3540 Zea mays egg cell cDNA library Zea mays cDNA clone 5919 5' similar to beta-1,3-glucanase, mRNA sequence Length = 316 Score = 559 bits (282), Expect = e-157 Identities = 288/290 (99%) Strand = Plus / Plus Query: 487 ccatgttcaacgagaacggcaaggccgagggcgtggagcagcacttcggcctcttccagc 546 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ccatgttcaacgagaacggcaaggccgagggcgtggagcagcacttcggcctcttccagc 60 Query: 547 cggacatgagcgaggtctaccacgtcgacttcacggcgggatccccctagggaggctcac 606 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cggacatgagcgaggtctaccacgtcgacttcacggcgggatccccctagggaggctcac 120 Query: 607 ccgcttctgtgtttactttatttatgtagtaggaatgatcattcttcattcagagactga 666 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 ccgcttctgtgtttactttatttatgtagtaggaatgatcattcttcattcagagactga 180 Query: 667 tcgacttcatcggagctgctcgatactcgagcggcgcggataggcttactgcgtactggt 726 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 181 ttgacttcatcggagctgctcgatactcgagcggcgcggataggcttactgcatactggt 240 Query: 727 agtattgttggagacttggagtagcattactatcgacgtgattcattaca 776 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 agtattgttggagacttggagtagcattactatcgacgtgattcattaca 290 >gi|78021451|gb|DV489838.1|DV489838 1000131-G08.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 287 Score = 553 bits (279), Expect = e-155 Identities = 285/287 (99%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggcgagggcgccagcgtggagaacgcggcg 404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 287 gtgtcggagaccggctggccgtcggccggcggcgagggcgccagcgtggagaacgcggcg 228 Query: 405 gcgtacaacaacaacgtggtgcggcacgtcgacggcggcacccctcggcggcccgggaag 464 |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 227 gcgtacaacaacaacgtggtgcggcatgttgacggcggcacccctcggcggcccgggaag 168 Query: 465 gccctggagacctacctgttcgccatgttcaacgagaacggcaaggccgagggcgtggag 524 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 167 gccctggagacctacctgttcgccatgttcaacgagaacggcaaggccgagggcgtggag 108 Query: 525 cagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcgacttcacggcg 584 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 107 cagcacttcggcctcttccagccggacatgagcgaggtctaccacgtcgacttcacggcg 48 Query: 585 ggatccccctagggaggctcacccgcttctgtgtttactttatttat 631 ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 47 ggatccccctagggaggctcacccgcttctgtgtttactttatttat 1 >gi|32789576|gb|CD941812.1|CD941812 RBK_30 GeneTag1 Zea mays cDNA, mRNA sequence Length = 222 Score = 440 bits (222), Expect = e-121 Identities = 222/222 (100%) Strand = Plus / Plus Query: 586 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 645 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 60 Query: 646 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 705 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 120 Query: 706 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 765 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 180 Query: 766 gattcattacagtgcatgtcgttacacggcgccatggattta 807 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gattcattacagtgcatgtcgttacacggcgccatggattta 222 >gi|32799627|gb|CD951863.1|CD951863 SAZ_158 GeneTag2 Zea mays cDNA, mRNA sequence Length = 222 Score = 440 bits (222), Expect = e-121 Identities = 222/222 (100%) Strand = Plus / Minus Query: 586 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 645 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 222 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 163 Query: 646 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 705 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 162 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 103 Query: 706 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 765 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 102 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 43 Query: 766 gattcattacagtgcatgtcgttacacggcgccatggattta 807 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 42 gattcattacagtgcatgtcgttacacggcgccatggattta 1 >gi|32790115|gb|CD942351.1|CD942351 RBU_39 GeneTag1 Zea mays cDNA, mRNA sequence Length = 221 Score = 436 bits (220), Expect = e-120 Identities = 220/220 (100%) Strand = Plus / Plus Query: 586 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 645 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gatccccctagggaggctcacccgcttctgtgtttactttatttatgtagtaggaatgat 60 Query: 646 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 705 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cattcttcattcagagactgatcgacttcatcggagctgctcgatactcgagcggcgcgg 120 Query: 706 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 765 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 ataggcttactgcgtactggtagtattgttggagacttggagtagcattactatcgacgt 180 Query: 766 gattcattacagtgcatgtcgttacacggcgccatggatt 805 |||||||||||||||||||||||||||||||||||||||| Sbjct: 181 gattcattacagtgcatgtcgttacacggcgccatggatt 220 >gi|78086913|gb|DV515306.1|DV515306 ZM_BFb0197N06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 751 Score = 426 bits (215), Expect = e-117 Identities = 215/215 (100%) Strand = Plus / Plus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 224 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 284 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 344 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||||||||||||||||||||||||||||||||| Sbjct: 345 attatgataatcagggtctgtagggcccacccaac 379 >gi|76282101|gb|DV021669.1|DV021669 ZM_BFb0140I08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 725 Score = 418 bits (211), Expect = e-115 Identities = 214/215 (99%) Strand = Plus / Plus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 141 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 200 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 201 atgaaaatttaaattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 260 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 261 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 320 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||||||||||||||||||||||||||||||||| Sbjct: 321 attatgataatcagggtctgtagggcccacccaac 355 >gi|21843238|gb|BQ703819.1|BQ703819 946106C10.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 428 Score = 402 bits (203), Expect = e-110 Identities = 212/215 (98%) Strand = Plus / Minus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 340 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 339 atgaaaatttagattgtcctgctgatgcctcgcgagcagttgctcctctcgcagttcatt 280 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 279 cttgattagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 220 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||||||||||||||| ||||||||||||||||| Sbjct: 219 attatgataatcagggtttgtagggcccacccaac 185 >gi|26557810|gb|CA830045.1|CA830045 1117001E07.y1 1117 - Unigene V from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 481 Score = 402 bits (203), Expect = e-110 Identities = 212/215 (98%) Strand = Plus / Minus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 352 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 293 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 292 atgaaaatttagattgtcctgctgatgcctcgcgagcagttgctcctctcgcagttcatt 233 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 232 cttgattagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 173 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||||||||||||||| ||||||||||||||||| Sbjct: 172 attatgataatcagggtttgtagggcccacccaac 138 >gi|87157112|gb|DY401901.1|DY401901 V-946-1A-E07.T7-1 UGV-Reseq Zea mays cDNA, mRNA sequence Length = 744 Score = 402 bits (203), Expect = e-110 Identities = 212/215 (98%) Strand = Plus / Plus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 410 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 469 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 470 atgaaaatttagattgtcctgctgatgcctcgcgagcagttgctcctctcgcagttcatt 529 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 530 cttgattagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 589 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||||||||||||||| ||||||||||||||||| Sbjct: 590 attatgataatcagggtttgtagggcccacccaac 624 >gi|61119146|gb|DN560107.1|DN560107 E11-G02-T3 E7PCR Zea mays cDNA clone E7PCRE1102G, mRNA sequence Length = 356 Score = 394 bits (199), Expect = e-108 Identities = 211/215 (98%) Strand = Plus / Minus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 216 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcatgta 157 Query: 65 atgaaaatttagattgtcctgctgatgcctcgcgagaagttgctcctctcgcagttcatt 124 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 156 atgaaaatttagattgtcctgctgatgcctcgcgagcagttgctcctctcgcagttcatt 97 Query: 125 cttgatcagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 184 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 96 cttgattagtgctaagttctccaactcatgcctcttggacaaaaacttgaactttctgac 37 Query: 185 attatgataatcagggtctgtagggcccacccaac 219 ||||| ||||||||||||||||||| ||||||||| Sbjct: 36 attattataatcagggtctgtagggtccacccaac 2 >gi|21891422|gb|BQ744635.1|BQ744635 946106C10.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 419 Score = 113 bits (57), Expect = 4e-23 Identities = 57/57 (100%) Strand = Plus / Plus Query: 5 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcat 61 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 363 agtcaggcgattgatgcagccactcgtaatcatgctgtctacagtctcaagcttcat 419 >gi|6918860|gb|AW400390.1|AW400390 707062G06.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 586 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 336 gagacctacctcttctccatgttcaacgagaac 368 >gi|7304697|gb|AW600636.1|AW600636 707104C10.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 365 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 214 gagacctacctcttctccatgttcaacgagaac 246 >gi|12046369|gb|BF728508.1|BF728508 1000063D08.x1 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 476 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 308 gagacctacctcttctccatgttcaacgagaac 340 >gi|13149335|gb|BG319657.1|BG319657 Zm03_06g10_A Zm03_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm03_06g10, mRNA sequence Length = 821 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 567 gagacctacctcttctccatgttcaacgagaac 535 Score = 42.1 bits (21), Expect = 0.11 Identities = 33/37 (89%) Strand = Plus / Minus Query: 342 gtggtgtcggagaccggctggccgtcggccggcggcg 378 ||||||||||||| ||| |||||||| | |||||||| Sbjct: 693 gtggtgtcggagagcgggtggccgtccggcggcggcg 657 >gi|17932057|gb|BM269017.1|BM269017 MEST403-G12.univ ISUM5-RN Zea mays cDNA clone MEST403-G12 3', mRNA sequence Length = 669 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 628 gagacctacctcttctccatgttcaacgagaac 596 >gi|18660949|gb|BM501133.1|BM501133 PAC000000001181 Pioneer AF-1 array Zea mays cDNA, mRNA sequence Length = 442 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 388 gagacctacctcttctccatgttcaacgagaac 356 >gi|56462108|gb|CK986406.1|CK986406 WSEST0174 water stress specific subtracted cDNA library of maize seedlings Zea mays cDNA clone O6, mRNA sequence Length = 176 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Minus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 126 gagacctacctcttctccatgttcaacgagaac 94 >gi|21212773|gb|AY109289.1| Zea mays PCO135820 mRNA sequence Length = 976 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 372 gagacctacctcttctccatgttcaacgagaac 404 Score = 42.1 bits (21), Expect = 0.11 Identities = 33/37 (89%) Strand = Plus / Plus Query: 342 gtggtgtcggagaccggctggccgtcggccggcggcg 378 ||||||||||||| ||| |||||||| | |||||||| Sbjct: 246 gtggtgtcggagagcgggtggccgtccggcggcggcg 282 >gi|21212773|gb|AY109289.1| Zea mays PCO135820 mRNA sequence Length = 976 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 372 gagacctacctcttctccatgttcaacgagaac 404 Score = 42.1 bits (21), Expect = 0.11 Identities = 33/37 (89%) Strand = Plus / Plus Query: 342 gtggtgtcggagaccggctggccgtcggccggcggcg 378 ||||||||||||| ||| |||||||| | |||||||| Sbjct: 246 gtggtgtcggagagcgggtggccgtccggcggcggcg 282 >gi|29162717|emb|AX660953.1| Sequence 1310 from Patent WO03000906 Length = 603 Score = 50.1 bits (25), Expect = 4e-04 Identities = 31/33 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgagaac 503 ||||||||||| ||| ||||||||||||||||| Sbjct: 496 gagacctacctcttctccatgttcaacgagaac 528 Score = 42.1 bits (21), Expect = 0.11 Identities = 33/37 (89%) Strand = Plus / Plus Query: 342 gtggtgtcggagaccggctggccgtcggccggcggcg 378 ||||||||||||| ||| |||||||| | |||||||| Sbjct: 370 gtggtgtcggagagcgggtggccgtccggcggcggcg 406 >gi|4174509|gb|AI374565.1|AI374565 MEST5-E7.POLYT-N.Seq ISUM2 Zea mays cDNA clone MEST5-E7 5', mRNA sequence Length = 886 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Minus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 303 ctggagaccttcgtcttcgccatgttcaacgagaac 268 Score = 44.1 bits (22), Expect = 0.027 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 423 gtgtccgagancggctggccctcggccggcggc 391 >gi|6952592|gb|AW424660.1|AW424660 707020H08.y1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 383 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Plus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 76 ctggagaccttcgtcttcgccatgttcaacgagaac 111 >gi|18180587|gb|BM381797.1|BM381797 MEST540-C07.univ ISUM6 Zea mays cDNA clone MEST540-C07 3', mRNA sequence Length = 519 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Minus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 333 ctggagaccttcgtcttcgccatgttcaacgagaac 298 Score = 42.1 bits (21), Expect = 0.11 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 453 gtgtccgagagcggctggccctcggccggcggc 421 >gi|86467494|gb|DY233864.1|DY233864 ZM_BFb0243L05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 687 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Minus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 301 ctggagaccttctttttcgccatgttcaacgagaac 266 Score = 42.1 bits (21), Expect = 0.11 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 421 gtgtccgagagcggctggccctcggccggcggc 389 >gi|91049150|gb|EB159568.1|EB159568 ZM_BFb0295I05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 580 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Minus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 297 ctggagaccttctttttcgccatgttcaacgagaac 262 Score = 42.1 bits (21), Expect = 0.11 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 417 gtgtccgagagcggctggccctcggccggcggc 385 >gi|29162720|emb|AX660956.1| Sequence 1313 from Patent WO03000906 Length = 1017 Score = 48.1 bits (24), Expect = 0.002 Identities = 33/36 (91%) Strand = Plus / Plus Query: 468 ctggagacctacctgttcgccatgttcaacgagaac 503 |||||||||| | | ||||||||||||||||||||| Sbjct: 901 ctggagaccttcgtcttcgccatgttcaacgagaac 936 Score = 42.1 bits (21), Expect = 0.11 Identities = 30/33 (90%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 781 gtgtccgagagcggctggccctcggccggcggc 813 >gi|18171925|gb|BM347313.1|BM347313 MEST275-F11.T3 ISUM5-RN Zea mays cDNA clone MEST275-F11 3', mRNA sequence Length = 627 Score = 46.1 bits (23), Expect = 0.007 Identities = 29/31 (93%) Strand = Plus / Minus Query: 473 gacctacctgttcgccatgttcaacgagaac 503 ||||||||| ||| ||||||||||||||||| Sbjct: 627 gacctaccttttctccatgttcaacgagaac 597 >gi|168394|gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs Length = 1265 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 957 gagacctacatcttcgccatgttcaacgag 986 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 834 gtgtccgagagcggctggccgtccgccgggggcga 868 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1016 gcacttcggcctcttcaacccggaca 1041 >gi|21216265|gb|AY111675.1| Zea mays CL1243_1 mRNA sequence Length = 1272 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 964 gagacctacatcttcgccatgttcaacgag 993 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1023 gcacttcggcctcttcaacccggaca 1048 >gi|1839590|gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=maize, cv. INRA 258, mercuric chloride-treated, leaves, mRNA Partial, 1243 nt] Length = 1243 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 943 gagacctacatcttcgccatgttcaacgag 972 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 826 gtgtccgagagcggctggccgtccgccgggggcga 860 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1002 gcacttcggcctcttcaacccggaca 1027 >gi|1839590|gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=maize, cv. INRA 258, mercuric chloride-treated, leaves, mRNA Partial, 1243 nt] Length = 1243 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 943 gagacctacatcttcgccatgttcaacgag 972 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 826 gtgtccgagagcggctggccgtccgccgggggcga 860 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1002 gcacttcggcctcttcaacccggaca 1027 >gi|168394|gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs Length = 1265 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 957 gagacctacatcttcgccatgttcaacgag 986 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 834 gtgtccgagagcggctggccgtccgccgggggcga 868 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1016 gcacttcggcctcttcaacccggaca 1041 >gi|77862322|gb|DQ147111.1| Zea mays subsp. parviglumis isolate p15 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1182 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1027 gagacctacatcttcgccatgttcaacgag 1056 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 904 gtgtccgagagcggctggccgtccgccgggggcga 938 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1086 gcacttcggcctcttcaacccggaca 1111 >gi|77862320|gb|DQ147110.1| Zea mays subsp. parviglumis isolate p14 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1181 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1026 gagacctacatcttcgccatgttcaacgag 1055 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 903 gtgtccgagagcggctggccgtccgccgggggcga 937 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1085 gcacttcggcctcttcaacccggaca 1110 >gi|77862318|gb|DQ147109.1| Zea mays subsp. parviglumis isolate p13 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1181 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1026 gagacctacatcttcgccatgttcaacgag 1055 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 903 gtgtccgagagcggctggccgtccgccgggggcga 937 >gi|77862316|gb|DQ147108.1| Zea mays subsp. parviglumis isolate p12 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1185 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|77862314|gb|DQ147107.1| Zea mays subsp. parviglumis isolate p11 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1186 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1031 gagacctacatcttcgccatgttcaacgag 1060 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 908 gtgtccgagagcggctggccgtccgccgggggcga 942 >gi|77862312|gb|DQ147106.1| Zea mays subsp. parviglumis isolate p9b truncated pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1120 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|77862310|gb|DQ147105.1| Zea mays subsp. parviglumis isolate p9 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1185 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|77862308|gb|DQ147104.1| Zea mays subsp. parviglumis isolate p8 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1182 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1027 gagacctacatcttcgccatgttcaacgag 1056 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 904 gtgtccgagagcggctggccgtccgccgggggcga 938 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1086 gcacttcggcctcttcaacccggaca 1111 >gi|77862306|gb|DQ147103.1| Zea mays subsp. parviglumis isolate p6 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1182 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1027 gagacctacatcttcgccatgttcaacgag 1056 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 904 gtgtccgagagcggctggccgtccgccgggggcga 938 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1086 gcacttcggcctcttcaacccggaca 1111 >gi|77862304|gb|DQ147102.1| Zea mays subsp. parviglumis isolate p5 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1185 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|77862302|gb|DQ147101.1| Zea mays subsp. parviglumis isolate p4 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1185 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|77862300|gb|DQ147100.1| Zea mays subsp. parviglumis isolate p3 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1186 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1031 gagacctacatcttcgccatgttcaacgag 1060 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 908 gtgtccgagagcggctggccgtccgccgggggcga 942 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1090 gcacttcggcctcttcaacccggaca 1115 >gi|77862298|gb|DQ147099.1| Zea mays subsp. parviglumis isolate p2 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1182 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1027 gagacctacatcttcgccatgttcaacgag 1056 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 904 gtgtccgagagcggctggccgtccgccgggggcga 938 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1086 gcacttcggcctcttcaacccggaca 1111 >gi|77862296|gb|DQ147098.1| Zea mays subsp. parviglumis isolate p1 pathogenesis-related protein 6 (pr6) gene, complete cds Length = 1185 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 1030 gagacctacatcttcgccatgttcaacgag 1059 Score = 38.2 bits (19), Expect = 1.7 Identities = 31/35 (88%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccggcggcga 379 ||||| |||| |||||||||||| ||||| ||||| Sbjct: 907 gtgtccgagagcggctggccgtccgccgggggcga 941 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1089 gcacttcggcctcttcaacccggaca 1114 >gi|21216265|gb|AY111675.1| Zea mays CL1243_1 mRNA sequence Length = 1272 Score = 44.1 bits (22), Expect = 0.027 Identities = 28/30 (93%) Strand = Plus / Plus Query: 471 gagacctacctgttcgccatgttcaacgag 500 ||||||||| | |||||||||||||||||| Sbjct: 964 gagacctacatcttcgccatgttcaacgag 993 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 527 gcacttcggcctcttccagccggaca 552 |||||||||||||||| | ||||||| Sbjct: 1023 gcacttcggcctcttcaacccggaca 1048 >gi|18178283|gb|BM379493.1|BM379493 MEST506-C09.univ ISUM6 Zea mays cDNA clone MEST506-C09 3', mRNA sequence Length = 525 Score = 42.1 bits (21), Expect = 0.11 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccggcggc 377 ||||| |||| ||||||||| |||||||||||| Sbjct: 450 gtgtccgagagcggctggccctcggccggcggc 418 >gi|74236304|gb|DT644218.1|DT644218 ZM_BFb0103J09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 700 Score = 42.1 bits (21), Expect = 0.11 Identities = 24/25 (96%) Strand = Plus / Plus Query: 503 cggcaaggccgagggcgtggagcag 527 |||||| |||||||||||||||||| Sbjct: 592 cggcaaagccgagggcgtggagcag 616 >gi|91872390|gb|EB402347.1|EB402347 ZM_BFb0309B14.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 713 Score = 42.1 bits (21), Expect = 0.11 Identities = 24/25 (96%) Strand = Plus / Minus Query: 344 ggtgtcggagaccggctggccgtcg 368 ||||||||||||||| ||||||||| Sbjct: 638 ggtgtcggagaccgggtggccgtcg 614 >gi|89572702|gb|AC183756.1| Zea mays chromosome UNK clone CH201-284M12; ZMMBBc0284M12, *** SEQUENCING IN PROGRESS ***, 24 unordered pieces Length = 144133 Score = 42.1 bits (21), Expect = 0.11 Identities = 27/29 (93%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggccgg 373 |||||||||||||| ||||| |||||||| Sbjct: 11761 gtgtcggagaccgggtggccatcggccgg 11733 >gi|58082248|gb|AC155386.2| Zea mays strain B73 clone ZMMBBb0151L07, *** SEQUENCING IN PROGRESS ***, 29 unordered pieces Length = 185679 Score = 42.1 bits (21), Expect = 0.11 Identities = 27/29 (93%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggccgg 373 |||||||||||||| ||||| |||||||| Sbjct: 34391 gtgtcggagaccgggtggccatcggccgg 34419 >gi|57790147|gb|AC149826.2| Zea mays clone ZMMBBc0046N19, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 111575 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 tggtgcggcacgtcgacggcg 441 ||||||||||||||||||||| Sbjct: 2337 tggtgcggcacgtcgacggcg 2317 >gi|58531567|gb|AC149034.3| Zea mays clone ZMMBBc0088M21, *** SEQUENCING IN PROGRESS *** Length = 165335 Score = 42.1 bits (21), Expect = 0.11 Identities = 21/21 (100%) Strand = Plus / Plus Query: 421 tggtgcggcacgtcgacggcg 441 ||||||||||||||||||||| Sbjct: 107767 tggtgcggcacgtcgacggcg 107787 >gi|6536597|gb|AW224910.1|AW224910 687047D11.y1 687 - Early embryo from Delaware Zea mays cDNA, mRNA sequence Length = 596 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 379 tacactaacatgttcgacgc 398 >gi|37378752|gb|CF626083.1|CF626083 zmrws05_0B10-009-e08.s3 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 663 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 478 ccggcgccggcgccgcgtcg 497 >gi|37383450|gb|CF628741.1|CF628741 zmrws48_0A10-009-d01.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 682 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 454 ccggcgccggcgccgcgtcg 473 >gi|37392245|gb|CF633371.1|CF633371 zmrws48_0B20-015-b05.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 545 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 482 ccggcgccggcgccgcgtcg 501 >gi|40302809|gb|CK347196.1|CK347196 zmrsub1_0A10-004-a01.s4 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 630 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 486 ccggcgccggcgccgcgtcg 505 >gi|50329342|gb|CO524468.1|CO524468 3530_1_162_1_A01.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 421 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 177 ccggcgccggcgccgcgtcg 196 >gi|60349528|gb|DN216501.1|DN216501 MEST1035_E10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 730 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 362 tacactaacatgttcgacgc 381 >gi|67017556|gb|CO446305.1|CO446305 MZCCL10101C01.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 908 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 535 tacactaacatgttcgacgc 554 >gi|67022628|gb|CO451377.1|CO451377 MZCCL10152C10.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 807 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 427 ccggcgccggcgccgcgtcg 408 >gi|78088058|gb|DV516451.1|DV516451 ZM_BFb0199I10.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 633 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 agaacgcggcggcgtacaac 413 |||||||||||||||||||| Sbjct: 441 agaacgcggcggcgtacaac 422 >gi|78092993|gb|DV521367.1|DV521367 ZM_BFb0206K08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 756 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 167 ccggcgccggcgccgcgtcg 186 >gi|21214367|gb|AY110207.1| Zea mays CL23834_1 mRNA sequence Length = 960 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 729 tacactaacatgttcgacgc 748 >gi|47100717|gb|BV151260.1| PZA02122-72583-W22_R-scm2 Zea mays W22_R-scm2 Zea mays STS genomic, sequence tagged site Length = 315 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 102 tacactaacatgttcgacgc 121 >gi|47100716|gb|BV151259.1| PZA02122-72571-Tx501 Zea mays Tx501 Zea mays STS genomic, sequence tagged site Length = 312 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 110 tacactaacatgttcgacgc 129 >gi|47100715|gb|BV151258.1| PZA02122-72581-Tx303 Zea mays Tx303 Zea mays STS genomic, sequence tagged site Length = 321 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 106 tacactaacatgttcgacgc 125 >gi|47100714|gb|BV151257.1| PZA02122-72580-T218 Zea mays T218 Zea mays STS genomic, sequence tagged site Length = 320 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 106 tacactaacatgttcgacgc 125 >gi|47100713|gb|BV151256.1| PZA02122-72582-NC7A Zea mays NC7A Zea mays STS genomic, sequence tagged site Length = 321 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 108 tacactaacatgttcgacgc 127 >gi|47100712|gb|BV151255.1| PZA02122-72570-Mp708 Zea mays Mp708 Zea mays STS genomic, sequence tagged site Length = 316 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 114 tacactaacatgttcgacgc 133 >gi|47100711|gb|BV151254.1| PZA02122-72579-Mo17 Zea mays Mo17 Zea mays STS genomic, sequence tagged site Length = 320 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 106 tacactaacatgttcgacgc 125 >gi|47100710|gb|BV151253.1| PZA02122-72584-ILO Zea mays ILO Zea mays STS genomic, sequence tagged site Length = 327 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 114 tacactaacatgttcgacgc 133 >gi|47100709|gb|BV151252.1| PZA02122-72572-IHO Zea mays IHO Zea mays STS genomic, sequence tagged site Length = 327 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 114 tacactaacatgttcgacgc 133 >gi|47100708|gb|BV151251.1| PZA02122-72568-GT119 Zea mays GT119 Zea mays STS genomic, sequence tagged site Length = 337 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 122 tacactaacatgttcgacgc 141 >gi|47100707|gb|BV151250.1| PZA02122-72569-CO159 Zea mays CO159 Zea mays STS genomic, sequence tagged site Length = 327 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 115 tacactaacatgttcgacgc 134 >gi|47100706|gb|BV151249.1| PZA02122-72567-B73 Zea mays B73 Zea mays STS genomic, sequence tagged site Length = 336 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 122 tacactaacatgttcgacgc 141 >gi|21214367|gb|AY110207.1| Zea mays CL23834_1 mRNA sequence Length = 960 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tacactaacatgttcgacgc 283 |||||||||||||||||||| Sbjct: 729 tacactaacatgttcgacgc 748 >gi|91065007|gb|AC184783.1| Zea mays chromosome UNK clone CH201-187K18; ZMMBBc0187K18, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 179582 Score = 40.1 bits (20), Expect = 0.43 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 ccggcgccggcgccgcgtcg 239 |||||||||||||||||||| Sbjct: 68826 ccggcgccggcgccgcgtcg 68845 >gi|21987524|gb|BQ779052.1|BQ779052 946116E10.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 658 Score = 38.2 bits (19), Expect = 1.7 Identities = 22/23 (95%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgtcgacg 242 ||||||||||||||||| ||||| Sbjct: 32 ccggcgccggcgccgcggcgacg 10 >gi|60343489|gb|DN210462.1|DN210462 MEST898_D07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 696 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 632 ccggctggccgtcggccgg 650 >gi|60348079|gb|DN215052.1|DN215052 MEST906_A12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 690 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 633 ccggctggccgtcggccgg 651 >gi|60355586|gb|DN222559.1|DN222559 MEST1129_D12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 759 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 620 ccggctggccgtcggccgg 638 >gi|60358424|gb|DN225397.1|DN225397 MEST1174_F02.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 682 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 630 ccggctggccgtcggccgg 648 >gi|71313724|gb|DR793451.1|DR793451 ZM_BFb0013L13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 829 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 613 ccggctggccgtcggccgg 631 >gi|71429079|gb|DR810129.1|DR810129 ZM_BFb0037K14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 598 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 231 gccgcgtcgacggtgacgg 249 ||||||||||||||||||| Sbjct: 204 gccgcgtcgacggtgacgg 222 >gi|76923577|gb|DV169556.1|DV169556 ZM_BFb0168L09.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 724 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 613 ccggctggccgtcggccgg 631 >gi|78086501|gb|DV514894.1|DV514894 ZM_BFb0197D20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 735 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 613 ccggctggccgtcggccgg 631 >gi|78086502|gb|DV514895.1|DV514895 ZM_BFb0197D20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 846 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 623 ccggctggccgtcggccgg 605 >gi|78120748|gb|DV539132.1|DV539132 ZM_BFb0232N15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 769 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 613 ccggctggccgtcggccgg 631 >gi|21206645|gb|AY103567.1| Zea mays PCO116252 mRNA sequence Length = 3135 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 2486 ccggctggccgtcggccgg 2468 >gi|21206645|gb|AY103567.1| Zea mays PCO116252 mRNA sequence Length = 3135 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 355 ccggctggccgtcggccgg 373 ||||||||||||||||||| Sbjct: 2486 ccggctggccgtcggccgg 2468 >gi|17082476|gb|AF391808.2| Zea mays chromosome 9S bz genomic region strain McC Length = 226001 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 734 ttggagacttggagtagca 752 ||||||||||||||||||| Sbjct: 625 ttggagacttggagtagca 607 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 196815 gccggcggcgagggcgcc 196798 >gi|93004174|gb|AC185503.1| Zea mays chromosome 4 clone CH201-287F7; ZMMBBc0287F07, *** SEQUENCING IN PROGRESS ***, 24 unordered pieces Length = 177688 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 732 tgttggagacttggagtag 750 ||||||||||||||||||| Sbjct: 32113 tgttggagacttggagtag 32095 >gi|90659929|gb|AC183966.1| Zea mays chromosome UNK clone ZMMBBb-570B5; ZMMBBb0570B05, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 119567 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgaggg 382 ||||||||||||||||||| Sbjct: 101146 cgtcggccggcggcgaggg 101164 >gi|58082382|gb|AC155522.2| Zea mays strain B73 clone ZMMBBc0113E06, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 169763 Score = 38.2 bits (19), Expect = 1.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgaggg 382 ||||||||||||||||||| Sbjct: 141184 cgtcggccggcggcgaggg 141202 >gi|3157222|gb|AA979844.1|AA979844 MEST2-C3.TW1412.Seq ISUM2 Zea mays cDNA clone MEST2-C3 5', mRNA sequence Length = 589 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 143 cccggcgccggcgccgcg 160 >gi|8368955|gb|BE051900.1|BE051900 za89g09.g50 Maize Glume cDNAs Library Zea mays cDNA clone za89g09 5', mRNA sequence Length = 473 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 153 gccggcggcgagggcgcc 136 >gi|8577276|gb|BE129913.1|BE129913 945032F10.X1 945 - Mixed adult tissues from Walbot lab, same as 707 (SK) Zea mays cDNA, mRNA sequence Length = 580 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 543 gccggcggcgagggcgcc 526 >gi|13149756|gb|BG320078.1|BG320078 Zm03_01c11_A Zm03_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm03_01c11, mRNA sequence Length = 723 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 451 ggcggcccgggaaggccc 468 |||||||||||||||||| Sbjct: 378 ggcggcccgggaaggccc 361 >gi|13149824|gb|BG320146.1|BG320146 Zm03_04g08_A Zm03_AAFC_ECORC_cold_stressed_maize_seedlings Zea mays cDNA clone Zm03_04g08, mRNA sequence Length = 405 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 367 cggccggcggcgagggcg 384 |||||||||||||||||| Sbjct: 257 cggccggcggcgagggcg 274 >gi|13198723|gb|BG354525.1|BG354525 947038E01.y1 947 - 2 week shoot from Barkan lab Zea mays cDNA, mRNA sequence Length = 484 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 207 ccggcggcgagggcgcca 224 >gi|14204094|gb|BG837771.1|BG837771 Zm10_06a10_A Zm10_AAFC_ECORC_Fusarium_graminearum_corn_silk Zea mays cDNA clone Zm10_06a10, mRNA sequence Length = 948 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 504 gccggcggcgagggcgcc 487 >gi|15082857|gb|BI389541.1|BI389541 949062G08.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 515 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 464 ccggcggcgagggcgcca 447 >gi|15209102|gb|BI430986.1|BI430986 949063G08.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 522 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 140 ccggcggcgagggcgcca 157 >gi|15353079|gb|BI502690.1|BI502690 949074H03.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 610 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 547 ccggcggcgagggcgcca 530 >gi|15427120|gb|BI542942.1|BI542942 949074H03.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 560 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 495 ccggcggcgagggcgcca 478 >gi|15427334|gb|BI543156.1|BI543156 949074H03.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 560 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 171 ccggcggcgagggcgcca 188 >gi|15499556|gb|BI596069.1|BI596069 949077A10.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 505 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 395 cccggcgccggcgccgcg 412 >gi|15590400|gb|BI675016.1|BI675016 949077A10.y2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 324 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 213 cccggcgccggcgccgcg 230 >gi|16379109|gb|BI992757.1|BI992757 1020067F09.x3 1020 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 623 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 559 ccggcggcgagggcgcca 542 >gi|19437165|gb|BM953575.1|BM953575 952063H10.y1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 549 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 123 aacccggcgccggcgccg 106 >gi|22490856|gb|BU050779.1|BU050779 1111033E12.y1 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 535 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 101 aacccggcgccggcgccg 84 >gi|22491113|gb|BU051036.1|BU051036 1111037F07.y2 1111 - Unigene III from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 457 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 101 aacccggcgccggcgccg 84 >gi|22935623|gb|BU571898.1|BU571898 946166B02.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 660 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 234 cccggcgccggcgccgcg 251 >gi|26558852|gb|CA831087.1|CA831087 1117015D05.y1 1117 - Unigene V from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 568 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 203 cccggcgccggcgccgcg 220 >gi|26559588|gb|CA831823.1|CA831823 1117024B10.y1 1117 - Unigene V from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 628 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 204 cccggcgccggcgccgcg 221 >gi|31351194|gb|CD435551.1|CD435551 EL01N0362E02.b Endosperm_3 Zea mays cDNA, mRNA sequence Length = 773 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 367 cggccggcggcgagggcg 384 |||||||||||||||||| Sbjct: 606 cggccggcggcgagggcg 623 >gi|31353663|gb|CD438020.1|CD438020 EL01N0508C08.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 881 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 154 cccggcgccggcgccgcg 137 >gi|31910964|gb|CD651687.1|CD651687 3529_1_135_1_G03.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 631 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 399 cccggcgccggcgccgcg 382 >gi|31998266|gb|CD662001.1|CD662001 3529_1_135_1_G03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 491 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 428 cccggcgccggcgccgcg 445 >gi|32789985|gb|CD942221.1|CD942221 RBP_85 GeneTag1 Zea mays cDNA, mRNA sequence Length = 369 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 337 ccggcggcgagggcgcca 320 >gi|32801099|gb|CD953335.1|CD953335 SBH_238 GeneTag2 Zea mays cDNA, mRNA sequence Length = 369 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 33 ccggcggcgagggcgcca 50 >gi|32803528|gb|CD955764.1|CD955764 SBX_203 GeneTag2 Zea mays cDNA, mRNA sequence Length = 331 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 33 ccggcggcgagggcgcca 50 >gi|32803568|gb|CD955804.1|CD955804 SBX_32 GeneTag2 Zea mays cDNA, mRNA sequence Length = 369 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 33 ccggcggcgagggcgcca 50 >gi|33467062|gb|CF244111.1|CF244111 3530_1_26_1_G07.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 665 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 621 gccgagggcgtggagcag 638 >gi|33467464|gb|CF244513.1|CF244513 3530_1_2_1_F09.y_2 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 514 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 151 cccggcgccggcgccgcg 134 >gi|37373650|gb|CF623134.1|CF623134 zmrws05_0A10-004-c11.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 519 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 91 cccggcgccggcgccgcg 74 >gi|37376584|gb|CF624834.1|CF624834 zmrws05_0A20-009-h02.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 382 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 91 cccggcgccggcgccgcg 74 >gi|37377784|gb|CF625530.1|CF625530 zmrws05_0A21-002-a02.s0 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 518 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 91 cccggcgccggcgccgcg 74 >gi|37386145|gb|CF630249.1|CF630249 zmrws48_0A20-010-f04.s0 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 511 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 91 cccggcgccggcgccgcg 74 >gi|37418142|gb|CF646735.1|CF646735 3530_1_32_1_C06.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 283 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 178 gccggcggcgagggcgcc 161 >gi|38688211|gb|CK145242.1|CK145242 3530_1_16_1_E07.y_11 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 241 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 209 ccggcggcgagggcgcca 226 >gi|40334024|gb|CK368094.1|CK368094 zmrws055_0A11-004-c11.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 518 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 436 cccggcgccggcgccgcg 453 >gi|50326598|gb|CO521724.1|CO521724 3530_1_143_1_D11.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 722 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 630 gccgagggcgtggagcag 647 >gi|50337455|gb|CO532581.1|CO532581 3530_1_214_1_D07.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 661 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 176 gccggcggcgagggcgcc 159 >gi|50338366|gb|CO533492.1|CO533492 3530_1_220_1_D02.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 747 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 481 gccgagggcgtggagcag 498 >gi|60340978|gb|DN207951.1|DN207951 MEST862_B06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 656 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 428 cccggcgccggcgccgcg 411 >gi|60347391|gb|DN214364.1|DN214364 MEST997_A12.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 652 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 492 ccggcggcgagggcgcca 475 >gi|60347788|gb|DN214761.1|DN214761 MEST890_F02.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 598 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 442 cccggcgccggcgccgcg 459 >gi|60348827|gb|DN215800.1|DN215800 MEST987_G09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 499 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 424 cccggcgccggcgccgcg 407 >gi|67031559|gb|CO460308.1|CO460308 MZCCL15024H01.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 810 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 170 cttgaactttctgacatt 187 |||||||||||||||||| Sbjct: 475 cttgaactttctgacatt 492 >gi|71312702|gb|DR792875.1|DR792875 ZM_BFb0012O08.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 847 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 123 aacccggcgccggcgccg 106 >gi|71323651|gb|DR798502.1|DR798502 ZM_BFb0021A21.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 826 Score = 36.2 bits (18), Expect = 6.6 Identities = 30/34 (88%) Strand = Plus / Plus Query: 263 gtacactaacatgttcgacgcgatcgtggacgcg 296 |||||| ||| ||||||||||||| |||||||| Sbjct: 286 gtacacgaacgtgttcgacgcgatgctggacgcg 319 >gi|71326992|gb|DR800146.1|DR800146 ZM_BFb0023G13.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 758 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 186 gccggcggcgagggcgcc 169 >gi|71329566|gb|DR801503.1|DR801503 ZM_BFb0025F17.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 699 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 525 acccggcgccggcgccgc 542 >gi|71429696|gb|DR810746.1|DR810746 ZM_BFb0038K03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 793 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 654 gccggcggcgagggcgcc 637 >gi|71434039|gb|DR815089.1|DR815089 ZM_BFb0045B04.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 516 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 733 gttggagacttggagtag 750 |||||||||||||||||| Sbjct: 322 gttggagacttggagtag 305 >gi|71436607|gb|DR817657.1|DR817657 ZM_BFb0051E17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 477 Score = 36.2 bits (18), Expect = 6.6 Identities = 21/22 (95%) Strand = Plus / Plus Query: 263 gtacactaacatgttcgacgcg 284 |||||| ||||||||||||||| Sbjct: 264 gtacaccaacatgttcgacgcg 285 >gi|71437089|gb|DR818139.1|DR818139 ZM_BFb0052K04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 826 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 651 cccggcgccggcgccgcg 668 >gi|71440719|gb|DR821769.1|DR821769 ZM_BFb0061G11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 777 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 162 gccggcggcgagggcgcc 145 >gi|71442670|gb|DR823720.1|DR823720 ZM_BFb0064P19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 729 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 372 acccggcgccggcgccgc 389 >gi|71449300|gb|DR830350.1|DR830350 ZM_BFb0078A17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 772 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 657 gccggcggcgagggcgcc 640 >gi|71758939|gb|DR956876.1|DR956876 ZM_BFb0054L13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 712 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 604 gccgagggcgtggagcag 621 >gi|71761734|gb|DR959671.1|DR959671 ZM_BFb0072C23.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 748 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Minus Query: 345 gtgtcggagaccggctggccgtcggc 370 ||||| |||||||| ||||||||||| Sbjct: 708 gtgtctgagaccgggtggccgtcggc 683 >gi|71764340|gb|DR962277.1|DR962277 ZM_BFb0080L02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 843 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggc 370 ||||| |||||||| ||||||||||| Sbjct: 801 gtgtctgagaccgggtggccgtcggc 826 >gi|71766501|gb|DR964438.1|DR964438 ZM_BFb0083N22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 770 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 176 gccggcggcgagggcgcc 159 >gi|71770974|gb|DR968911.1|DR968911 ZM_BFb0090G20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 822 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 163 gccggcggcgagggcgcc 146 >gi|74237769|gb|DT645683.1|DT645683 ZM_BFb0105N02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 526 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 69 gccgagggcgtggagcag 52 >gi|74241742|gb|DT649656.1|DT649656 ZM_BFb0112I08.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 755 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 733 gttggagacttggagtag 750 |||||||||||||||||| Sbjct: 322 gttggagacttggagtag 305 >gi|74244014|gb|DT651928.1|DT651928 ZM_BFb0116H10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 819 Score = 36.2 bits (18), Expect = 6.6 Identities = 24/26 (92%) Strand = Plus / Plus Query: 345 gtgtcggagaccggctggccgtcggc 370 ||||| |||||||| ||||||||||| Sbjct: 337 gtgtctgagaccgggtggccgtcggc 362 >gi|74245503|gb|DT653417.1|DT653417 ZM_BFb0125B07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 724 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 410 acccggcgccggcgccgc 393 >gi|74246410|gb|DT654324.1|DT654324 ZM_BFb0127L13.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 792 Score = 36.2 bits (18), Expect = 6.6 Identities = 21/22 (95%) Strand = Plus / Plus Query: 263 gtacactaacatgttcgacgcg 284 |||||| ||||||||||||||| Sbjct: 426 gtacaccaacatgttcgacgcg 447 >gi|76011448|gb|DT938618.1|DT938618 ZM_BFb0120C15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 823 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 169 gccggcggcgagggcgcc 152 >gi|76016531|gb|DT943701.1|DT943701 ZM_BFb0129M06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 787 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 692 gccggcggcgagggcgcc 709 >gi|76020474|gb|DT947644.1|DT947644 ZM_BFb0135P02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 741 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 192 cccggcgccggcgccgcg 175 >gi|76287442|gb|DV027010.1|DV027010 ZM_BFb0148E12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 773 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 540 gccgagggcgtggagcag 557 >gi|76289280|gb|DV028848.1|DV028848 ZM_BFb0151A07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 851 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 186 gccggcggcgagggcgcc 169 >gi|76293760|gb|DV033328.1|DV033328 ZM_BFb0157I06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 778 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 186 gccggcggcgagggcgcc 169 >gi|76909823|gb|DV163555.1|DV163555 ZM_BFb0159J18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 715 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 157 cccggcgccggcgccgcg 140 >gi|76921697|gb|DV168656.1|DV168656 ZM_BFb0167G06.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 645 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 602 gccgagggcgtggagcag 619 >gi|76922201|gb|DV168898.1|DV168898 ZM_BFb0167L18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 808 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgt 237 |||||||||||||||||| Sbjct: 121 ccggcgccggcgccgcgt 104 >gi|76924407|gb|DV169938.1|DV169938 ZM_BFb0169E03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 896 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 503 gccgagggcgtggagcag 486 >gi|76926393|gb|DV170839.1|DV170839 ZM_BFb0170L10.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 728 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 173 cccggcgccggcgccgcg 156 >gi|76935004|gb|DV174130.1|DV174130 ZM_BFb0177J01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 756 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 657 gccggcggcgagggcgcc 640 >gi|78083744|gb|DV512137.1|DV512137 ZM_BFb0192K17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 846 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 236 cccggcgccggcgccgcg 219 >gi|78084582|gb|DV512975.1|DV512975 ZM_BFb0193O06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 797 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 654 gccggcggcgagggcgcc 637 >gi|78088238|gb|DV516631.1|DV516631 ZM_BFb0199M24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 862 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 145 gccggcggcgagggcgcc 128 >gi|78089932|gb|DV518306.1|DV518306 ZM_BFb0202E03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 751 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 657 gccggcggcgagggcgcc 640 >gi|78104285|gb|DV522703.1|DV522703 ZM_BFb0208J12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 604 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 177 gccggcggcgagggcgcc 160 >gi|78111348|gb|DV529745.1|DV529745 ZM_BFb0218M04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 668 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 654 gccggcggcgagggcgcc 637 >gi|78112087|gb|DV530483.1|DV530483 ZM_BFb0220E14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 742 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 169 gccggcggcgagggcgcc 152 >gi|78118598|gb|DV536982.1|DV536982 ZM_BFb0229L09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 802 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 184 gccggcggcgagggcgcc 167 >gi|78123473|gb|DV541857.1|DV541857 ZM_BFb0236M15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 746 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 597 gccgagggcgtggagcag 614 >gi|78180583|gb|DV550911.1|DV550911 1000077-C03.GAD10-F UGI-Reseq Zea mays cDNA, mRNA sequence Length = 720 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 575 gccggcggcgagggcgcc 558 >gi|83279146|gb|DV943154.1|DV943154 1000142-H09.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 526 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 733 gttggagacttggagtag 750 |||||||||||||||||| Sbjct: 337 gttggagacttggagtag 320 >gi|86466478|gb|DY232848.1|DY232848 ZM_BFb0242C20.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 745 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 477 gccgagggcgtggagcag 494 >gi|86466975|gb|DY233345.1|DY233345 ZM_BFb0242N24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 546 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 184 gccggcggcgagggcgcc 167 >gi|86469574|gb|DY235944.1|DY235944 ZM_BFb0246O20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 619 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 169 gccggcggcgagggcgcc 152 >gi|86471303|gb|DY237673.1|DY237673 ZM_BFb0254P12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 424 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 232 acccggcgccggcgccgc 249 >gi|86474342|gb|DY240712.1|DY240712 ZM_BFb0260I07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 623 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 604 gccggcggcgagggcgcc 621 >gi|86475273|gb|DY241643.1|DY241643 ZM_BFb0262F03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 613 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 177 gccggcggcgagggcgcc 160 >gi|87152637|gb|DY397426.1|DY397426 III-952-10A-F07.M13-R UGIII-Reseq Zea mays cDNA, mRNA sequence Length = 655 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 86 aacccggcgccggcgccg 69 >gi|87152122|gb|DY396911.1|DY396911 III-952-9A-E12.M13-R UGIII-Reseq Zea mays cDNA, mRNA sequence Length = 654 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 aacccggcgccggcgccg 234 |||||||||||||||||| Sbjct: 86 aacccggcgccggcgccg 69 >gi|87157247|gb|DY402036.1|DY402036 V-946-6C-B10.Gal4-R UGV-Reseq Zea mays cDNA, mRNA sequence Length = 613 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 187 cccggcgccggcgccgcg 204 >gi|87157333|gb|DY402122.1|DY402122 V-946-4D-D05.Gal4-R UGV-Reseq Zea mays cDNA, mRNA sequence Length = 423 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 187 cccggcgccggcgccgcg 204 >gi|88757966|gb|DY542107.1|DY542107 ZM_BFb0367H15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 822 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 658 gccggcggcgagggcgcc 641 >gi|89756359|gb|DY686409.1|DY686409 ZM_BFb0274O03.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 715 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 176 gccggcggcgagggcgcc 159 >gi|89756703|gb|DY686637.1|DY686637 ZM_BFb0275I23.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 358 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 146 gccggcggcgagggcgcc 129 >gi|91052622|gb|EB163040.1|EB163040 ZM_BFb0303M19.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 612 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 429 cacgtcgacggcggcacc 446 |||||||||||||||||| Sbjct: 301 cacgtcgacggcggcacc 318 >gi|91874924|gb|EB404881.1|EB404881 ZM_BFb0314H18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 617 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 286 ccggcggcgagggcgcca 303 >gi|91877742|gb|EB407699.1|EB407699 ZM_BFb0320B15.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 682 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 554 gccgagggcgtggagcag 571 >gi|93011776|gb|EB637296.1|EB637296 ZM_BFb0322J07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 664 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 510 gccgagggcgtggagcag 527 |||||||||||||||||| Sbjct: 535 gccgagggcgtggagcag 552 >gi|93012228|gb|EB637748.1|EB637748 ZM_BFb0324A06.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 767 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 657 gccggcggcgagggcgcc 640 >gi|500852|gb|L33913.1|MZEAKHDA Zea mays (clone pAKHSDH2) aspartate kinase-homoserine dehydrogenase mRNA, complete cds Length = 3045 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 170 cttgaactttctgacatt 187 |||||||||||||||||| Sbjct: 2408 cttgaactttctgacatt 2425 >gi|517257|emb|X66076.1|ZMMNB1A Z.mays MNB1a mRNA for DNA-binding protein Length = 1225 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgt 237 |||||||||||||||||| Sbjct: 204 ccggcgccggcgccgcgt 187 >gi|54651557|gb|BT016776.1| Zea mays clone Contig609 mRNA sequence Length = 1943 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 367 cggccggcggcgagggcg 384 |||||||||||||||||| Sbjct: 1022 cggccggcggcgagggcg 1039 >gi|58866284|gb|AY850138.1| Zea mays senescence-inducible chloroplast stay-green protein 1 (SGR1) mRNA, complete cds; nuclear gene for chloroplast product Length = 1406 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 543 acccggcgccggcgccgc 560 >gi|21209341|gb|AY106263.1| Zea mays PCO149364 mRNA sequence Length = 422 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 341 cccggcgccggcgccgcg 358 >gi|21210247|gb|AY107169.1| Zea mays PCO151038 mRNA sequence Length = 806 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 213 gccggcggcgagggcgcc 196 >gi|21215928|gb|AY111338.1| Zea mays CL2352_-1 mRNA sequence Length = 3045 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 170 cttgaactttctgacatt 187 |||||||||||||||||| Sbjct: 2408 cttgaactttctgacatt 2425 >gi|71159403|gb|AY108158.2| Zea mays PCO072790 mRNA sequence Length = 836 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 264 ccggcggcgagggcgcca 281 >gi|517257|emb|X66076.1|ZMMNB1A Z.mays MNB1a mRNA for DNA-binding protein Length = 1225 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgt 237 |||||||||||||||||| Sbjct: 204 ccggcgccggcgccgcgt 187 >gi|500852|gb|L33913.1|MZEAKHDA Zea mays (clone pAKHSDH2) aspartate kinase-homoserine dehydrogenase mRNA, complete cds Length = 3045 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 170 cttgaactttctgacatt 187 |||||||||||||||||| Sbjct: 2408 cttgaactttctgacatt 2425 >gi|83957658|dbj|DD159361.1| A potato having enhanced starch content per plant and a method of producing the same Length = 717 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 220 ccggcgccggcgccgcgt 237 |||||||||||||||||| Sbjct: 118 ccggcgccggcgccgcgt 101 >gi|54651557|gb|BT016776.1| Zea mays clone Contig609 mRNA sequence Length = 1943 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 367 cggccggcggcgagggcg 384 |||||||||||||||||| Sbjct: 1022 cggccggcggcgagggcg 1039 >gi|58866284|gb|AY850138.1| Zea mays senescence-inducible chloroplast stay-green protein 1 (SGR1) mRNA, complete cds; nuclear gene for chloroplast product Length = 1406 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 543 acccggcgccggcgccgc 560 >gi|55741096|gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence Length = 405672 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 155677 cccggcgccggcgccgcg 155660 >gi|55741072|gb|AY664416.1| Zea mays cultivar Mo17 locus bz, complete sequence Length = 203581 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 67068 gccggcggcgagggcgcc 67051 >gi|55741054|gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence Length = 323584 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 143741 cccggcgccggcgccgcg 143724 >gi|21215928|gb|AY111338.1| Zea mays CL2352_-1 mRNA sequence Length = 3045 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 170 cttgaactttctgacatt 187 |||||||||||||||||| Sbjct: 2408 cttgaactttctgacatt 2425 >gi|71159403|gb|AY108158.2| Zea mays PCO072790 mRNA sequence Length = 836 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 370 ccggcggcgagggcgcca 387 |||||||||||||||||| Sbjct: 264 ccggcggcgagggcgcca 281 >gi|21210247|gb|AY107169.1| Zea mays PCO151038 mRNA sequence Length = 806 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 213 gccggcggcgagggcgcc 196 >gi|21209341|gb|AY106263.1| Zea mays PCO149364 mRNA sequence Length = 422 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 341 cccggcgccggcgccgcg 358 >gi|29162697|emb|AX660933.1| Sequence 1290 from Patent WO03000906 Length = 399 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 198 cccggcgccggcgccgcg 215 >gi|18092333|gb|AF448416.1| Zea mays B73 chromosome 9S bz genomic region Length = 106186 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 369 gccggcggcgagggcgcc 386 |||||||||||||||||| Sbjct: 78434 gccggcggcgagggcgcc 78417 >gi|93004171|gb|AC185500.1| Zea mays chromosome 3 clone CH201-528O18; ZMMBBc0528O18, *** SEQUENCING IN PROGRESS ***, 21 unordered pieces Length = 183134 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 218 acccggcgccggcgccgc 235 |||||||||||||||||| Sbjct: 170609 acccggcgccggcgccgc 170626 >gi|92900759|gb|AC185469.1| Zea mays chromosome 4 clone CH201-272M16; ZMMBBc0272M16, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 185766 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 130656 cgtcggccggcggcgagg 130673 >gi|92110181|gb|AC185318.1| Zea mays chromosome UNK clone CH201-5O9; ZMMBBc0005O09, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 196162 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 671 cttcatcggagctgctcg 688 |||||||||||||||||| Sbjct: 186000 cttcatcggagctgctcg 185983 >gi|91982798|gb|AC185254.1| Zea mays chromosome UNK clone CH201-418N20; ZMMBBc0418N20, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 173633 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 238 cgacggtgacggacggcg 255 |||||||||||||||||| Sbjct: 84076 cgacggtgacggacggcg 84059 >gi|91630512|gb|AC185125.1| Zea mays chromosome UNK clone CH201-334C16; ZMMBBc0334C16, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 189249 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 56058 cgtcggccggcggcgagg 56041 >gi|90855892|gb|AC184141.1| Zea mays chromosome UNK clone CH201-176H2; ZMMBBc0176H02, *** SEQUENCING IN PROGRESS ***, 24 unordered pieces Length = 194078 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 57708 cgtcggccggcggcgagg 57725 >gi|89274339|gb|AC182818.2| Zea mays chromosome UNK clone ZMMBBb-533H21; ZMMBBb0533H21, *** SEQUENCING IN PROGRESS ***, 2 unordered pieces Length = 141036 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 116663 cgtcggccggcggcgagg 116680 >gi|89274337|gb|AC182438.3| Zea mays chromosome UNK clone ZMMBBb-594O8; ZMMBBb0594O08, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 140772 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 126191 cgtcggccggcggcgagg 126208 >gi|89257788|gb|AC177911.2| Zea mays chromosome UNK clone CH201-151F11; ZMMBBc0151F11, *** SEQUENCING IN PROGRESS ***, 4 unordered pieces Length = 173742 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 165425 cccggcgccggcgccgcg 165408 >gi|89257779|gb|AC177900.2| Zea mays chromosome UNK clone CH201-187O10; ZMMBBc0187O10, *** SEQUENCING IN PROGRESS ***, 4 unordered pieces Length = 181850 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 733 gttggagacttggagtag 750 |||||||||||||||||| Sbjct: 12647 gttggagacttggagtag 12664 >gi|89257732|gb|AC177860.2| Zea mays chromosome UNK clone CH201-392J6; ZMMBBc0392J06, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces Length = 200939 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 29940 cgtcggccggcggcgagg 29957 >gi|85861337|gb|AC177827.1| Zea mays chromosome UNK clone CH201-270F23; ZMMBBc0270F23, *** SEQUENCING IN PROGRESS ***, 19 unordered pieces Length = 208731 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 219 cccggcgccggcgccgcg 236 |||||||||||||||||| Sbjct: 42207 cccggcgccggcgccgcg 42190 >gi|58082478|gb|AC155619.2| Zea mays strain B73 clone ZMMBBc0347P15, *** SEQUENCING IN PROGRESS ***, 30 unordered pieces Length = 204462 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 13144 cgtcggccggcggcgagg 13127 >gi|58082446|gb|AC155587.2| Zea mays strain B73 clone ZMMBBc0199C24, *** SEQUENCING IN PROGRESS ***, 34 unordered pieces Length = 197225 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 143190 cgtcggccggcggcgagg 143207 >gi|58082434|gb|AC155575.2| Zea mays strain B73 clone ZMMBBc0180B04, *** SEQUENCING IN PROGRESS ***, 37 unordered pieces Length = 164241 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 3979 cgtcggccggcggcgagg 3996 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 3961 cgtcggccggcggcgagg 3978 >gi|48762560|gb|AC148179.4| Zea mays clone ZMMBBb0356A09, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces Length = 141469 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 364 cgtcggccggcggcgagg 381 |||||||||||||||||| Sbjct: 12917 cgtcggccggcggcgagg 12934 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 457,542 Number of Sequences: 836351 Number of extensions: 457542 Number of successful extensions: 52155 Number of sequences better than 10.0: 252 Number of HSP's better than 10.0 without gapping: 252 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51529 Number of HSP's gapped (non-prelim): 624 length of query: 807 length of database: 669,372,029 effective HSP length: 19 effective length of query: 788 effective length of database: 653,481,360 effective search space: 514943311680 effective search space used: 514943311680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)