BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 131612.2.1 (620 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|4967097|gb|AI692047.1|AI692047 606010E12.x1 606 - Ear tissue ... 761 0.0 gi|60354730|gb|DN221703.1|DN221703 MEST1117_C06.T7-1 UGA-ZmSAM-X... 761 0.0 gi|67019916|gb|CO448665.1|CO448665 MZCCL10121E11.g Maize Endospe... 755 0.0 gi|67024132|gb|CO452881.1|CO452881 MZCCL10186H12.g Maize Endospe... 747 0.0 gi|6022506|gb|AW067539.1|AW067539 660013H01.y1 660 - Mixed stage... 418 e-115 gi|21331325|gb|BQ486706.1|BQ486706 1091047E03.x1 1091 - Immature... 418 e-115 gi|32943507|gb|CF048326.1|CF048326 QCL1h08.yg QCL Zea mays cDNA ... 418 e-115 gi|60337899|gb|DN204872.1|DN204872 MEST810_H10.T7-1 UGA-ZmSAM-XZ... 418 e-115 gi|60345870|gb|DN212843.1|DN212843 MEST949_H01.T7-1 UGA-ZmSAM-XZ... 418 e-115 gi|78544553|gb|DV622051.1|DV622051 IV-1091-405D-D09.T7-1 UGIV-10... 418 e-115 gi|88753328|gb|DY537469.1|DY537469 ZM_BFb0273E05.f ZM_BFb Zea ma... 418 e-115 gi|21211285|gb|AY108207.1| Zea mays PCO082315 mRNA sequence 418 e-115 gi|21211285|gb|AY108207.1| Zea mays PCO082315 mRNA sequence 418 e-115 gi|76020497|gb|DT947667.1|DT947667 ZM_BFb0136A11.f ZM_BFb Zea ma... 402 e-110 gi|37386992|gb|CF630688.1|CF630688 zmrws48_0A20-015-f03.s1 zmrws... 387 e-105 gi|32851032|gb|CD990713.1|CD990713 QAY3d12.yg QAY Zea mays cDNA ... 385 e-105 gi|681840|gb|T70692.1|T70692 86 vegetative meristem Zea mays cDN... 381 e-104 gi|32934152|gb|CF038964.1|CF038964 QCH30a08.yg QCH Zea mays cDNA... 343 2e-92 gi|32936240|gb|CF041052.1|CF041052 QCI21c02.yg QCI Zea mays cDNA... 289 2e-76 gi|9254838|gb|BE345306.1|BE345306 946034A06.y1 946 - tassel prim... 262 5e-68 gi|32807351|gb|CD959585.1|CD959585 SCW_221 GeneTag2 Zea mays cDN... 208 6e-52 gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence 206 2e-51 gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence 206 2e-51 gi|4572834|gb|AI586483.1|AI586483 486051G06.x2 486 - leaf primor... 204 1e-50 gi|32912691|gb|CF017503.1|CF017503 QBM25a06.xg QBM Zea mays cDNA... 202 4e-50 gi|32912752|gb|CF017564.1|CF017564 QBM25h05.xg QBM Zea mays cDNA... 202 4e-50 gi|83279419|gb|DV943427.1|DV943427 1000137-B06.T7-1 UGI-Reseq Ze... 198 6e-49 gi|4609560|gb|AI600399.1|AI600399 486071A05.x2 486 - leaf primor... 163 3e-38 gi|61117946|gb|DN558907.1|DN558907 E5-H06-T3 E7PCR Zea mays cDNA... 157 2e-36 gi|61117944|gb|DN558905.1|DN558905 ME16-D06-T3-96-R1 E7PCR Zea m... 153 3e-35 gi|61117945|gb|DN558906.1|DN558906 ME22-E03-T3-96-R1 E7PCR Zea m... 153 3e-35 gi|61117947|gb|DN558908.1|DN558908 ME24-D06-T3-96-R1 E7PCR Zea m... 151 1e-34 gi|12971941|gb|BG267734.1|BG267734 1000137B06.x2 1000 - Unigene ... 109 4e-22 gi|32830788|gb|CD970466.1|CD970466 QAD17g06.sg QAD Zea mays cDNA... 92 1e-16 gi|32831815|gb|CD971493.1|CD971493 QAD9f04.sg QAD Zea mays cDNA ... 92 1e-16 gi|5670945|gb|AI932208.1|AI932208 618029G11.x1 618 - Inbred Tass... 68 1e-09 gi|60345589|gb|DN212562.1|DN212562 MEST942_C06.T7-1 UGA-ZmSAM-XZ... 68 1e-09 gi|88687866|gb|AC182833.1| Zea mays chromosome UNK clone CH201-1... 66 6e-09 gi|24462506|gb|BM660037.1|BM660037 EST0044 Zea mays sperm cell c... 54 2e-05 gi|88687856|gb|AC182823.1| Zea mays chromosome UNK clone CH201-2... 50 3e-04 gi|85861441|gb|AC177931.1| Zea mays chromosome UNK clone CH201-1... 50 3e-04 gi|5499430|gb|AI855297.1|AI855297 603014A03.x1 603 - stressed ro... 48 0.001 gi|67014266|gb|CO443015.1|CO443015 MZCCL10058G03.g Maize Endospe... 48 0.001 gi|67014856|gb|CO443605.1|CO443605 MZCCL10047D09.g Maize Endospe... 48 0.001 gi|67019808|gb|CO448557.1|CO448557 MZCCL10122B12.g Maize Endospe... 48 0.001 gi|78021197|gb|DV489584.1|DV489584 1000126-D06.T7-1 UGI-Reseq Ze... 48 0.001 gi|91050139|gb|EB160557.1|EB160557 ZM_BFb0298I11.r ZM_BFb Zea ma... 48 0.001 gi|58082325|gb|AC155464.2| Zea mays strain B73 clone ZMMBBb0518C... 48 0.001 gi|5650234|gb|AI920594.1|AI920594 618016A09.x1 618 - Inbred Tass... 46 0.005 gi|5847010|gb|AW000089.1|AW000089 614057D01.x1 614 - root cDNA l... 46 0.005 gi|6526773|gb|AW216052.1|AW216052 687050H06.x1 687 - Early embry... 46 0.005 gi|9732693|gb|BE511445.1|BE511445 946060H07.y1 946 - tassel prim... 46 0.005 gi|32796874|gb|CD949110.1|CD949110 SAJ_144 GeneTag2 Zea mays cDN... 46 0.005 gi|32837612|gb|CD977290.1|CD977290 QAF28f04.yg QAF Zea mays cDNA... 46 0.005 gi|32838544|gb|CD978222.1|CD978222 QAF40e05.yg QAF Zea mays cDNA... 46 0.005 gi|32849812|gb|CD989493.1|CD989493 QAT2e12.yg QAT Zea mays cDNA ... 46 0.005 gi|37389477|gb|CF631959.1|CF631959 zmrws48_0B10-015-c04.s3 zmrws... 46 0.005 gi|45568321|gb|CK986009.1|CK986009 zmrsub1_0B20-009-f01.s3 zmrsu... 46 0.005 gi|60357590|gb|DN224563.1|DN224563 MEST1160_B09.T7-1 UGA-ZmSAM-X... 46 0.005 gi|60397477|gb|DN230293.1|DN230293 MEST1024_G10.T7-1 UGA-ZmSAM-X... 46 0.005 gi|67012517|gb|CO441266.1|CO441266 MZCCL10029C08.g Maize Endospe... 46 0.005 gi|67015741|gb|CO444490.1|CO444490 MZCCL10072C12.g Maize Endospe... 46 0.005 gi|78022641|gb|DV491028.1|DV491028 1000036-G05.T7-1 UGI-Reseq Ze... 46 0.005 gi|78120961|gb|DV539345.1|DV539345 ZM_BFb0233C12.f ZM_BFb Zea ma... 46 0.005 gi|84980995|gb|DW531344.1|DW531344 ZMEC_04C01 ZmEC Zea mays cDNA... 46 0.005 gi|87155610|gb|DY400399.1|DY400399 V-946-2B-F12.T7-1 UGV-Reseq Z... 46 0.005 gi|21211045|gb|AY107967.1| Zea mays PCO108952 mRNA sequence 46 0.005 gi|45673714|gb|BV134191.1| PZA00393 Zea mays ssp. parviglumis Wi... 46 0.005 gi|45673713|gb|BV134190.1| PZA00393 Zea mays ssp. parviglumis Be... 46 0.005 gi|45673712|gb|BV134189.1| PZA00393 Zea mays ssp. parviglumis Ka... 46 0.005 gi|45673711|gb|BV134188.1| PZA00393 Zea mays ssp. parviglumis Be... 46 0.005 gi|45673710|gb|BV134187.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673709|gb|BV134186.1| PZA00393 Zea mays ssp. parviglumis US... 46 0.005 gi|45673708|gb|BV134185.1| PZA00393 Zea mays ssp. parviglumis CI... 46 0.005 gi|45673707|gb|BV134184.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673706|gb|BV134183.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673705|gb|BV134182.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673704|gb|BV134181.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673703|gb|BV134180.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673702|gb|BV134179.1| PZA00393 Zea mays ssp. parviglumis CI... 46 0.005 gi|45673701|gb|BV134178.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673700|gb|BV134177.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673699|gb|BV134176.1| PZA00393 Zea mays ssp. parviglumis JS... 46 0.005 gi|45673698|gb|BV134175.1| PZA00393 Zea mays ssp. mays CML69 Zea... 46 0.005 gi|45673697|gb|BV134174.1| PZA00393 Zea mays ssp. mays CML322 Ze... 46 0.005 gi|45673696|gb|BV134173.1| PZA00393 Zea mays ssp. mays CML333 Ze... 46 0.005 gi|45673695|gb|BV134172.1| PZA00393 Zea mays ssp. mays Kul11 Zea... 46 0.005 gi|45673694|gb|BV134171.1| PZA00393 Zea mays ssp. mays Kul3 Zea ... 46 0.005 gi|45673693|gb|BV134170.1| PZA00393 Zea mays ssp. mays NC350 Zea... 46 0.005 gi|45673692|gb|BV134169.1| PZA00393 Zea mays ssp. mays CML247 Ze... 46 0.005 gi|45673691|gb|BV134168.1| PZA00393 Zea mays ssp. mays Hp301 Zea... 46 0.005 gi|45673690|gb|BV134167.1| PZA00393 Zea mays ssp. mays M37W Zea ... 46 0.005 gi|45673689|gb|BV134166.1| PZA00393 Zea mays ssp. mays Mo17(2) Z... 46 0.005 gi|45673688|gb|BV134165.1| PZA00393 Zea mays ssp. mays Mo17(1) Z... 46 0.005 gi|45673687|gb|BV134164.1| PZA00393 Zea mays ssp. mays Il14H Zea... 46 0.005 gi|45673686|gb|BV134163.1| PZA00393 Zea mays ssp. mays Oh43 Zea ... 46 0.005 gi|45673685|gb|BV134162.1| PZA00393 Zea mays ssp. mays B73(2) Ze... 46 0.005 gi|45673684|gb|BV134161.1| PZA00393 Zea mays ssp. mays B73(1) Ze... 46 0.005 gi|21211045|gb|AY107967.1| Zea mays PCO108952 mRNA sequence 46 0.005 gi|89257742|gb|AC177869.2| Zea mays chromosome UNK clone CH201-4... 46 0.005 gi|58082375|gb|AC155515.2| Zea mays strain B73 clone ZMMBBc0059O... 46 0.005 gi|50322940|gb|CO518066.1|CO518066 3530_1_117_1_G04.x_1 3530 - F... 44 0.021 gi|78118621|gb|DV537005.1|DV537005 ZM_BFb0229L22.f ZM_BFb Zea ma... 44 0.021 gi|91630513|gb|AC185126.1| Zea mays chromosome UNK clone CH201-1... 44 0.021 gi|58082380|gb|AC155520.2| Zea mays strain B73 clone ZMMBBc0111D... 44 0.021 gi|45583818|gb|BV114445.1| PZA01060 Kul11 Zea mays Kul11 Zea may... 42 0.082 gi|45583815|gb|BV114442.1| PZA01060 CML247 Zea mays CML247 Zea m... 42 0.082 gi|45583814|gb|BV114441.1| PZA01060 Hp301 Zea mays Hp301 Zea may... 42 0.082 gi|45583810|gb|BV114437.1| PZA01060 Mo17(1) Zea mays Mo17(1) Zea... 42 0.082 gi|45583809|gb|BV114436.1| PZA01060 Il14H Zea mays Il14H Zea may... 42 0.082 gi|45583807|gb|BV114434.1| PZA01060 B73(2) Zea mays B73(2) Zea m... 42 0.082 gi|37056223|gb|BV084566.1| scl284_p6 CML247 Zea mays CML247 Zea ... 42 0.082 gi|37056222|gb|BV084565.1| scl284_p6 Hp301 Zea mays Hp301 Zea ma... 42 0.082 gi|37056217|gb|BV084560.1| scl284_p6 Il14H Zea mays Il14H Zea ma... 42 0.082 gi|37056212|gb|BV084555.1| scl284_p6 Kul11 Zea mays Kul11 Zea ma... 42 0.082 gi|71446860|gb|DR827910.1|DR827910 ZM_BFb0071K11.r ZM_BFb Zea ma... 40 0.32 gi|45583819|gb|BV114446.1| PZA01060 CML333 Zea mays CML333 Zea m... 40 0.32 gi|45583808|gb|BV114435.1| PZA01060 Oh43 Zea mays Oh43 Zea mays ... 40 0.32 gi|37056215|gb|BV084558.1| scl284_p6 Oh43 Zea mays Oh43 Zea mays... 40 0.32 gi|37056214|gb|BV084557.1| scl284_p6 CML333 Zea mays CML333 Zea ... 40 0.32 gi|22545825|gb|BU098199.1|BU098199 946124F12.x1 946 - tassel pri... 38 1.3 gi|31664674|gb|CD573607.1|CD573607 3529_1_128_1_H08.y_1 3529 - 2... 38 1.3 gi|21207316|gb|AY104238.1| Zea mays PCO120536 mRNA sequence 38 1.3 gi|21207316|gb|AY104238.1| Zea mays PCO120536 mRNA sequence 38 1.3 gi|92110175|gb|AC185312.1| Zea mays chromosome UNK clone CH201-3... 38 1.3 gi|88900602|gb|AC183313.1| Zea mays chromosome UNK clone CH201-4... 38 1.3 gi|88024682|gb|AC182628.1| Zea mays chromosome UNK clone CH201-1... 38 1.3 gi|90186373|gb|AC182615.2| Zea mays chromosome UNK clone CH201-2... 38 1.3 gi|22545921|gb|BU098280.1|BU098280 946133F05.y1 946 - tassel pri... 36 5.1 gi|31353451|gb|CD437808.1|CD437808 EL01N0505D01.b Endosperm_5 Ze... 36 5.1 gi|55741096|gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, co... 36 5.1 gi|55741054|gb|AY664415.1| Zea mays cultivar B73 locus 9009, com... 36 5.1 gi|91982822|gb|AC185278.1| Zea mays chromosome UNK clone CH201-3... 36 5.1 gi|91176471|gb|AC184833.1| Zea mays chromosome UNK clone CH201-4... 36 5.1 gi|90568146|gb|AC183934.1| Zea mays chromosome UNK clone ZMMBBb-... 36 5.1 gi|90186361|gb|AC183888.1| Zea mays chromosome UNK clone ZMMBBb-... 36 5.1 gi|89257716|gb|AC177834.2| Zea mays chromosome UNK clone CH201-4... 36 5.1 gi|71725484|gb|AC166636.1| Zea mays strain B73 clone ZMMBBb0106O... 36 5.1 gi|58082381|gb|AC155521.2| Zea mays strain B73 clone ZMMBBc0111D... 36 5.1 gi|58082257|gb|AC155395.2| Zea mays strain B73 clone ZMMBBb0160F... 36 5.1 gi|57790161|gb|AC149836.2| Zea mays clone ZMMBBc0496L17, *** SEQ... 36 5.1 >gi|4967097|gb|AI692047.1|AI692047 606010E12.x1 606 - Ear tissue cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 574 Score = 761 bits (384), Expect = 0.0 Identities = 384/384 (100%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 574 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 515 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 514 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 455 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 454 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 395 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 394 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 335 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 334 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 275 Query: 301 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 274 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 215 Query: 361 caggttcagagaatattagggtcc 384 |||||||||||||||||||||||| Sbjct: 214 caggttcagagaatattagggtcc 191 Score = 224 bits (113), Expect = 1e-56 Identities = 113/113 (100%) Strand = Plus / Minus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 128 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 69 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaa 559 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 68 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaa 16 Score = 52.0 bits (26), Expect = 9e-05 Identities = 29/30 (96%) Strand = Plus / Minus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||||||||| ||||||| Sbjct: 212 ggttcagagaatattagggtccgtatgtat 183 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Minus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 129 aggttcagagaatattagggtcc 107 >gi|60354730|gb|DN221703.1|DN221703 MEST1117_C06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 605 Score = 761 bits (384), Expect = 0.0 Identities = 384/384 (100%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 490 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 431 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 430 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 371 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 370 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 311 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 310 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 251 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 250 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 191 Query: 301 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 190 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 131 Query: 361 caggttcagagaatattagggtcc 384 |||||||||||||||||||||||| Sbjct: 130 caggttcagagaatattagggtcc 107 Score = 71.9 bits (36), Expect = 9e-11 Identities = 43/44 (97%), Gaps = 1/44 (2%) Strand = Plus / Minus Query: 447 ggttcagagaatattagggt-ccctatgtatatgtatgtatcag 489 |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 44 ggttcagagaatattagggtcccctatgtatatgtatgtatcag 1 Score = 52.0 bits (26), Expect = 9e-05 Identities = 29/30 (96%) Strand = Plus / Minus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||||||||| ||||||| Sbjct: 128 ggttcagagaatattagggtccgtatgtat 99 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Minus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 45 aggttcagagaatattagggtcc 23 >gi|67019916|gb|CO448665.1|CO448665 MZCCL10121E11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 812 Score = 755 bits (381), Expect = 0.0 Identities = 383/384 (99%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 243 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 302 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 303 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 362 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 363 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 422 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 423 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 482 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 483 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 542 Query: 301 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 543 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 602 Query: 361 caggttcagagaatattagggtcc 384 |||||||||||||||||| ||||| Sbjct: 603 caggttcagagaatattanggtcc 626 Score = 226 bits (114), Expect = 3e-57 Identities = 123/125 (98%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 689 ggttcagaga-tattanggtccctatgtatatgtatgtatcaggattgctatggtctttt 747 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 748 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 807 Query: 567 actat 571 ||||| Sbjct: 808 actat 812 Score = 46.1 bits (23), Expect = 0.005 Identities = 28/30 (93%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||| ||||| ||||||| Sbjct: 605 ggttcagagaatattanggtccgtatgtat 634 >gi|67024132|gb|CO452881.1|CO452881 MZCCL10186H12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 822 Score = 747 bits (377), Expect = 0.0 Identities = 382/384 (99%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 253 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 312 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 313 aagctatcaggcctttgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 372 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 373 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 432 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 433 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 492 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagt 300 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 493 tgcagatctcccgtatcctgngaggacacaagaaagaccgagggacgcggagcaaggagt 552 Query: 301 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 553 agtagggctgctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctat 612 Query: 361 caggttcagagaatattagggtcc 384 |||||||||||||||||||||||| Sbjct: 613 caggttcagagaatattagggtcc 636 Score = 210 bits (106), Expect = 2e-52 Identities = 115/118 (97%) Strand = Plus / Plus Query: 454 agaatattagggtccctatgtatatgtatgtatcaggattgctatggtcttttggattgg 513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 704 agaatattagggtccctatgtatatgtatgtatcaggattgctatggtcttttggattgg 763 Query: 514 aagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaaactat 571 |||||||||||||||||||||||||||||| | |||||||||| |||||||||||||| Sbjct: 764 aagatctgagatttgctggtgcaatggccattttctgacatcccaatgttgaaactat 821 Score = 52.0 bits (26), Expect = 9e-05 Identities = 29/30 (96%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||||||||| ||||||| Sbjct: 615 ggttcagagaatattagggtccgtatgtat 644 >gi|6022506|gb|AW067539.1|AW067539 660013H01.y1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 594 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 62 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 121 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 122 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 181 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 182 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 241 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 242 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 301 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 302 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 352 >gi|21331325|gb|BQ486706.1|BQ486706 1091047E03.x1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 559 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 551 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 492 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 491 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 432 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 431 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 372 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 371 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 312 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 311 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 261 >gi|32943507|gb|CF048326.1|CF048326 QCL1h08.yg QCL Zea mays cDNA clone QCL1h08, mRNA sequence Length = 596 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 596 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 537 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 536 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 477 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 476 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 417 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 416 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 357 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 356 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 306 >gi|60337899|gb|DN204872.1|DN204872 MEST810_H10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 702 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 621 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 562 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 561 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 502 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 501 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 442 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 441 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 382 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 381 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 331 >gi|60345870|gb|DN212843.1|DN212843 MEST949_H01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 719 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 608 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 549 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 548 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 489 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 488 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 429 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 428 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 369 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 368 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 318 >gi|78544553|gb|DV622051.1|DV622051 IV-1091-405D-D09.T7-1 UGIV-1091-Reseq Zea mays cDNA, mRNA sequence Length = 598 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 428 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 369 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 368 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 309 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 308 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 249 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 248 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 189 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 188 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 138 >gi|88753328|gb|DY537469.1|DY537469 ZM_BFb0273E05.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 716 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 602 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 543 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 542 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 483 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 482 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 423 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 422 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 363 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 362 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 312 >gi|21211285|gb|AY108207.1| Zea mays PCO082315 mRNA sequence Length = 1199 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 595 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 654 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 655 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 714 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 715 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 774 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 775 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 834 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 835 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 885 >gi|21211285|gb|AY108207.1| Zea mays PCO082315 mRNA sequence Length = 1199 Score = 418 bits (211), Expect = e-115 Identities = 271/291 (93%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 595 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 654 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 655 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 714 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 715 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 774 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 775 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 834 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 835 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 885 >gi|76020497|gb|DT947667.1|DT947667 ZM_BFb0136A11.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 666 Score = 402 bits (203), Expect = e-110 Identities = 269/291 (92%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| ||||||||| |||||||||||||||| |||||||||| Sbjct: 602 acatatttgtttgcatccttgctttcatgccccctggatggggtttgctgctgattgccc 543 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 542 aagcgatccggcctgtgatccacaagactgggctttggggctcgatcaaggctcttgccc 483 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| ||| |||||||||||||||| || ||||| ||||||| Sbjct: 482 ggggctacgagatcctgatgggacttttcctgttcacgcccatcgccttcctcgcctggt 423 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 422 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 363 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 362 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 312 >gi|37386992|gb|CF630688.1|CF630688 zmrws48_0A20-015-f03.s1 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 658 Score = 387 bits (195), Expect = e-105 Identities = 267/291 (91%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| |||||||||||||| || |||||||||||||||||||||||||| |||||||||| Sbjct: 651 acatatttgtttgcatcctggctttcatgcccactggatggggtttgctgctgattgccc 592 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| |||||||||||||| ||| Sbjct: 591 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctctgcccc 532 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| || |||| Sbjct: 531 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcgtggt 472 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 471 tcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtc 412 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 411 tgcagatctcccgtatcctgggaggacacaagaaagaccgagggacccgga 361 >gi|32851032|gb|CD990713.1|CD990713 QAY3d12.yg QAY Zea mays cDNA clone QAY3d12, mRNA sequence Length = 417 Score = 385 bits (194), Expect = e-105 Identities = 194/194 (100%) Strand = Plus / Plus Query: 191 gtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctc 250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctc 60 Query: 251 ccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagtagtagggctg 310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ccgtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagtagtagggctg 120 Query: 311 ctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctatcaggttcaga 370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 ctgattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctatcaggttcaga 180 Query: 371 gaatattagggtcc 384 |||||||||||||| Sbjct: 181 gaatattagggtcc 194 Score = 317 bits (160), Expect = 9e-85 Identities = 160/160 (100%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 257 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 316 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 317 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 376 Query: 567 actataattaggctctgctaatagttagctaacttacagc 606 |||||||||||||||||||||||||||||||||||||||| Sbjct: 377 actataattaggctctgctaatagttagctaacttacagc 416 Score = 52.0 bits (26), Expect = 9e-05 Identities = 29/30 (96%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||||||||| ||||||| Sbjct: 173 ggttcagagaatattagggtccgtatgtat 202 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Plus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 256 aggttcagagaatattagggtcc 278 >gi|681840|gb|T70692.1|T70692 86 vegetative meristem Zea mays cDNA clone 7C03C04, mRNA sequence Length = 383 Score = 381 bits (192), Expect = e-104 Identities = 192/192 (100%) Strand = Plus / Plus Query: 193 ccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctccc 252 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctccc 60 Query: 253 gtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagtagtagggctgct 312 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 gtatcctgggaggacacaagaaagaccgagggacgcggagcaaggagtagtagggctgct 120 Query: 313 gattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctatcaggttcagaga 372 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gattgaaggtccgtctatcgggagttatgtcgtcctggagcggtctatcaggttcagaga 180 Query: 373 atattagggtcc 384 |||||||||||| Sbjct: 181 atattagggtcc 192 Score = 121 bits (61), Expect = 1e-25 Identities = 102/110 (92%), Gaps = 5/110 (4%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctat-ggtcttt 505 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 255 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatgggtcttt 314 Query: 506 t-ggattggaa-gatc-tgagatttgc-tggtgcaatggccagtatctga 551 | ||||||| | |||| ||||||||| ||||||||||| |||||||||| Sbjct: 315 tgggattggnaggatcttgagatttgnttggtgcaatggncagtatctga 364 Score = 52.0 bits (26), Expect = 9e-05 Identities = 29/30 (96%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtat 476 |||||||||||||||||||||| ||||||| Sbjct: 171 ggttcagagaatattagggtccgtatgtat 200 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Plus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 254 aggttcagagaatattagggtcc 276 >gi|32934152|gb|CF038964.1|CF038964 QCH30a08.yg QCH Zea mays cDNA clone QCH30a08, mRNA sequence Length = 503 Score = 343 bits (173), Expect = 2e-92 Identities = 237/257 (92%), Gaps = 1/257 (0%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 247 acatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgccc 306 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 |||| ||| |||||||||| || |||| ||||| ||||| ||||||||||||||||||| Sbjct: 307 aagcgatccggcctgtgatccacaagactgggctctggggctcgatcaaggctcttgccc 366 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 |||||||||||||||| ||||| |||||||||||||||||||| || ||||| ||||||| Sbjct: 367 ggggctacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggt 426 Query: 181 tcccgttcgtgtccgagttccagaccaggat-gctgttcaaccaggccttcagcagaggt 239 ||||||||||||| || |||||||||||||| ||||||||||||||| |||||||||||| Sbjct: 427 tcccgttcgtgtcggaattccagaccaggatggctgttcaaccaggcgttcagcagaggt 486 Query: 240 ctgcagatctcccgtat 256 ||||||||||||||||| Sbjct: 487 ctgcagatctcccgtat 503 >gi|32936240|gb|CF041052.1|CF041052 QCI21c02.yg QCI Zea mays cDNA clone QCI21c02, mRNA sequence Length = 470 Score = 289 bits (146), Expect = 2e-76 Identities = 179/190 (94%) Strand = Plus / Minus Query: 102 tcgatcaaggctcttgcccggggctacgagatcctaatggggcttctcctgttcacgccc 161 ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Sbjct: 466 tcgatcaaggctcttgcccggggctacgagatcctgatgggacttctcctgttcacgccc 407 Query: 162 attgctttccttgcctggttcccgttcgtgtccgagttccagaccaggatgctgttcaac 221 || || ||||| |||||||||||| ||||||| || |||||||||||||||||||||||| Sbjct: 406 atcgccttcctcgcctggttcccgctcgtgtcggaattccagaccaggatgctgttcaac 347 Query: 222 caggccttcagcagaggtctgcagatctcccgtatcctgggaggacacaagaaagaccga 281 ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 346 caggcgttcagcagaggtctgcagatctcccgtatcctgggaggacccaagaaagaccga 287 Query: 282 gggacgcgga 291 ||||| |||| Sbjct: 286 gggacccgga 277 >gi|9254838|gb|BE345306.1|BE345306 946034A06.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 230 Score = 262 bits (132), Expect = 5e-68 Identities = 132/132 (100%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 49 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 108 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 109 ggattggaagatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaa 168 Query: 567 actataattagg 578 |||||||||||| Sbjct: 169 actataattagg 180 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Plus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 48 aggttcagagaatattagggtcc 70 >gi|32807351|gb|CD959585.1|CD959585 SCW_221 GeneTag2 Zea mays cDNA, mRNA sequence Length = 105 Score = 208 bits (105), Expect = 6e-52 Identities = 105/105 (100%) Strand = Plus / Plus Query: 516 gatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaaactataatt 575 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gatctgagatttgctggtgcaatggccagtatctgacatccaaatgttgaaactataatt 60 Query: 576 aggctctgctaatagttagctaacttacagctaacaattagttta 620 ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 aggctctgctaatagttagctaacttacagctaacaattagttta 105 >gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence Length = 2352 Score = 206 bits (104), Expect = 2e-51 Identities = 236/280 (84%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || | Sbjct: 1812 acatctttgtttgcatccttgcgttcatgccaactggatggggtttgcttctgatagcac 1871 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 || |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| ||||||| Sbjct: 1872 aaactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgccc 1931 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 | ||||| |||||| | ||||| | || ||||||| || || || ||||| || |||| Sbjct: 1932 gaggctatgagatcatcatgggcttgctgttgttcaccccgatcgcattcctcgcttggt 1991 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||| || || ||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 1992 tcccgtttgtttcggagttccagacaaggatgctgttcaaccaggccttcagtagaggtc 2051 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccg 280 ||||||| || |||||||| || ||||||||||||||||| Sbjct: 2052 tgcagatttctcgtatcctaggcggacacaagaaagaccg 2091 >gi|21210805|gb|AY107727.1| Zea mays PCO075555 mRNA sequence Length = 2352 Score = 206 bits (104), Expect = 2e-51 Identities = 236/280 (84%) Strand = Plus / Plus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || | Sbjct: 1812 acatctttgtttgcatccttgcgttcatgccaactggatggggtttgcttctgatagcac 1871 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 || |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| ||||||| Sbjct: 1872 aaactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgccc 1931 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 | ||||| |||||| | ||||| | || ||||||| || || || ||||| || |||| Sbjct: 1932 gaggctatgagatcatcatgggcttgctgttgttcaccccgatcgcattcctcgcttggt 1991 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||| || || ||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 1992 tcccgtttgtttcggagttccagacaaggatgctgttcaaccaggccttcagtagaggtc 2051 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccg 280 ||||||| || |||||||| || ||||||||||||||||| Sbjct: 2052 tgcagatttctcgtatcctaggcggacacaagaaagaccg 2091 >gi|4572834|gb|AI586483.1|AI586483 486051G06.x2 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 412 Score = 204 bits (103), Expect = 1e-50 Identities = 235/279 (84%) Strand = Plus / Minus Query: 2 catctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccca 61 ||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || || Sbjct: 412 catctttgtttgcatccttgcgttcatgccaactggatggggtttgcttctgatagcaca 353 Query: 62 agctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgcccg 121 | |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| |||||||| Sbjct: 352 aactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgcccg 293 Query: 122 gggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggtt 181 ||||| |||||| | ||||| | || ||||||| || || || ||||| || ||||| Sbjct: 292 aggctatgagatcatcatgggcttgctgttgttcaccccgatcgcattcctcgcttggtt 233 Query: 182 cccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtct 241 |||||| || || ||||||||||| |||||||||||||||||||||||||| |||||||| Sbjct: 232 cccgtttgtttcggagttccagacaaggatgctgttcaaccaggccttcagtagaggtct 173 Query: 242 gcagatctcccgtatcctgggaggacacaagaaagaccg 280 |||||| || |||||||| || ||||||||||||||||| Sbjct: 172 gcagatttctcgtatcctaggcggacacaagaaagaccg 134 >gi|32912691|gb|CF017503.1|CF017503 QBM25a06.xg QBM Zea mays cDNA clone QBM25a06, mRNA sequence Length = 242 Score = 202 bits (102), Expect = 4e-50 Identities = 112/114 (98%), Gaps = 1/114 (0%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 31 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtccttt 90 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatct-gacatccaaa 559 ||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 91 ggattggaagatctgagatttgctggtgcaatggccagtatctggacatccaaa 144 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Plus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 30 aggttcagagaatattagggtcc 52 >gi|32912752|gb|CF017564.1|CF017564 QBM25h05.xg QBM Zea mays cDNA clone QBM25h05, mRNA sequence Length = 163 Score = 202 bits (102), Expect = 4e-50 Identities = 112/114 (98%), Gaps = 1/114 (0%) Strand = Plus / Plus Query: 447 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtctttt 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 31 ggttcagagaatattagggtccctatgtatatgtatgtatcaggattgctatggtccttt 90 Query: 507 ggattggaagatctgagatttgctggtgcaatggccagtatct-gacatccaaa 559 ||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 91 ggattggaagatctgagatttgctggtgcaatggccagtatctggacatccaaa 144 Score = 46.1 bits (23), Expect = 0.005 Identities = 23/23 (100%) Strand = Plus / Plus Query: 362 aggttcagagaatattagggtcc 384 ||||||||||||||||||||||| Sbjct: 30 aggttcagagaatattagggtcc 52 >gi|83279419|gb|DV943427.1|DV943427 1000137-B06.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 456 Score = 198 bits (100), Expect = 6e-49 Identities = 235/280 (83%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||| |||||||| ||||||||||||||||| |||| || | Sbjct: 340 acatctttgtttgcatccttgcgttcatgccaactggatggggtttgcttttgatagcac 281 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 || |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| ||||||| Sbjct: 280 aaactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgccc 221 Query: 121 ggggctacgagatcctaatggggcttctcctgttcacgcccattgctttccttgcctggt 180 | ||||| |||||| | ||||| | || ||||||| || || || ||||| || |||| Sbjct: 220 gaggctatgagatcatcatgggcttgctgttgttcaccccgatggcattcctcgcttggt 161 Query: 181 tcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagaggtc 240 ||||||| || || ||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 160 tcccgtttgtttcggagttccagacaaggatgctgttcaaccaggccttcagtagaggtc 101 Query: 241 tgcagatctcccgtatcctgggaggacacaagaaagaccg 280 ||||||| || |||||||| || ||||||||||||||||| Sbjct: 100 tgcagatttctcgtatcctaggcggacacaagaaagaccg 61 >gi|4609560|gb|AI600399.1|AI600399 486071A05.x2 486 - leaf primordia cDNA library from Hake lab Zea mays cDNA, mRNA sequence Length = 415 Score = 163 bits (82), Expect = 3e-38 Identities = 88/90 (97%) Strand = Plus / Minus Query: 202 agaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctgg 261 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 415 agaccaggatgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgg 356 Query: 262 gaggacacaagaaagaccgagggacgcgga 291 ||||||||||||||||||||||||| |||| Sbjct: 355 gaggacacaagaaagaccgagggacccgga 326 >gi|61117946|gb|DN558907.1|DN558907 E5-H06-T3 E7PCR Zea mays cDNA clone E7PCRE506H, mRNA sequence Length = 175 Score = 157 bits (79), Expect = 2e-36 Identities = 88/91 (96%) Strand = Plus / Plus Query: 201 cagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctg 260 |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1 cagaccaggacgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctg 60 Query: 261 ggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||| |||| Sbjct: 61 ggaggacacaagaaagaccgagggacccgga 91 >gi|61117944|gb|DN558905.1|DN558905 ME16-D06-T3-96-R1 E7PCR Zea mays cDNA clone E7PCRME1606D, mRNA sequence Length = 177 Score = 153 bits (77), Expect = 3e-35 Identities = 90/93 (96%), Gaps = 1/93 (1%) Strand = Plus / Plus Query: 200 ccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctcccg-tatcc 258 ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| Sbjct: 1 ccagaccaggatgctgttcaaccaggcgttcagcagaggtctgcagatctcccgntatcc 60 Query: 259 tgggaggacacaagaaagaccgagggacgcgga 291 |||||||||||||||||||||||||||| |||| Sbjct: 61 tgggaggacacaagaaagaccgagggacccgga 93 >gi|61117945|gb|DN558906.1|DN558906 ME22-E03-T3-96-R1 E7PCR Zea mays cDNA clone E7PCRME2203E, mRNA sequence Length = 334 Score = 153 bits (77), Expect = 3e-35 Identities = 90/93 (96%), Gaps = 1/93 (1%) Strand = Plus / Plus Query: 200 ccagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcct 259 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1 ccagaccaggatgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcct 60 Query: 260 gg-gaggacacaagaaagaccgagggacgcgga 291 || ||||||||||||||||||||||||| |||| Sbjct: 61 ggngaggacacaagaaagaccgagggacccgga 93 >gi|61117947|gb|DN558908.1|DN558908 ME24-D06-T3-96-R1 E7PCR Zea mays cDNA clone E7PCRME2406D, mRNA sequence Length = 176 Score = 151 bits (76), Expect = 1e-34 Identities = 89/92 (96%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 201 cagaccaggatgctgttcaaccaggccttcagcagaggtctgcagatctcccg-tatcct 259 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 1 cagaccaggatgctgttcaaccaggcgttcagcagaggtctgcagatctcccgntatcct 60 Query: 260 gggaggacacaagaaagaccgagggacgcgga 291 ||||||||||||||||||||||||||| |||| Sbjct: 61 gggaggacacaagaaagaccgagggacccgga 92 >gi|12971941|gb|BG267734.1|BG267734 1000137B06.x2 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 261 Score = 109 bits (55), Expect = 4e-22 Identities = 157/191 (82%) Strand = Plus / Minus Query: 90 gggctgtgggggtcgatcaaggctcttgcccggggctacgagatcctaatggggcttctc 149 ||||| ||||| ||| ||||||| |||||||| ||||| |||||| | ||||| | || Sbjct: 255 gggctatggggatcggtcaaggcgcttgcccgaggctatgagatcatcatgggcttgctg 196 Query: 150 ctgttcacgcccattgctttccttgcctggttcccgttcgtgtccgagttccagaccagg 209 ||||||| || || || ||||| || ||||||||||| || || ||||||||| | ||| Sbjct: 195 ttgttcaccccgatcgcattcctcgcttggttcccgtttgtttcggagttccagccaagg 136 Query: 210 atgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctgggaggacac 269 |||||||||||||||| || |||||||||||||| || |||||||| || |||||| Sbjct: 135 atgctgttcaaccaggaaaaaagtagaggtctgcagatttctcgtatcctaggcggacac 76 Query: 270 aagaaagaccg 280 ||||||||||| Sbjct: 75 aagaaagaccg 65 >gi|32830788|gb|CD970466.1|CD970466 QAD17g06.sg QAD Zea mays cDNA clone QAD17g06, mRNA sequence Length = 549 Score = 91.7 bits (46), Expect = 1e-16 Identities = 112/134 (83%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || | Sbjct: 219 acatctttgtttgcatccttgcgttcatgccaactggatggggtttgcttctgatagcac 160 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 || |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| ||||||| Sbjct: 159 aaactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgccc 100 Query: 121 ggggctacgagatc 134 | ||||| |||||| Sbjct: 99 gaggctatgagatc 86 >gi|32831815|gb|CD971493.1|CD971493 QAD9f04.sg QAD Zea mays cDNA clone QAD9f04, mRNA sequence Length = 615 Score = 91.7 bits (46), Expect = 1e-16 Identities = 112/134 (83%) Strand = Plus / Minus Query: 1 acatctttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgccc 60 |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || | Sbjct: 200 acatctttgtttgcatccttgcgttcatgccaactggatggggtttgcttctgatagcac 141 Query: 61 aagctatcaggcctgtgattcaaaagatcgggctgtgggggtcgatcaaggctcttgccc 120 || |||| ||| | | ||| | | || ||||| ||||| ||| ||||||| ||||||| Sbjct: 140 aaactatgaggtcagctatttcacatatggggctatggggatcggtcaaggcgcttgccc 81 Query: 121 ggggctacgagatc 134 | ||||| |||||| Sbjct: 80 gaggctatgagatc 67 >gi|5670945|gb|AI932208.1|AI932208 618029G11.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 271 Score = 67.9 bits (34), Expect = 1e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| ||||| || || |||||||| || |||| |||||||||||||||||||| Sbjct: 250 tggttccccttcgtctctgaattccagacacggctgctcttcaaccaggccttcagcagg 191 Query: 237 ggtctgcagatctc 250 || ||||||||||| Sbjct: 190 gggctgcagatctc 177 >gi|60345589|gb|DN212562.1|DN212562 MEST942_C06.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 762 Score = 67.9 bits (34), Expect = 1e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| ||||| || || |||||||| || |||| |||||||||||||||||||| Sbjct: 304 tggttccccttcgtctctgaattccagacacggctgctcttcaaccaggccttcagcagg 245 Query: 237 ggtctgcagatctc 250 || ||||||||||| Sbjct: 244 gggctgcagatctc 231 >gi|88687866|gb|AC182833.1| Zea mays chromosome UNK clone CH201-175A10, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 174451 Score = 65.9 bits (33), Expect = 6e-09 Identities = 63/73 (86%) Strand = Plus / Plus Query: 178 ggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcagag 237 ||||||| ||||| || || |||||||| || |||| |||||||||||||||||||| | Sbjct: 128583 ggttccccttcgtctctgaattccagacacggctgctcttcaaccaggccttcagcaggg 128642 Query: 238 gtctgcagatctc 250 | ||||||||||| Sbjct: 128643 ggctgcagatctc 128655 >gi|24462506|gb|BM660037.1|BM660037 EST0044 Zea mays sperm cell cDNA library Zea mays cDNA clone Zmsp042 5' similar to glucan synthase, mRNA sequence Length = 449 Score = 54.0 bits (27), Expect = 2e-05 Identities = 51/59 (86%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcag 235 |||||||| ||||| || || |||||||| || |||| |||||||||||||||||||| Sbjct: 263 tggttccccttcgtctctgaattccagacacggctgctcttcaaccaggccttcagcag 321 >gi|88687856|gb|AC182823.1| Zea mays chromosome UNK clone CH201-256F5, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 159704 Score = 50.1 bits (25), Expect = 3e-04 Identities = 28/29 (96%) Strand = Plus / Plus Query: 590 gttagctaacttacagctaacaattagtt 618 ||||||||||| ||||||||||||||||| Sbjct: 83863 gttagctaactcacagctaacaattagtt 83891 >gi|85861441|gb|AC177931.1| Zea mays chromosome UNK clone CH201-120B1, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces Length = 223026 Score = 50.1 bits (25), Expect = 3e-04 Identities = 28/29 (96%) Strand = Plus / Minus Query: 590 gttagctaacttacagctaacaattagtt 618 ||||||||||| ||||||||||||||||| Sbjct: 129475 gttagctaactcacagctaacaattagtt 129447 >gi|5499430|gb|AI855297.1|AI855297 603014A03.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 557 Score = 48.1 bits (24), Expect = 0.001 Identities = 33/36 (91%) Strand = Plus / Minus Query: 583 gctaatagttagctaacttacagctaacaattagtt 618 |||||| |||||||| || ||||||||||||||||| Sbjct: 246 gctaattgttagctacctcacagctaacaattagtt 211 >gi|67014266|gb|CO443015.1|CO443015 MZCCL10058G03.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 858 Score = 48.1 bits (24), Expect = 0.001 Identities = 57/68 (83%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| || |||||||||||||| || |||||||||| || || || ||||| ||| Sbjct: 479 tggttcccctttgtgtccgagttccaaacgcggatgctgtttaatcaagcgttcagtaga 538 Query: 237 ggtctgca 244 || ||||| Sbjct: 539 ggactgca 546 >gi|67014856|gb|CO443605.1|CO443605 MZCCL10047D09.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 667 Score = 48.1 bits (24), Expect = 0.001 Identities = 57/68 (83%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| || |||||||||||||| || |||||||||| || || || ||||| ||| Sbjct: 416 tggttcccctttgtgtccgagttccaaacgcggatgctgtttaatcaagcgttcagtaga 475 Query: 237 ggtctgca 244 || ||||| Sbjct: 476 ggactgca 483 >gi|67019808|gb|CO448557.1|CO448557 MZCCL10122B12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 487 Score = 48.1 bits (24), Expect = 0.001 Identities = 57/68 (83%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| || |||||||||||||| || |||||||||| || || || ||||| ||| Sbjct: 135 tggttcccctttgtgtccgagttccaaacgcggatgctgtttaatcaagcgttcagtaga 194 Query: 237 ggtctgca 244 || ||||| Sbjct: 195 ggactgca 202 >gi|78021197|gb|DV489584.1|DV489584 1000126-D06.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 546 Score = 48.1 bits (24), Expect = 0.001 Identities = 33/36 (91%) Strand = Plus / Minus Query: 583 gctaatagttagctaacttacagctaacaattagtt 618 |||||| |||||||| || ||||||||||||||||| Sbjct: 224 gctaattgttagctacctcacagctaacaattagtt 189 >gi|91050139|gb|EB160557.1|EB160557 ZM_BFb0298I11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 811 Score = 48.1 bits (24), Expect = 0.001 Identities = 57/68 (83%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| || |||||||||||||| || |||||||||| || || || ||||| ||| Sbjct: 588 tggttcccctttgtgtccgagttccaaacgcggatgctgtttaatcaagcgttcagtaga 647 Query: 237 ggtctgca 244 || ||||| Sbjct: 648 ggactgca 655 >gi|58082325|gb|AC155464.2| Zea mays strain B73 clone ZMMBBb0518C23, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 119773 Score = 48.1 bits (24), Expect = 0.001 Identities = 57/68 (83%) Strand = Plus / Plus Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236 |||||||| || |||||||||||||| || |||||||||| || || || ||||| ||| Sbjct: 81605 tggttcccctttgtgtccgagttccaaacgcggatgctgtttaatcaagcgttcagtaga 81664 Query: 237 ggtctgca 244 || ||||| Sbjct: 81665 ggactgca 81672 >gi|5650234|gb|AI920594.1|AI920594 618016A09.x1 618 - Inbred Tassel cDNA Library Zea mays cDNA, mRNA sequence Length = 438 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 162 ctgttcaaccaggcgttcagcagaggt 136 >gi|5847010|gb|AW000089.1|AW000089 614057D01.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 568 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 316 ctgttcaaccaggcgttcagcagaggt 290 >gi|6526773|gb|AW216052.1|AW216052 687050H06.x1 687 - Early embryo from Delaware Zea mays cDNA, mRNA sequence Length = 480 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 280 ctgttcaaccaggcgttcagcagaggt 254 >gi|9732693|gb|BE511445.1|BE511445 946060H07.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 556 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 382 ctgttcaaccaggcgttcagcagaggt 408 >gi|32796874|gb|CD949110.1|CD949110 SAJ_144 GeneTag2 Zea mays cDNA, mRNA sequence Length = 407 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 333 ctgttcaaccaggcgttcagcagaggt 359 >gi|32837612|gb|CD977290.1|CD977290 QAF28f04.yg QAF Zea mays cDNA clone QAF28f04, mRNA sequence Length = 436 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 123 ctgttcaaccaggcgttcagcagaggt 97 >gi|32838544|gb|CD978222.1|CD978222 QAF40e05.yg QAF Zea mays cDNA clone QAF40e05, mRNA sequence Length = 436 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 123 ctgttcaaccaggcgttcagcagaggt 97 >gi|32849812|gb|CD989493.1|CD989493 QAT2e12.yg QAT Zea mays cDNA clone QAT2e12, mRNA sequence Length = 436 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 314 ctgttcaaccaggcgttcagcagaggt 340 >gi|37389477|gb|CF631959.1|CF631959 zmrws48_0B10-015-c04.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 378 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 319 ctgttcaaccaggcgttcagcagaggt 293 >gi|45568321|gb|CK986009.1|CK986009 zmrsub1_0B20-009-f01.s3 zmrsub1 Zea mays cDNA 3', mRNA sequence Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 300 ctgttcaaccaggcgttcagcagaggt 274 >gi|60357590|gb|DN224563.1|DN224563 MEST1160_B09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 657 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 263 ctgttcaaccaggcgttcagcagaggt 237 >gi|60397477|gb|DN230293.1|DN230293 MEST1024_G10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 734 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 314 ctgttcaaccaggcgttcagcagaggt 288 >gi|67012517|gb|CO441266.1|CO441266 MZCCL10029C08.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 536 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 218 ctgttcaaccaggcgttcagcagaggt 244 >gi|67015741|gb|CO444490.1|CO444490 MZCCL10072C12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 851 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 521 ctgttcaaccaggcgttcagcagaggt 547 >gi|78022641|gb|DV491028.1|DV491028 1000036-G05.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 531 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 359 ctgttcaaccaggcgttcagcagaggt 333 >gi|78120961|gb|DV539345.1|DV539345 ZM_BFb0233C12.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 777 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 294 ctgttcaaccaggcgttcagcagaggt 268 >gi|84980995|gb|DW531344.1|DW531344 ZMEC_04C01 ZmEC Zea mays cDNA, mRNA sequence Length = 695 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 368 ctgttcaaccaggcgttcagcagaggt 394 >gi|87155610|gb|DY400399.1|DY400399 V-946-2B-F12.T7-1 UGV-Reseq Zea mays cDNA, mRNA sequence Length = 654 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 360 ctgttcaaccaggcgttcagcagaggt 334 >gi|21211045|gb|AY107967.1| Zea mays PCO108952 mRNA sequence Length = 1033 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 679 ctgttcaaccaggcgttcagcagaggt 705 >gi|45673714|gb|BV134191.1| PZA00393 Zea mays ssp. parviglumis Wilkes Site 6 Zea mays Wilkes Site 6 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673713|gb|BV134190.1| PZA00393 Zea mays ssp. parviglumis Beadle & Kato site 4 Zea mays Beadle & Kato site 4 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673712|gb|BV134189.1| PZA00393 Zea mays ssp. parviglumis Kato Site 4 Zea mays Kato Site 4 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 597 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673711|gb|BV134188.1| PZA00393 Zea mays ssp. parviglumis Benz 967 Zea mays Benz 967 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 585 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 440 ctgttcaaccaggcgttcagcagaggt 466 >gi|45673710|gb|BV134187.1| PZA00393 Zea mays ssp. parviglumis JSGyMAS 264 Zea mays JSGyMAS 264 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673709|gb|BV134186.1| PZA00393 Zea mays ssp. parviglumis USDA PI566686 Zea mays USDA PI566686 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 596 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 453 ctgttcaaccaggcgttcagcagaggt 479 >gi|45673708|gb|BV134185.1| PZA00393 Zea mays ssp. parviglumis CIMMYT 11355 Zea mays CIMMYT 11355 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673707|gb|BV134184.1| PZA00393 Zea mays ssp. parviglumis JSGyLOS 161 Zea mays JSGyLOS 161 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 601 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 453 ctgttcaaccaggcgttcagcagaggt 479 >gi|45673706|gb|BV134183.1| PZA00393 Zea mays ssp. parviglumis JSG 374 Zea mays JSG 374 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 587 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 428 ctgttcaaccaggcgttcagcagaggt 454 >gi|45673705|gb|BV134182.1| PZA00393 Zea mays ssp. parviglumis JSG 378 Zea mays JSG 378 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 594 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673704|gb|BV134181.1| PZA00393 Zea mays ssp. parviglumis JSGyLOS 109 Zea mays JSGyLOS 109 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673703|gb|BV134180.1| PZA00393 Zea mays ssp. parviglumis JSG 197 Zea mays JSG 197 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 562 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673702|gb|BV134179.1| PZA00393 Zea mays ssp. parviglumis CIMMYT 8783 Zea mays CIMMYT 8783 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673701|gb|BV134178.1| PZA00393 Zea mays ssp. parviglumis JSGyMAS 401 Zea mays JSGyMAS 401 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 570 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 453 ctgttcaaccaggcgttcagcagaggt 479 >gi|45673700|gb|BV134177.1| PZA00393 Zea mays ssp. parviglumis JSGyLOS 119 Zea mays JSGyLOS 119 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 566 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 429 ctgttcaaccaggcgttcagcagaggt 455 >gi|45673699|gb|BV134176.1| PZA00393 Zea mays ssp. parviglumis JSGyLOS 130 Zea mays JSGyLOS 130 Zea mays subsp. parviglumis STS genomic, sequence tagged site Length = 585 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 447 ctgttcaaccaggcgttcagcagaggt 473 >gi|45673698|gb|BV134175.1| PZA00393 Zea mays ssp. mays CML69 Zea mays CML69 Zea mays STS genomic, sequence tagged site Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673697|gb|BV134174.1| PZA00393 Zea mays ssp. mays CML322 Zea mays CML322 Zea mays STS genomic, sequence tagged site Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673696|gb|BV134173.1| PZA00393 Zea mays ssp. mays CML333 Zea mays CML333 Zea mays STS genomic, sequence tagged site Length = 609 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 453 ctgttcaaccaggcgttcagcagaggt 479 >gi|45673695|gb|BV134172.1| PZA00393 Zea mays ssp. mays Kul11 Zea mays Kul11 Zea mays STS genomic, sequence tagged site Length = 608 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673694|gb|BV134171.1| PZA00393 Zea mays ssp. mays Kul3 Zea mays Kul3 Zea mays STS genomic, sequence tagged site Length = 572 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 446 ctgttcaaccaggcgttcagcagaggt 472 >gi|45673693|gb|BV134170.1| PZA00393 Zea mays ssp. mays NC350 Zea mays NC350 Zea mays STS genomic, sequence tagged site Length = 617 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673692|gb|BV134169.1| PZA00393 Zea mays ssp. mays CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673691|gb|BV134168.1| PZA00393 Zea mays ssp. mays Hp301 Zea mays Hp301 Zea mays STS genomic, sequence tagged site Length = 615 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673690|gb|BV134167.1| PZA00393 Zea mays ssp. mays M37W Zea mays M37W Zea mays STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673689|gb|BV134166.1| PZA00393 Zea mays ssp. mays Mo17(2) Zea mays Mo17(2) Zea mays STS genomic, sequence tagged site Length = 603 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 453 ctgttcaaccaggcgttcagcagaggt 479 >gi|45673688|gb|BV134165.1| PZA00393 Zea mays ssp. mays Mo17(1) Zea mays Mo17(1) Zea mays STS genomic, sequence tagged site Length = 608 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 458 ctgttcaaccaggcgttcagcagaggt 484 >gi|45673687|gb|BV134164.1| PZA00393 Zea mays ssp. mays Il14H Zea mays Il14H Zea mays STS genomic, sequence tagged site Length = 577 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 440 ctgttcaaccaggcgttcagcagaggt 466 >gi|45673686|gb|BV134163.1| PZA00393 Zea mays ssp. mays Oh43 Zea mays Oh43 Zea mays STS genomic, sequence tagged site Length = 609 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673685|gb|BV134162.1| PZA00393 Zea mays ssp. mays B73(2) Zea mays B73(2) Zea mays STS genomic, sequence tagged site Length = 618 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 459 ctgttcaaccaggcgttcagcagaggt 485 >gi|45673684|gb|BV134161.1| PZA00393 Zea mays ssp. mays B73(1) Zea mays B73(1) Zea mays STS genomic, sequence tagged site Length = 586 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 429 ctgttcaaccaggcgttcagcagaggt 455 >gi|21211045|gb|AY107967.1| Zea mays PCO108952 mRNA sequence Length = 1033 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 679 ctgttcaaccaggcgttcagcagaggt 705 >gi|89257742|gb|AC177869.2| Zea mays chromosome UNK clone CH201-464E4; ZMMBBc0464E04, *** SEQUENCING IN PROGRESS ***, 14 unordered pieces Length = 180066 Score = 46.1 bits (23), Expect = 0.005 Identities = 32/35 (91%) Strand = Plus / Minus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||||||| || ||||||||||||||||| Sbjct: 107269 ctaattgttagctatctcacagctaacaattagtt 107235 >gi|58082375|gb|AC155515.2| Zea mays strain B73 clone ZMMBBc0059O05, *** SEQUENCING IN PROGRESS ***, 13 unordered pieces Length = 161304 Score = 46.1 bits (23), Expect = 0.005 Identities = 26/27 (96%) Strand = Plus / Plus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||||||| |||||||||||| Sbjct: 34454 ctgttcaaccaggcgttcagcagaggt 34480 >gi|50322940|gb|CO518066.1|CO518066 3530_1_117_1_G04.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 668 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Minus Query: 214 tgttcaaccaggccttcagcagaggt 239 ||||||||||||| |||||||||||| Sbjct: 344 tgttcaaccaggcgttcagcagaggt 319 >gi|78118621|gb|DV537005.1|DV537005 ZM_BFb0229L22.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 664 Score = 44.1 bits (22), Expect = 0.021 Identities = 25/26 (96%) Strand = Plus / Minus Query: 214 tgttcaaccaggccttcagcagaggt 239 ||||||||||||| |||||||||||| Sbjct: 333 tgttcaaccaggcgttcagcagaggt 308 >gi|91630513|gb|AC185126.1| Zea mays chromosome UNK clone CH201-179E3; ZMMBBc0179E03, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces Length = 167139 Score = 44.1 bits (22), Expect = 0.021 Identities = 31/34 (91%) Strand = Plus / Minus Query: 585 taatagttagctaacttacagctaacaattagtt 618 |||| |||||||| || ||||||||||||||||| Sbjct: 34140 taattgttagctacctcacagctaacaattagtt 34107 >gi|58082380|gb|AC155520.2| Zea mays strain B73 clone ZMMBBc0111D02, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 182471 Score = 44.1 bits (22), Expect = 0.021 Identities = 34/38 (89%) Strand = Plus / Plus Query: 583 gctaatagttagctaacttacagctaacaattagttta 620 |||||| |||||||| || ||| ||||||||||||||| Sbjct: 63724 gctaattgttagctacctcacaactaacaattagttta 63761 >gi|45583818|gb|BV114445.1| PZA01060 Kul11 Zea mays Kul11 Zea mays STS genomic, sequence tagged site Length = 227 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|45583815|gb|BV114442.1| PZA01060 CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 226 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|45583814|gb|BV114441.1| PZA01060 Hp301 Zea mays Hp301 Zea mays STS genomic, sequence tagged site Length = 220 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|45583810|gb|BV114437.1| PZA01060 Mo17(1) Zea mays Mo17(1) Zea mays STS genomic, sequence tagged site Length = 227 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|45583809|gb|BV114436.1| PZA01060 Il14H Zea mays Il14H Zea mays STS genomic, sequence tagged site Length = 193 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|45583807|gb|BV114434.1| PZA01060 B73(2) Zea mays B73(2) Zea mays STS genomic, sequence tagged site Length = 227 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|37056223|gb|BV084566.1| scl284_p6 CML247 Zea mays CML247 Zea mays STS genomic, sequence tagged site Length = 226 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|37056222|gb|BV084565.1| scl284_p6 Hp301 Zea mays Hp301 Zea mays STS genomic, sequence tagged site Length = 220 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|37056217|gb|BV084560.1| scl284_p6 Il14H Zea mays Il14H Zea mays STS genomic, sequence tagged site Length = 193 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|37056212|gb|BV084555.1| scl284_p6 Kul11 Zea mays Kul11 Zea mays STS genomic, sequence tagged site Length = 227 Score = 42.1 bits (21), Expect = 0.082 Identities = 27/29 (93%) Strand = Plus / Plus Query: 252 cgtatcctgggaggacacaagaaagaccg 280 |||||||| || ||||||||||||||||| Sbjct: 2 cgtatcctaggcggacacaagaaagaccg 30 >gi|71446860|gb|DR827910.1|DR827910 ZM_BFb0071K11.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 768 Score = 40.1 bits (20), Expect = 0.32 Identities = 32/36 (88%) Strand = Plus / Plus Query: 583 gctaatagttagctaacttacagctaacaattagtt 618 |||||| |||||||| || |||||||||||||||| Sbjct: 687 gctaattgttagctacctcgcagctaacaattagtt 722 >gi|45583819|gb|BV114446.1| PZA01060 CML333 Zea mays CML333 Zea mays STS genomic, sequence tagged site Length = 208 Score = 40.1 bits (20), Expect = 0.32 Identities = 26/28 (92%) Strand = Plus / Plus Query: 253 gtatcctgggaggacacaagaaagaccg 280 ||||||| || ||||||||||||||||| Sbjct: 1 gtatcctaggcggacacaagaaagaccg 28 >gi|45583808|gb|BV114435.1| PZA01060 Oh43 Zea mays Oh43 Zea mays STS genomic, sequence tagged site Length = 222 Score = 40.1 bits (20), Expect = 0.32 Identities = 26/28 (92%) Strand = Plus / Plus Query: 253 gtatcctgggaggacacaagaaagaccg 280 ||||||| || ||||||||||||||||| Sbjct: 1 gtatcctaggcggacacaagaaagaccg 28 >gi|37056215|gb|BV084558.1| scl284_p6 Oh43 Zea mays Oh43 Zea mays STS genomic, sequence tagged site Length = 222 Score = 40.1 bits (20), Expect = 0.32 Identities = 26/28 (92%) Strand = Plus / Plus Query: 253 gtatcctgggaggacacaagaaagaccg 280 ||||||| || ||||||||||||||||| Sbjct: 1 gtatcctaggcggacacaagaaagaccg 28 >gi|37056214|gb|BV084557.1| scl284_p6 CML333 Zea mays CML333 Zea mays STS genomic, sequence tagged site Length = 208 Score = 40.1 bits (20), Expect = 0.32 Identities = 26/28 (92%) Strand = Plus / Plus Query: 253 gtatcctgggaggacacaagaaagaccg 280 ||||||| || ||||||||||||||||| Sbjct: 1 gtatcctaggcggacacaagaaagaccg 28 >gi|22545825|gb|BU098199.1|BU098199 946124F12.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 637 Score = 38.2 bits (19), Expect = 1.3 Identities = 25/27 (92%) Strand = Plus / Minus Query: 213 ctgttcaaccaggccttcagcagaggt 239 |||||||||| ||| |||||||||||| Sbjct: 324 ctgttcaacccggcgttcagcagaggt 298 >gi|31664674|gb|CD573607.1|CD573607 3529_1_128_1_H08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 544 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Plus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||| |||||| |||||||||||||||| Sbjct: 452 ctaattgttaactaactcgcagctaacaattagtt 486 >gi|21207316|gb|AY104238.1| Zea mays PCO120536 mRNA sequence Length = 1630 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Plus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||| |||||| |||||||||||||||| Sbjct: 207 ctaattgttaactaactcgcagctaacaattagtt 241 >gi|21207316|gb|AY104238.1| Zea mays PCO120536 mRNA sequence Length = 1630 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Plus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||| |||||| |||||||||||||||| Sbjct: 207 ctaattgttaactaactcgcagctaacaattagtt 241 >gi|92110175|gb|AC185312.1| Zea mays chromosome UNK clone CH201-321N9; ZMMBBc0321N09, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 149133 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Minus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||||||| || |||||||||||||||| Sbjct: 80778 ctaattgttagctatctcgcagctaacaattagtt 80744 >gi|88900602|gb|AC183313.1| Zea mays chromosome UNK clone CH201-487A8; ZMMBBc0487A08, *** SEQUENCING IN PROGRESS ***, 18 unordered pieces Length = 172511 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Plus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| ||||||||| | ||| ||||||||||||| Sbjct: 73561 ctaattgttagctaaatcacatctaacaattagtt 73595 >gi|88024682|gb|AC182628.1| Zea mays chromosome UNK clone CH201-114J9; ZMMBBc0114J09, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces Length = 185949 Score = 38.2 bits (19), Expect = 1.3 Identities = 31/35 (88%) Strand = Plus / Plus Query: 584 ctaatagttagctaacttacagctaacaattagtt 618 ||||| |||||||| || ||| ||||||||||||| Sbjct: 14022 ctaattgttagctacctcacaactaacaattagtt 14056 >gi|90186373|gb|AC182615.2| Zea mays chromosome UNK clone CH201-23M14; ZMMBBc0023M14, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces Length = 195851 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 551 acatccaaatgttgaaact 569 ||||||||||||||||||| Sbjct: 56315 acatccaaatgttgaaact 56297 >gi|22545921|gb|BU098280.1|BU098280 946133F05.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 558 Score = 36.2 bits (18), Expect = 5.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 276 gaccgagggacgcggagcaagg 297 |||||||||| ||||||||||| Sbjct: 46 gaccgagggaggcggagcaagg 67 >gi|31353451|gb|CD437808.1|CD437808 EL01N0505D01.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 829 Score = 36.2 bits (18), Expect = 5.1 Identities = 24/26 (92%) Strand = Plus / Minus Query: 590 gttagctaacttacagctaacaatta 615 ||||||||||| ||| |||||||||| Sbjct: 691 gttagctaactcacacctaacaatta 666 >gi|55741096|gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence Length = 405672 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 326760 gctaatagttagctaact 326743 >gi|55741054|gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence Length = 323584 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 322312 gctaatagttagctaact 322295 >gi|91982822|gb|AC185278.1| Zea mays chromosome UNK clone CH201-320G10; ZMMBBc0320G10, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 143833 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 97241 gctaatagttagctaact 97258 >gi|91176471|gb|AC184833.1| Zea mays chromosome UNK clone CH201-483F6; ZMMBBc0483F06, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 185348 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 144 cttctcctgttcacgccc 161 |||||||||||||||||| Sbjct: 59573 cttctcctgttcacgccc 59590 >gi|90568146|gb|AC183934.1| Zea mays chromosome UNK clone ZMMBBb-117H22; ZMMBBb0117H22, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces Length = 146122 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 44867 gctaatagttagctaact 44884 >gi|90186361|gb|AC183888.1| Zea mays chromosome UNK clone ZMMBBb-334E17; ZMMBBb0334E17, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 132702 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 72181 gctaatagttagctaact 72198 >gi|89257716|gb|AC177834.2| Zea mays chromosome UNK clone CH201-43M11; ZMMBBc0043M11, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces Length = 200864 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 64886 gctaatagttagctaact 64869 >gi|71725484|gb|AC166636.1| Zea mays strain B73 clone ZMMBBb0106O08, *** SEQUENCING IN PROGRESS ***, 27 unordered pieces Length = 136059 Score = 36.2 bits (18), Expect = 5.1 Identities = 30/34 (88%) Strand = Plus / Minus Query: 585 taatagttagctaacttacagctaacaattagtt 618 |||| |||||||| || ||| ||||||||||||| Sbjct: 95553 taattgttagctatctcacaactaacaattagtt 95520 >gi|58082381|gb|AC155521.2| Zea mays strain B73 clone ZMMBBc0111D07, *** SEQUENCING IN PROGRESS ***, 23 unordered pieces Length = 197590 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 149354 gctaatagttagctaact 149337 >gi|58082257|gb|AC155395.2| Zea mays strain B73 clone ZMMBBb0160F12, *** SEQUENCING IN PROGRESS ***, 13 unordered pieces Length = 149882 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 14938 gctaatagttagctaact 14955 >gi|57790161|gb|AC149836.2| Zea mays clone ZMMBBc0496L17, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces Length = 112468 Score = 36.2 bits (18), Expect = 5.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 583 gctaatagttagctaact 600 |||||||||||||||||| Sbjct: 87017 gctaatagttagctaact 87034 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 156,126 Number of Sequences: 836351 Number of extensions: 156126 Number of successful extensions: 12300 Number of sequences better than 10.0: 141 Number of HSP's better than 10.0 without gapping: 141 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 11993 Number of HSP's gapped (non-prelim): 301 length of query: 620 length of database: 669,372,029 effective HSP length: 19 effective length of query: 601 effective length of database: 653,481,360 effective search space: 392742297360 effective search space used: 392742297360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)