BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCL35a05.yg.2.1
         (567 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL809242.1|AL809242  AL809242 a:11 Triticum aestivum cDNA...    58   7e-007
gb|CV065256.1|CV065256  WNEL20b2 Wheat EST endosperm library...    40   0.16 

>gb|AL809242.1|AL809242 AL809242 a:11 Triticum aestivum cDNA clone A10_a11_plate_15, mRNA
          sequence
          Length = 586

 Score = 58.0 bits (29), Expect = 7e-007
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                   
Query: 1  acagtagttggctgaacctccccatcagtccataagttttc 41
          ||||||||||| |||||||||||||||| ||||| ||||||
Sbjct: 94 acagtagttgggtgaacctccccatcagcccatatgttttc 54



>gb|CV065256.1|CV065256 WNEL20b2 Wheat EST endosperm library Triticum aestivum cDNA clone
           WNEL20b2 5' similar to Unknown Function, mRNA sequence
          Length = 488

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 201 catccactgcgtatgtgatc 220
           ||||||||||||||||||||
Sbjct: 132 catccactgcgtatgtgatc 151



  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,821
Number of Sequences: 636343
Number of extensions: 70821
Number of successful extensions: 18754
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18752
Number of HSP's gapped (non-prelim): 2
length of query: 567
length of database: 367,240,239
effective HSP length: 19
effective length of query: 548
effective length of database: 355,149,722
effective search space: 194622047656
effective search space used: 194622047656
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)