BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCK30g08.yg.2.1
(164 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CK194020.1|CK194020 FGAS002439 Triticum aestivum FGAS: L... 88 2e-016
gb|CK203901.1|CK203901 FGAS012436 Triticum aestivum FGAS: L... 88 2e-016
gb|CK204227.1|CK204227 FGAS012763 Triticum aestivum FGAS: L... 88 2e-016
gb|CA667900.1|CA667900 wlsu1.pk015.e16 wlsu1 Triticum aesti... 48 2e-004
gb|CA669552.1|CA669552 wlsu1.pk021.h2 wlsu1 Triticum aestiv... 48 2e-004
gb|CA735308.1|CA735308 wpi1s.pk004.c10 wpi1s Triticum aesti... 48 2e-004
gb|CA737110.1|CA737110 wpi1s.pk009.f20 wpi1s Triticum aesti... 48 2e-004
gb|CA742666.1|CA742666 wri1s.pk001.h11 wri1s Triticum aesti... 48 2e-004
gb|AJ602516.1|AJ602516 AJ602516 T06 Triticum aestivum cDNA ... 48 2e-004
gb|AJ603412.1|AJ603412 AJ603412 T06 Triticum aestivum cDNA ... 48 2e-004
gb|AJ603416.1|AJ603416 AJ603416 T06 Triticum aestivum cDNA ... 48 2e-004
gb|CA667120.1|CA667120 wlsu1.pk0012.c2 wlsu1 Triticum aesti... 46 7e-004
gb|CA667202.1|CA667202 wlsu1.pk0014.d10 wlsu1 Triticum aest... 46 7e-004
gb|CA667566.1|CA667566 wlsu1.pk017.m11 wlsu1 Triticum aesti... 46 7e-004
gb|CA668407.1|CA668407 wlsu1.pk019.l14 wlsu1 Triticum aesti... 46 7e-004
gb|CA668928.1|CA668928 wlsu1.pk023.g6 wlsu1 Triticum aestiv... 46 7e-004
gb|CA675588.1|CA675588 wlsu2.pk027.j2 wlsu2 Triticum aestiv... 46 7e-004
gb|CA736694.1|CA736694 wpi1s.pk008.h11 wpi1s Triticum aesti... 46 7e-004
gb|CA742743.1|CA742743 wri1s.pk004.n3 wri1s Triticum aestiv... 46 7e-004
gb|CA743753.1|CA743753 wri1s.pk005.f13 wri1s Triticum aesti... 46 7e-004
gb|CA745340.1|CA745340 wri2s.pk001.k3 wri2s Triticum aestiv... 46 7e-004
gb|CA746570.1|CA746570 wri2s.pk004.o5 wri2s Triticum aestiv... 46 7e-004
gb|AJ603204.1|AJ603204 AJ603204 T06 Triticum aestivum cDNA ... 46 7e-004
gb|CV522403.1|CV522403 RH-322 Triticum aestivum subtracted,... 46 7e-004
gb|CA667112.1|CA667112 wlsu1.pk0012.f9 wlsu1 Triticum aesti... 44 0.003
gb|CA667426.1|CA667426 wlsu1.pk018.m19 wlsu1 Triticum aesti... 44 0.003
gb|CA667503.1|CA667503 wlsu1.pk015.h12 wlsu1 Triticum aesti... 44 0.003
gb|CA667546.1|CA667546 wlsu1.pk017.o23 wlsu1 Triticum aesti... 44 0.003
gb|CA667668.1|CA667668 wlsu1.pk017.e6 wlsu1 Triticum aestiv... 44 0.003
gb|CA667784.1|CA667784 wlsu1.pk015.o1 wlsu1 Triticum aestiv... 44 0.003
gb|CA667844.1|CA667844 wlsu1.pk015.c5 wlsu1 Triticum aestiv... 44 0.003
gb|CA667962.1|CA667962 wlsu1.pk015.n15 wlsu1 Triticum aesti... 44 0.003
gb|CA668095.1|CA668095 wlsu1.pk017.j22 wlsu1 Triticum aesti... 44 0.003
gb|CA668443.1|CA668443 wlsu1.pk019.l9 wlsu1 Triticum aestiv... 44 0.003
gb|CA668668.1|CA668668 wlsu1.pk021.p7 wlsu1 Triticum aestiv... 44 0.003
gb|CA668810.1|CA668810 wlsu1.pk023.o9 wlsu1 Triticum aestiv... 44 0.003
gb|CA668817.1|CA668817 wlsu1.pk023.g1 wlsu1 Triticum aestiv... 44 0.003
gb|CA668961.1|CA668961 wlsu1.pk023.m6 wlsu1 Triticum aestiv... 44 0.003
gb|CA669112.1|CA669112 wlsu1.pk023.f23 wlsu1 Triticum aesti... 44 0.003
gb|CA669201.1|CA669201 wlsu1.pk021.o24 wlsu1 Triticum aesti... 44 0.003
gb|CA669465.1|CA669465 wlsu1.pk022.f11 wlsu1 Triticum aesti... 44 0.003
gb|CA669529.1|CA669529 wlsu1.pk022.m22 wlsu1 Triticum aesti... 44 0.003
gb|CA669538.1|CA669538 wlsu1.pk022.g18 wlsu1 Triticum aesti... 44 0.003
gb|CA669653.1|CA669653 wlsu1.pk022.g1 wlsu1 Triticum aestiv... 44 0.003
gb|CA669691.1|CA669691 wlsu1.pk022.j8 wlsu1 Triticum aestiv... 44 0.003
gb|CA669730.1|CA669730 wlsu1.pk022.l22 wlsu1 Triticum aesti... 44 0.003
gb|CA669822.1|CA669822 wlsu1.pk018.d1 wlsu1 Triticum aestiv... 44 0.003
gb|CA670385.1|CA670385 wlsu1.pk026.g22 wlsu1 Triticum aesti... 44 0.003
gb|CA670459.1|CA670459 wlsu1.pk026.b7 wlsu1 Triticum aestiv... 44 0.003
gb|CA674495.1|CA674495 wlsu2.pk024.m13 wlsu2 Triticum aesti... 44 0.003
gb|CA736400.1|CA736400 wpi1s.pk007.h13 wpi1s Triticum aesti... 44 0.003
gb|CA736836.1|CA736836 wpi1s.pk008.d7 wpi1s Triticum aestiv... 44 0.003
gb|AJ602569.1|AJ602569 AJ602569 T06 Triticum aestivum cDNA ... 44 0.003
gb|CK157602.1|CK157602 FGAS038746 Triticum aestivum FGAS: T... 44 0.003
gb|CK161102.1|CK161102 FGAS042782 Triticum aestivum FGAS: T... 44 0.003
gb|CK166467.1|CK166467 FGAS050607 Triticum aestivum FGAS: T... 44 0.003
gb|CA669921.1|CA669921 wlsu1.pk024.i5 wlsu1 Triticum aestiv... 42 0.011
gb|CA670346.1|CA670346 wlsu1.pk026.e22 wlsu1 Triticum aesti... 42 0.011
gb|CA670394.1|CA670394 wlsu1.pk026.g16 wlsu1 Triticum aesti... 42 0.011
gb|CA670520.1|CA670520 wlsu1.pk026.j4 wlsu1 Triticum aestiv... 42 0.011
gb|CA670564.1|CA670564 wlsu1.pk026.b16 wlsu1 Triticum aesti... 42 0.011
gb|CA670602.1|CA670602 wlsu1.pk027.o8 wlsu1 Triticum aestiv... 42 0.011
gb|CA670611.1|CA670611 wlsu1.pk027.e20 wlsu1 Triticum aesti... 42 0.011
gb|CA670789.1|CA670789 wlsu1.pk027.d16 wlsu1 Triticum aesti... 42 0.011
gb|CA675277.1|CA675277 wlsu2.pk028.l1 wlsu2 Triticum aestiv... 42 0.011
gb|CA726167.1|CA726167 wet1s.pk002.f11 wet1s Triticum aesti... 42 0.011
gb|CA735991.1|CA735991 wpi1s.pk006.e17 wpi1s Triticum aesti... 42 0.011
gb|CA737015.1|CA737015 wpi1s.pk009.i10 wpi1s Triticum aesti... 42 0.011
gb|CA742711.1|CA742711 wri1s.pk001.d7 wri1s Triticum aestiv... 42 0.011
gb|CA743438.1|CA743438 wri1s.pk003.g14 wri1s Triticum aesti... 42 0.011
gb|CA744628.1|CA744628 wri1s.pk008.f18 wri1s Triticum aesti... 42 0.011
gb|CA745396.1|CA745396 wri2s.pk001.k22 wri2s Triticum aesti... 42 0.011
gb|CA745477.1|CA745477 wri2s.pk001.l21 wri2s Triticum aesti... 42 0.011
gb|AJ602852.1|AJ602852 AJ602852 T06 Triticum aestivum cDNA ... 42 0.011
gb|AJ603250.1|AJ603250 AJ603250 T06 Triticum aestivum cDNA ... 42 0.011
gb|CK153884.1|CK153884 FGAS032564 Triticum aestivum FGAS: T... 42 0.011
gb|CK155421.1|CK155421 FGAS036227 Triticum aestivum FGAS: T... 42 0.011
gb|CV522259.1|CV522259 RH-841 Triticum aestivum subtracted,... 42 0.011
gb|CA667479.1|CA667479 wlsu1.pk015.j20 wlsu1 Triticum aesti... 40 0.043
gb|CA670200.1|CA670200 wlsu1.pk025.n4 wlsu1 Triticum aestiv... 40 0.043
gb|CA670321.1|CA670321 wlsu1.pk026.o17 wlsu1 Triticum aesti... 40 0.043
gb|CA670860.1|CA670860 wlsu2.pk0001.e8 wlsu2 Triticum aesti... 40 0.043
gb|CA735035.1|CA735035 wpi1s.pk003.a9 wpi1s Triticum aestiv... 40 0.043
gb|CA735202.1|CA735202 wpi1s.pk003.j18 wpi1s Triticum aesti... 40 0.043
gb|CA736443.1|CA736443 wpi1s.pk007.d20 wpi1s Triticum aesti... 40 0.043
gb|CA736478.1|CA736478 wpi1s.pk007.i20 wpi1s Triticum aesti... 40 0.043
gb|CA737027.1|CA737027 wpi1s.pk009.l17 wpi1s Triticum aesti... 40 0.043
gb|CA744936.1|CA744936 wri1s.pk009.n13 wri1s Triticum aesti... 40 0.043
gb|CA745086.1|CA745086 wri1s.pk008.c22 wri1s Triticum aesti... 40 0.043
gb|CA745505.1|CA745505 wri2s.pk001.n15 wri2s Triticum aesti... 40 0.043
gb|CA746760.1|CA746760 wri2s.pk004.p2 wri2s Triticum aestiv... 40 0.043
gb|AJ603181.1|AJ603181 AJ603181 T06 Triticum aestivum cDNA ... 40 0.043
gb|AJ603185.1|AJ603185 AJ603185 T06 Triticum aestivum cDNA ... 40 0.043
gb|AJ603226.1|AJ603226 AJ603226 T06 Triticum aestivum cDNA ... 40 0.043
gb|AJ603252.1|AJ603252 AJ603252 T06 Triticum aestivum cDNA ... 40 0.043
gb|CV522863.1|CV522863 LH-23 Triticum aestivum subtracted, ... 40 0.043
gb|CV522903.1|CV522903 LH-34 Triticum aestivum subtracted, ... 40 0.043
gb|CV523130.1|CV523130 LP-225 Triticum aestivum subtracted,... 40 0.043
gb|CA642715.1|CA642715 wre1n.pk0060.h5 wre1n Triticum aesti... 38 0.17
gb|CA664139.1|CA664139 wlmk1.pk036.c9 wlmk1 Triticum aestiv... 38 0.17
gb|CA668229.1|CA668229 wlsu1.pk019.e7 wlsu1 Triticum aestiv... 38 0.17
gb|CA668499.1|CA668499 wlsu1.pk018.a24 wlsu1 Triticum aesti... 38 0.17
gb|CA671738.1|CA671738 wlsu2.pk0014.g3 wlsu2 Triticum aesti... 38 0.17
gb|CA673772.1|CA673772 wlsu2.pk022.f7 wlsu2 Triticum aestiv... 38 0.17
gb|CA725723.1|CA725723 wet1s.pk001.a22 wet1s Triticum aesti... 38 0.17
gb|CA725962.1|CA725962 wet1s.pk001.l8 wet1s Triticum aestiv... 38 0.17
gb|CA726070.1|CA726070 wet1s.pk002.c23 wet1s Triticum aesti... 38 0.17
gb|CA726234.1|CA726234 wet1s.pk002.b10 wet1s Triticum aesti... 38 0.17
gb|CA726253.1|CA726253 wet1s.pk002.h8 wet1s Triticum aestiv... 38 0.17
gb|CA726399.1|CA726399 wet1s.pk003.f9 wet1s Triticum aestiv... 38 0.17
gb|CA726426.1|CA726426 wet1s.pk003.p2 wet1s Triticum aestiv... 38 0.17
gb|CA726536.1|CA726536 wet1s.pk003.c21 wet1s Triticum aesti... 38 0.17
gb|CA726544.1|CA726544 wet1s.pk003.l18 wet1s Triticum aesti... 38 0.17
gb|CA735011.1|CA735011 wpi1s.pk003.n17 wpi1s Triticum aesti... 38 0.17
gb|CA735134.1|CA735134 wpi1s.pk002.j24 wpi1s Triticum aesti... 38 0.17
gb|CA735143.1|CA735143 wpi1s.pk002.d4 wpi1s Triticum aestiv... 38 0.17
gb|CA735186.1|CA735186 wpi1s.pk004.f1 wpi1s Triticum aestiv... 38 0.17
gb|CA735220.1|CA735220 wpi1s.pk003.p12 wpi1s Triticum aesti... 38 0.17
gb|CA735580.1|CA735580 wpi1s.pk004.b12 wpi1s Triticum aesti... 38 0.17
gb|CA735635.1|CA735635 wpi1s.pk004.c15 wpi1s Triticum aesti... 38 0.17
gb|CA735843.1|CA735843 wpi1s.pk005.e6 wpi1s Triticum aestiv... 38 0.17
gb|CA736117.1|CA736117 wpi1s.pk006.f19 wpi1s Triticum aesti... 38 0.17
gb|CA736140.1|CA736140 wpi1s.pk006.i22 wpi1s Triticum aesti... 38 0.17
gb|CA736194.1|CA736194 wpi1s.pk006.l14 wpi1s Triticum aesti... 38 0.17
gb|CA736461.1|CA736461 wpi1s.pk007.c18 wpi1s Triticum aesti... 38 0.17
gb|CA736511.1|CA736511 wpi1s.pk007.p13 wpi1s Triticum aesti... 38 0.17
gb|CA736523.1|CA736523 wpi1s.pk007.b7 wpi1s Triticum aestiv... 38 0.17
gb|CA736576.1|CA736576 wpi1s.pk007.j8 wpi1s Triticum aestiv... 38 0.17
gb|CA736830.1|CA736830 wpi1s.pk008.d14 wpi1s Triticum aesti... 38 0.17
gb|CA737073.1|CA737073 wpi1s.pk009.n2 wpi1s Triticum aestiv... 38 0.17
gb|CA737486.1|CA737486 wpi2s.pk004.g19 wpi2s Triticum aesti... 38 0.17
gb|CA737495.1|CA737495 wpi2s.pk004.i13 wpi2s Triticum aesti... 38 0.17
gb|CA737525.1|CA737525 wpi2s.pk004.k17 wpi2s Triticum aesti... 38 0.17
gb|CA737536.1|CA737536 wpi2s.pk004.o13 wpi2s Triticum aesti... 38 0.17
gb|CA737594.1|CA737594 wpi2s.pk004.g22 wpi2s Triticum aesti... 38 0.17
gb|CA738215.1|CA738215 wpi2s.pk006.o13 wpi2s Triticum aesti... 38 0.17
gb|CA738282.1|CA738282 wpi2s.pk006.n11 wpi2s Triticum aesti... 38 0.17
gb|CA738584.1|CA738584 wpi2s.pk008.c8 wpi2s Triticum aestiv... 38 0.17
gb|CA738917.1|CA738917 wpi2s.pk009.g6 wpi2s Triticum aestiv... 38 0.17
gb|CA739247.1|CA739247 wpi2s.pk005.b22 wpi2s Triticum aesti... 38 0.17
gb|CA739290.1|CA739290 wpi2s.pk007.a17 wpi2s Triticum aesti... 38 0.17
gb|CA739472.1|CA739472 wpi2s.pk007.f19 wpi2s Triticum aesti... 38 0.17
gb|CA739549.1|CA739549 wpi2s.pk007.n18 wpi2s Triticum aesti... 38 0.17
gb|CA739640.1|CA739640 wpi2s.pk010.i23 wpi2s Triticum aesti... 38 0.17
gb|CA742430.1|CA742430 wri1s.pk001.m21 wri1s Triticum aesti... 38 0.17
gb|CA742448.1|CA742448 wri1s.pk001.o3 wri1s Triticum aestiv... 38 0.17
gb|CA742784.1|CA742784 wri1s.pk004.j7 wri1s Triticum aestiv... 38 0.17
gb|CA742975.1|CA742975 wri1s.pk004.o4 wri1s Triticum aestiv... 38 0.17
gb|CA743066.1|CA743066 wri1s.pk002.o1 wri1s Triticum aestiv... 38 0.17
gb|CA743075.1|CA743075 wri1s.pk002.m23 wri1s Triticum aesti... 38 0.17
gb|CA743094.1|CA743094 wri1s.pk002.h6 wri1s Triticum aestiv... 38 0.17
gb|CA743110.1|CA743110 wri1s.pk004.n24 wri1s Triticum aesti... 38 0.17
gb|CA743247.1|CA743247 wri1s.pk002.g24 wri1s Triticum aesti... 38 0.17
gb|CA743302.1|CA743302 wri1s.pk003.a20 wri1s Triticum aesti... 38 0.17
gb|CA743339.1|CA743339 wri1s.pk005.g11 wri1s Triticum aesti... 38 0.17
gb|CA743615.1|CA743615 wri1s.pk003.d15 wri1s Triticum aesti... 38 0.17
gb|CA743616.1|CA743616 wri1s.pk003.d19 wri1s Triticum aesti... 38 0.17
gb|CA743697.1|CA743697 wri1s.pk005.c20 wri1s Triticum aesti... 38 0.17
gb|CA743987.1|CA743987 wri1s.pk006.m7 wri1s Triticum aestiv... 38 0.17
gb|CA743999.1|CA743999 wri1s.pk006.g11 wri1s Triticum aesti... 38 0.17
gb|CA744047.1|CA744047 wri1s.pk006.f17 wri1s Triticum aesti... 38 0.17
gb|CA744304.1|CA744304 wri1s.pk007.i18 wri1s Triticum aesti... 38 0.17
gb|CA744369.1|CA744369 wri1s.pk007.j17 wri1s Triticum aesti... 38 0.17
gb|CA744428.1|CA744428 wri1s.pk007.f5 wri1s Triticum aestiv... 38 0.17
gb|CA744776.1|CA744776 wri1s.pk009.o23 wri1s Triticum aesti... 38 0.17
gb|CA744923.1|CA744923 wri1s.pk009.h19 wri1s Triticum aesti... 38 0.17
gb|CA745079.1|CA745079 wri1s.pk008.c10 wri1s Triticum aesti... 38 0.17
gb|CA745205.1|CA745205 wri1s.pk003.p22 wri1s Triticum aesti... 38 0.17
gb|CA745635.1|CA745635 wri2s.pk002.g20 wri2s Triticum aesti... 38 0.17
gb|CA745822.1|CA745822 wri2s.pk002.f21 wri2s Triticum aesti... 38 0.17
gb|CA745834.1|CA745834 wri2s.pk002.j24 wri2s Triticum aesti... 38 0.17
gb|CA746372.1|CA746372 wri2s.pk005.d20 wri2s Triticum aesti... 38 0.17
gb|CA746830.1|CA746830 wri2s.pk006.o5 wri2s Triticum aestiv... 38 0.17
gb|CA746929.1|CA746929 wri2s.pk006.o6 wri2s Triticum aestiv... 38 0.17
gb|CA747065.1|CA747065 wri2s.pk007.n5 wri2s Triticum aestiv... 38 0.17
gb|CA747132.1|CA747132 wri2s.pk007.d22 wri2s Triticum aesti... 38 0.17
gb|AJ602472.1|AJ602472 AJ602472 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602522.1|AJ602522 AJ602522 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602621.1|AJ602621 AJ602621 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602661.1|AJ602661 AJ602661 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602675.1|AJ602675 AJ602675 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602744.1|AJ602744 AJ602744 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602774.1|AJ602774 AJ602774 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602777.1|AJ602777 AJ602777 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602896.1|AJ602896 AJ602896 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602906.1|AJ602906 AJ602906 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602913.1|AJ602913 AJ602913 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ602973.1|AJ602973 AJ602973 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603065.1|AJ603065 AJ603065 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603068.1|AJ603068 AJ603068 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603082.1|AJ603082 AJ603082 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603091.1|AJ603091 AJ603091 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603130.1|AJ603130 AJ603130 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603299.1|AJ603299 AJ603299 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603379.1|AJ603379 AJ603379 T06 Triticum aestivum cDNA ... 38 0.17
gb|AJ603473.1|AJ603473 AJ603473 T06 Triticum aestivum cDNA ... 38 0.17
gb|CK153179.1|CK153179 FGAS031753 Triticum aestivum FGAS: T... 38 0.17
gb|CK153652.1|CK153652 FGAS032300 Triticum aestivum FGAS: T... 38 0.17
gb|CK155850.1|CK155850 FGAS036715 Triticum aestivum FGAS: T... 38 0.17
gb|CK156229.1|CK156229 FGAS037162 Triticum aestivum FGAS: T... 38 0.17
gb|CK157327.1|CK157327 FGAS038429 Triticum aestivum FGAS: T... 38 0.17
gb|CK157668.1|CK157668 FGAS038820 Triticum aestivum FGAS: T... 38 0.17
gb|CK157848.1|CK157848 FGAS039030 Triticum aestivum FGAS: T... 38 0.17
gb|CK158577.1|CK158577 FGAS039852 Triticum aestivum FGAS: T... 38 0.17
gb|CK171125.1|CK171125 FGAS046259 Triticum aestivum FGAS: T... 38 0.17
gb|CV522850.1|CV522850 LH-209 Triticum aestivum subtracted,... 38 0.17
gb|CV522859.1|CV522859 LH-221 Triticum aestivum subtracted,... 38 0.17
gb|CV522922.1|CV522922 LH-64 Triticum aestivum subtracted, ... 38 0.17
gb|CV523019.1|CV523019 LP-25 Triticum aestivum subtracted, ... 38 0.17
gb|CV523095.1|CV523095 LP-158 Triticum aestivum subtracted,... 38 0.17
gb|DR752093.1|DR752093 G4-269 Wheat Aluminum SSH Library Tr... 38 0.17
>gb|CK194020.1|CK194020 FGAS002439 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 840
Score = 87.7 bits (44), Expect = 2e-016
Identities = 119/144 (82%)
Strand = Plus / Plus
Query: 1 ggatcacccaaaaactcaccctgcacagaaaaatttcctcttactccaaacaatccatat 60
|||||||| || ||||||||||||||||| | |||||||| ||| |||||||||||
Sbjct: 176 ggatcacctaagaactcaccctgcacagaggagtttcctctccttccgcacaatccatat 235
Query: 61 ggcaaaacaaagctcgttgttgaggatatttgccgggatatctaccgttcagatcctgaa 120
|||| ||| ||||| | | |||||| || ||||| ||||| ||||| |||||| ||||
Sbjct: 236 ggcagaaccaagcttatggctgaggagatatgccgtgatatataccggtcagattctgag 295
Query: 121 tggaagatcattttacttaggtac 144
|||| ||||||||||||||||||
Sbjct: 296 tggagaatcattttacttaggtac 319
>gb|CK203901.1|CK203901 FGAS012436 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 858
Score = 87.7 bits (44), Expect = 2e-016
Identities = 119/144 (82%)
Strand = Plus / Plus
Query: 1 ggatcacccaaaaactcaccctgcacagaaaaatttcctcttactccaaacaatccatat 60
|||||||| || ||||||||||||||||| | |||||||| ||| |||||||||||
Sbjct: 191 ggatcacctaagaactcaccctgcacagaggagtttcctctccttccgcacaatccatat 250
Query: 61 ggcaaaacaaagctcgttgttgaggatatttgccgggatatctaccgttcagatcctgaa 120
|||| ||| ||||| | | |||||| || ||||| ||||| ||||| |||||| ||||
Sbjct: 251 ggcagaaccaagcttatggctgaggagatatgccgtgatatataccggtcagattctgag 310
Query: 121 tggaagatcattttacttaggtac 144
|||| ||||||||||||||||||
Sbjct: 311 tggagaatcattttacttaggtac 334
>gb|CK204227.1|CK204227 FGAS012763 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 812
Score = 87.7 bits (44), Expect = 2e-016
Identities = 119/144 (82%)
Strand = Plus / Plus
Query: 1 ggatcacccaaaaactcaccctgcacagaaaaatttcctcttactccaaacaatccatat 60
|||||||| || ||||||||||||||||| | |||||||| ||| |||||||||||
Sbjct: 192 ggatcacctaagaactcaccctgcacagaggagtttcctctccttccgcacaatccatat 251
Query: 61 ggcaaaacaaagctcgttgttgaggatatttgccgggatatctaccgttcagatcctgaa 120
|||| ||| ||||| | | |||||| || ||||| ||||| ||||| |||||| ||||
Sbjct: 252 ggcagaaccaagcttatggctgaggagatatgccgtgatatataccggtcagattctgag 311
Query: 121 tggaagatcattttacttaggtac 144
|||| ||||||||||||||||||
Sbjct: 312 tggagaatcattttacttaggtac 335
>gb|CA667900.1|CA667900 wlsu1.pk015.e16 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.e16
5' end, mRNA sequence
Length = 518
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcgaa 164
||||||||||||||||||||||||
Sbjct: 40 gtacctgccgggcggccgctcgaa 17
>gb|CA669552.1|CA669552 wlsu1.pk021.h2 wlsu1 Triticum aestivum cDNA clone wlsu1.pk021.h2 5'
end, mRNA sequence
Length = 428
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcgaa 164
||||||||||||||||||||||||
Sbjct: 39 gtacctgccgggcggccgctcgaa 16
>gb|CA735308.1|CA735308 wpi1s.pk004.c10 wpi1s Triticum aestivum cDNA clone wpi1s.pk004.c10
5' end, mRNA sequence
Length = 420
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 141 gtacctgccgggcggccgctcgaa 164
||||||||||||||||||||||||
Sbjct: 397 gtacctgccgggcggccgctcgaa 420
>gb|CA737110.1|CA737110 wpi1s.pk009.f20 wpi1s Triticum aestivum cDNA clone wpi1s.pk009.f20
5' end, mRNA sequence
Length = 362
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 141 gtacctgccgggcggccgctcgaa 164
||||||||||||||||||||||||
Sbjct: 339 gtacctgccgggcggccgctcgaa 362
>gb|CA742666.1|CA742666 wri1s.pk001.h11 wri1s Triticum aestivum cDNA clone wri1s.pk001.h11
5' end, mRNA sequence
Length = 314
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 140 ggtacctgccgggcggccgctcga 163
||||||||||||||||||||||||
Sbjct: 24 ggtacctgccgggcggccgctcga 1
>gb|AJ602516.1|AJ602516 AJ602516 T06 Triticum aestivum cDNA clone G06_T06_plate_11, mRNA
sequence
Length = 339
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcgaa 164
||||||||||||||||||||||||
Sbjct: 28 gtacctgccgggcggccgctcgaa 5
>gb|AJ603412.1|AJ603412 AJ603412 T06 Triticum aestivum cDNA clone G06_T06_plate_69, mRNA
sequence
Length = 135
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 140 ggtacctgccgggcggccgctcga 163
||||||||||||||||||||||||
Sbjct: 112 ggtacctgccgggcggccgctcga 135
>gb|AJ603416.1|AJ603416 AJ603416 T06 Triticum aestivum cDNA clone A07_T06_plate_7, mRNA
sequence
Length = 196
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 140 ggtacctgccgggcggccgctcga 163
||||||||||||||||||||||||
Sbjct: 173 ggtacctgccgggcggccgctcga 196
>gb|CA667120.1|CA667120 wlsu1.pk0012.c2 wlsu1 Triticum aestivum cDNA clone wlsu1.pk0012.c2
5' end, mRNA sequence
Length = 202
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 142 tacctgccgggcggccgctcgaa 164
|||||||||||||||||||||||
Sbjct: 178 tacctgccgggcggccgctcgaa 200
>gb|CA667202.1|CA667202 wlsu1.pk0014.d10 wlsu1 Triticum aestivum cDNA clone
wlsu1.pk0014.d10 5' end, mRNA sequence
Length = 249
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcgaa 164
|||||||||||||||||||||||
Sbjct: 38 tacctgccgggcggccgctcgaa 16
>gb|CA667566.1|CA667566 wlsu1.pk017.m11 wlsu1 Triticum aestivum cDNA clone wlsu1.pk017.m11
5' end, mRNA sequence
Length = 513
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcgaa 164
|||||||||||||||||||||||
Sbjct: 38 tacctgccgggcggccgctcgaa 16
>gb|CA668407.1|CA668407 wlsu1.pk019.l14 wlsu1 Triticum aestivum cDNA clone wlsu1.pk019.l14
5' end, mRNA sequence
Length = 460
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcgaa 164
|||||||||||||||||||||||
Sbjct: 39 tacctgccgggcggccgctcgaa 17
>gb|CA668928.1|CA668928 wlsu1.pk023.g6 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.g6 5'
end, mRNA sequence
Length = 420
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcgaa 164
|||||||||||||||||||||||
Sbjct: 38 tacctgccgggcggccgctcgaa 16
>gb|CA675588.1|CA675588 wlsu2.pk027.j2 wlsu2 Triticum aestivum cDNA clone wlsu2.pk027.j2 5'
end, mRNA sequence
Length = 448
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CA736694.1|CA736694 wpi1s.pk008.h11 wpi1s Triticum aestivum cDNA clone wpi1s.pk008.h11
5' end, mRNA sequence
Length = 272
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CA742743.1|CA742743 wri1s.pk004.n3 wri1s Triticum aestivum cDNA clone wri1s.pk004.n3 5'
end, mRNA sequence
Length = 364
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CA743753.1|CA743753 wri1s.pk005.f13 wri1s Triticum aestivum cDNA clone wri1s.pk005.f13
5' end, mRNA sequence
Length = 156
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CA745340.1|CA745340 wri2s.pk001.k3 wri2s Triticum aestivum cDNA clone wri2s.pk001.k3 5'
end, mRNA sequence
Length = 503
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CA746570.1|CA746570 wri2s.pk004.o5 wri2s Triticum aestivum cDNA clone wri2s.pk004.o5 5'
end, mRNA sequence
Length = 151
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 129 gtacctgccgggcggccgctcga 151
>gb|AJ603204.1|AJ603204 AJ603204 T06 Triticum aestivum cDNA clone D02_T06_plate_61, mRNA
sequence
Length = 382
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 23 gtacctgccgggcggccgctcga 1
>gb|CV522403.1|CV522403 RH-322 Triticum aestivum subtracted, clontech Triticum aestivum
cDNA, mRNA sequence
Length = 292
Score = 46.1 bits (23), Expect = 7e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 141 gtacctgccgggcggccgctcga 163
|||||||||||||||||||||||
Sbjct: 252 gtacctgccgggcggccgctcga 274
>gb|CA667112.1|CA667112 wlsu1.pk0012.f9 wlsu1 Triticum aestivum cDNA clone wlsu1.pk0012.f9
5' end, mRNA sequence
Length = 271
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA667426.1|CA667426 wlsu1.pk018.m19 wlsu1 Triticum aestivum cDNA clone wlsu1.pk018.m19
5' end, mRNA sequence
Length = 478
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA667503.1|CA667503 wlsu1.pk015.h12 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.h12
5' end, mRNA sequence
Length = 300
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA667546.1|CA667546 wlsu1.pk017.o23 wlsu1 Triticum aestivum cDNA clone wlsu1.pk017.o23
5' end, mRNA sequence
Length = 267
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA667668.1|CA667668 wlsu1.pk017.e6 wlsu1 Triticum aestivum cDNA clone wlsu1.pk017.e6 5'
end, mRNA sequence
Length = 448
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA667784.1|CA667784 wlsu1.pk015.o1 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.o1 5'
end, mRNA sequence
Length = 418
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA667844.1|CA667844 wlsu1.pk015.c5 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.c5 5'
end, mRNA sequence
Length = 545
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA667962.1|CA667962 wlsu1.pk015.n15 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.n15
5' end, mRNA sequence
Length = 534
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA668095.1|CA668095 wlsu1.pk017.j22 wlsu1 Triticum aestivum cDNA clone wlsu1.pk017.j22
5' end, mRNA sequence
Length = 201
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA668443.1|CA668443 wlsu1.pk019.l9 wlsu1 Triticum aestivum cDNA clone wlsu1.pk019.l9 5'
end, mRNA sequence
Length = 468
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA668668.1|CA668668 wlsu1.pk021.p7 wlsu1 Triticum aestivum cDNA clone wlsu1.pk021.p7 5'
end, mRNA sequence
Length = 252
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA668810.1|CA668810 wlsu1.pk023.o9 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.o9 5'
end, mRNA sequence
Length = 176
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA668817.1|CA668817 wlsu1.pk023.g1 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.g1 5'
end, mRNA sequence
Length = 233
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA668961.1|CA668961 wlsu1.pk023.m6 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.m6 5'
end, mRNA sequence
Length = 226
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669112.1|CA669112 wlsu1.pk023.f23 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.f23
5' end, mRNA sequence
Length = 273
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669201.1|CA669201 wlsu1.pk021.o24 wlsu1 Triticum aestivum cDNA clone wlsu1.pk021.o24
5' end, mRNA sequence
Length = 313
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA669465.1|CA669465 wlsu1.pk022.f11 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.f11
5' end, mRNA sequence
Length = 438
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 38 acctgccgggcggccgctcgaa 17
>gb|CA669529.1|CA669529 wlsu1.pk022.m22 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.m22
5' end, mRNA sequence
Length = 427
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669538.1|CA669538 wlsu1.pk022.g18 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.g18
5' end, mRNA sequence
Length = 430
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669653.1|CA669653 wlsu1.pk022.g1 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.g1 5'
end, mRNA sequence
Length = 427
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669691.1|CA669691 wlsu1.pk022.j8 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.j8 5'
end, mRNA sequence
Length = 434
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669730.1|CA669730 wlsu1.pk022.l22 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.l22
5' end, mRNA sequence
Length = 429
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA669822.1|CA669822 wlsu1.pk018.d1 wlsu1 Triticum aestivum cDNA clone wlsu1.pk018.d1 5'
end, mRNA sequence
Length = 461
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 143 acctgccgggcggccgctcgaa 164
||||||||||||||||||||||
Sbjct: 37 acctgccgggcggccgctcgaa 16
>gb|CA670385.1|CA670385 wlsu1.pk026.g22 wlsu1 Triticum aestivum cDNA clone wlsu1.pk026.g22
5' end, mRNA sequence
Length = 408
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcga 163
||||||||||||||||||||||
Sbjct: 22 tacctgccgggcggccgctcga 1
>gb|CA670459.1|CA670459 wlsu1.pk026.b7 wlsu1 Triticum aestivum cDNA clone wlsu1.pk026.b7 5'
end, mRNA sequence
Length = 453
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcga 163
||||||||||||||||||||||
Sbjct: 22 tacctgccgggcggccgctcga 1
>gb|CA674495.1|CA674495 wlsu2.pk024.m13 wlsu2 Triticum aestivum cDNA clone wlsu2.pk024.m13
5' end, mRNA sequence
Length = 230
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 142 tacctgccgggcggccgctcga 163
||||||||||||||||||||||
Sbjct: 22 tacctgccgggcggccgctcga 1
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 57,430
Number of Sequences: 636343
Number of extensions: 57430
Number of successful extensions: 33316
Number of sequences better than 0.5: 216
Number of HSP's better than 0.5 without gapping: 120
Number of HSP's successfully gapped in prelim test: 96
Number of HSP's that attempted gapping in prelim test: 33162
Number of HSP's gapped (non-prelim): 218
length of query: 164
length of database: 367,240,239
effective HSP length: 18
effective length of query: 146
effective length of database: 355,786,065
effective search space: 51944765490
effective search space used: 51944765490
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)