BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF12e06.yg.2.1
         (561 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF133885.1|CF133885  WHE4364_G12_M24ZT Wheat meiotic flor...   147   9e-034
gb|CK208073.1|CK208073  FGAS019754 Triticum aestivum FGAS: L...    52   4e-005

>gb|CF133885.1|CF133885 WHE4364_G12_M24ZT Wheat meiotic floret cDNA library Triticum
           aestivum cDNA clone WHE4364_G12_M24, mRNA sequence
          Length = 732

 Score =  147 bits (74), Expect = 9e-034
 Identities = 125/142 (88%)
 Strand = Plus / Minus

                                                                       
Query: 403 catgggttgagtcaggccttggacatgattatggaatcagccatgtcgatatagagaagg 462
           |||||||| |||| || |||||| | ||||||||||| |||| |||||||||||| ||||
Sbjct: 732 catgggttcagtccggtcttggatacgattatggaattagccgtgtcgatatagaaaagg 673

                                                                       
Query: 463 ctgctactctgcactacaatggtgtgatgaaaccttggcttgacttggggatacttgatt 522
           | ||| ||||||||||||||||||| ||||||||||||||||| ||||  |||| |||||
Sbjct: 672 cggctgctctgcactacaatggtgtcatgaaaccttggcttgatttggcaatacatgatt 613

                                 
Query: 523 acaagaactactggaggaagta 544
           |||||| ||||||||| |||||
Sbjct: 612 acaagagctactggagaaagta 591



>gb|CK208073.1|CK208073 FGAS019754 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
           aestivum cDNA, mRNA sequence
          Length = 1052

 Score = 52.0 bits (26), Expect = 4e-005
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 472 tgcactacaatggtgtgatgaaaccttggcttgacttggggatacttgattacaagaact 531
           ||||||||||||||   ||||||||||||||||| ||||| ||||   |||||| ||| |
Sbjct: 626 tgcactacaatggtaatatgaaaccttggcttgaattgggtataccaaattacaggaagt 685

                 
Query: 532 actgga 537
           ||||||
Sbjct: 686 actgga 691



  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 87,893
Number of Sequences: 636343
Number of extensions: 87893
Number of successful extensions: 22039
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22036
Number of HSP's gapped (non-prelim): 3
length of query: 561
length of database: 367,240,239
effective HSP length: 19
effective length of query: 542
effective length of database: 355,149,722
effective search space: 192491149324
effective search space used: 192491149324
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)