BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE20c02.yg.2.1
(696 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE400791.1|BE400791 AWB007.C05F000328 ITEC AWB Wheat Mei... 285 2e-075
gb|CV782404.1|CV782404 FGAS076817 Triticum aestivum FGAS: L... 278 5e-073
gb|CD895052.1|CD895052 G118.127N13F010824 G118 Triticum aes... 270 1e-070
gb|BQ802514.1|BQ802514 WHE2826_G09_M18ZS Triticum monococcu... 262 3e-068
gb|CK207361.1|CK207361 FGAS018982 Triticum aestivum FGAS: L... 262 3e-068
gb|BE607053.1|BE607053 WHE0915_G06_N11ZS Wheat 5-15 DAP spi... 240 1e-061
gb|BF483002.1|BF483002 WHE2313_E11_I21ZS Wheat pre-anthesis... 238 4e-061
gb|BE517860.1|BE517860 WHE0803_A03_B05ZS Wheat vernalized c... 180 8e-044
gb|CD896524.1|CD896524 G174.103C01F010822 G174 Triticum aes... 180 8e-044
gb|DR739724.1|DR739724 FGAS084941 Triticum aestivum FGAS: L... 180 8e-044
gb|BQ902450.1|BQ902450 Ta02_02e05_R Ta02_AAFC_ECORC_Fusariu... 176 1e-042
gb|CK199186.1|CK199186 FGAS007680 Triticum aestivum FGAS: L... 174 5e-042
gb|BJ210112.1|BJ210112 BJ210112 Y. Ogihara unpublished cDNA... 172 2e-041
gb|CK207850.1|CK207850 FGAS019519 Triticum aestivum FGAS: L... 165 5e-039
gb|BQ902349.1|BQ902349 Ta02_03h02_R Ta02_AAFC_ECORC_Fusariu... 155 5e-036
gb|DR736805.1|DR736805 FGAS082175 Triticum aestivum FGAS: L... 145 5e-033
gb|CA709393.1|CA709393 wdk2c.pk012.l16 wdk2c Triticum aesti... 137 1e-030
gb|BJ246270.1|BJ246270 BJ246270 Y. Ogihara unpublished cDNA... 135 5e-030
gb|BJ270032.1|BJ270032 BJ270032 Y. Ogihara unpublished cDNA... 133 2e-029
gb|CK151519.1|CK151519 FGAS034088 Triticum aestivum FGAS: T... 133 2e-029
gb|BT009232.1| Triticum aestivum clone wle1n.pk0102.g9:fis,... 133 2e-029
gb|BE497655.1|BE497655 WHE955_G04_M07ZS Wheat pre-anthesis ... 129 3e-028
gb|AL829613.1|AL829613 AL829613 p:840 Triticum aestivum cDN... 119 3e-025
gb|CA635613.1|CA635613 wle1n.pk0102.g9 wle1n Triticum aesti... 119 3e-025
gb|CA646056.1|CA646056 wre1n.pk0105.e12 wre1n Triticum aest... 119 3e-025
gb|BJ207587.1|BJ207587 BJ207587 Y. Ogihara unpublished cDNA... 117 1e-024
gb|BU100454.1|BU100454 WHE3353_E04_J07ZS Chinese Spring alu... 109 3e-022
gb|BJ281281.1|BJ281281 BJ281281 Y. Ogihara unpublished cDNA... 109 3e-022
gb|BG607282.1|BG607282 WHE2493_F04_L07ZS Triticum monococcu... 107 1e-021
gb|DR733159.1|DR733159 FGAS078921 Triticum aestivum FGAS: L... 103 2e-020
gb|BQ901706.1|BQ901706 Ta02_15c07_R Ta02_AAFC_ECORC_Fusariu... 92 6e-017
gb|BQ901504.1|BQ901504 Ta02_16d03_R Ta02_AAFC_ECORC_Fusariu... 86 4e-015
gb|BF483316.1|BF483316 WHE1791_D05_G09ZS Wheat pre-anthesis... 80 2e-013
gb|CD897157.1|CD897157 G174.104P23F010823 G174 Triticum aes... 80 2e-013
gb|CK209455.1|CK209455 FGAS021221 Triticum aestivum FGAS: L... 80 2e-013
gb|CA605028.1|CA605028 wr1.pk0046.b2 wr1 Triticum aestivum ... 78 9e-013
gb|BI751302.1|BI751302 Ta01_16f07_R Ta01_AAFC_ECORC_Fusariu... 74 1e-011
gb|BI751475.1|BI751475 Ta01_20d11_R Ta01_AAFC_ECORC_Fusariu... 74 1e-011
gb|CA712867.1|CA712867 wdk3c.pk015.l11 wdk3c Triticum aesti... 74 1e-011
gb|CD894557.1|CD894557 G118.126I10F010823 G118 Triticum aes... 72 6e-011
gb|BM138675.1|BM138675 WHE0496_E09_I18ZS Wheat Fusarium gra... 66 3e-009
gb|CD930609.1|CD930609 GR45.111N11R010612 GR45 Triticum aes... 64 1e-008
gb|BF473283.1|BF473283 WHE0926_F12_K24ZS Wheat 5-15 DAP spi... 58 8e-007
gb|BJ218685.1|BJ218685 BJ218685 Y. Ogihara unpublished cDNA... 58 8e-007
gb|AL810577.1|AL810577 AL810577 e:29 Triticum aestivum cDNA... 56 3e-006
gb|BQ483400.1|BQ483400 WHE3508_B06_D12ZS Wheat unstressed r... 52 5e-005
gb|CA735990.1|CA735990 wpi1s.pk006.e4 wpi1s Triticum aestiv... 50 2e-004
gb|CA736813.1|CA736813 wpi1s.pk008.h16 wpi1s Triticum aesti... 50 2e-004
gb|CA742769.1|CA742769 wri1s.pk004.l3 wri1s Triticum aestiv... 50 2e-004
gb|CA743039.1|CA743039 wri1s.pk002.k21 wri1s Triticum aesti... 50 2e-004
gb|CA746056.1|CA746056 wri2s.pk003.e24 wri2s Triticum aesti... 50 2e-004
gb|CA725947.1|CA725947 wet1s.pk001.f24 wet1s Triticum aesti... 48 8e-004
gb|CA726364.1|CA726364 wet1s.pk003.o6 wet1s Triticum aestiv... 48 8e-004
gb|CA734783.1|CA734783 wpi1s.pk002.o11 wpi1s Triticum aesti... 48 8e-004
gb|CA735224.1|CA735224 wpi1s.pk003.p10 wpi1s Triticum aesti... 48 8e-004
gb|CA735985.1|CA735985 wpi1s.pk006.o20 wpi1s Triticum aesti... 48 8e-004
gb|CA736378.1|CA736378 wpi1s.pk007.f11 wpi1s Triticum aesti... 48 8e-004
gb|CA736539.1|CA736539 wpi1s.pk007.d5 wpi1s Triticum aestiv... 48 8e-004
gb|CA736612.1|CA736612 wpi1s.pk008.g15 wpi1s Triticum aesti... 48 8e-004
gb|CA736708.1|CA736708 wpi1s.pk008.m16 wpi1s Triticum aesti... 48 8e-004
gb|CA737135.1|CA737135 wpi1s.pk009.c8 wpi1s Triticum aestiv... 48 8e-004
gb|CA737505.1|CA737505 wpi2s.pk004.g4 wpi2s Triticum aestiv... 48 8e-004
gb|CA737741.1|CA737741 wpi2s.pk004.b16 wpi2s Triticum aesti... 48 8e-004
gb|CA737908.1|CA737908 wpi2s.pk005.i24 wpi2s Triticum aesti... 48 8e-004
gb|CA738817.1|CA738817 wpi2s.pk002.e8 wpi2s Triticum aestiv... 48 8e-004
gb|CA739011.1|CA739011 wpi2s.pk009.m16 wpi2s Triticum aesti... 48 8e-004
gb|CA739687.1|CA739687 wpi2s.pk010.n11 wpi2s Triticum aesti... 48 8e-004
gb|CA742585.1|CA742585 wri1s.pk001.n12 wri1s Triticum aesti... 48 8e-004
gb|CA742960.1|CA742960 wri1s.pk004.e18 wri1s Triticum aesti... 48 8e-004
gb|CA743892.1|CA743892 wri1s.pk006.a5 wri1s Triticum aestiv... 48 8e-004
gb|CA744327.1|CA744327 wri1s.pk007.a18 wri1s Triticum aesti... 48 8e-004
gb|CA744360.1|CA744360 wri1s.pk007.b17 wri1s Triticum aesti... 48 8e-004
gb|AJ602879.1|AJ602879 AJ602879 T06 Triticum aestivum cDNA ... 48 8e-004
gb|AJ603025.1|AJ603025 AJ603025 T06 Triticum aestivum cDNA ... 48 8e-004
gb|AJ603345.1|AJ603345 AJ603345 T06 Triticum aestivum cDNA ... 48 8e-004
gb|AJ603447.1|AJ603447 AJ603447 T06 Triticum aestivum cDNA ... 48 8e-004
gb|CV522531.1|CV522531 RP-242 Triticum aestivum subtracted,... 48 8e-004
gb|BE445079.1|BE445079 WHE1131_B08_D15ZS Wheat etiolated se... 46 0.003
gb|BQ295018.1|BQ295018 WHE2857_D02_H03ZS Wheat unstressed r... 46 0.003
gb|BJ214871.1|BJ214871 BJ214871 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ252204.1|BJ252204 BJ252204 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ279176.1|BJ279176 BJ279176 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ284237.1|BJ284237 BJ284237 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ286347.1|BJ286347 BJ286347 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ311537.1|BJ311537 BJ311537 Y. Ogihara unpublished cDNA... 46 0.003
gb|CA483765.1|CA483765 28 A. Wheat subtracted library enric... 46 0.003
gb|CA651587.1|CA651587 wre1n.pk176.e5 wre1n Triticum aestiv... 46 0.003
gb|CA669697.1|CA669697 wlsu1.pk022.b8 wlsu1 Triticum aestiv... 46 0.003
gb|CA714922.1|CA714922 wdk3c.pk021.p8 wdk3c Triticum aestiv... 46 0.003
gb|CA725781.1|CA725781 wet1s.pk001.o23 wet1s Triticum aesti... 46 0.003
gb|CA726086.1|CA726086 wet1s.pk002.c20 wet1s Triticum aesti... 46 0.003
gb|CA726302.1|CA726302 wet1s.pk002.d16 wet1s Triticum aesti... 46 0.003
gb|CA726334.1|CA726334 wet1s.pk003.g14 wet1s Triticum aesti... 46 0.003
gb|CA726347.1|CA726347 wet1s.pk003.o10 wet1s Triticum aesti... 46 0.003
gb|CA726379.1|CA726379 wet1s.pk003.m18 wet1s Triticum aesti... 46 0.003
gb|CA726415.1|CA726415 wet1s.pk003.n3 wet1s Triticum aestiv... 46 0.003
gb|CA726583.1|CA726583 wet1s.pk003.n10 wet1s Triticum aesti... 46 0.003
gb|CA734831.1|CA734831 wpi1s.pk002.o17 wpi1s Triticum aesti... 46 0.003
gb|CA734944.1|CA734944 wpi1s.pk002.j18 wpi1s Triticum aesti... 46 0.003
gb|CA734969.1|CA734969 wpi1s.pk003.a19 wpi1s Triticum aesti... 46 0.003
gb|CA735123.1|CA735123 wpi1s.pk003.l23 wpi1s Triticum aesti... 46 0.003
gb|CA735386.1|CA735386 wpi1s.pk003.i10 wpi1s Triticum aesti... 46 0.003
gb|CA735441.1|CA735441 wpi1s.pk003.m2 wpi1s Triticum aestiv... 46 0.003
gb|CA735552.1|CA735552 wpi1s.pk003.g10 wpi1s Triticum aesti... 46 0.003
gb|CA735622.1|CA735622 wpi1s.pk004.p10 wpi1s Triticum aesti... 46 0.003
gb|CA735670.1|CA735670 wpi1s.pk005.g21 wpi1s Triticum aesti... 46 0.003
gb|CA736182.1|CA736182 wpi1s.pk006.n2 wpi1s Triticum aestiv... 46 0.003
gb|CA736426.1|CA736426 wpi1s.pk007.j15 wpi1s Triticum aesti... 46 0.003
gb|CA736490.1|CA736490 wpi1s.pk007.f22 wpi1s Triticum aesti... 46 0.003
gb|CA736635.1|CA736635 wpi1s.pk008.i5 wpi1s Triticum aestiv... 46 0.003
gb|CA736670.1|CA736670 wpi1s.pk008.m22 wpi1s Triticum aesti... 46 0.003
gb|CA736774.1|CA736774 wpi1s.pk008.d10 wpi1s Triticum aesti... 46 0.003
gb|CA736819.1|CA736819 wpi1s.pk008.f16 wpi1s Triticum aesti... 46 0.003
gb|CA736911.1|CA736911 wpi1s.pk008.l14 wpi1s Triticum aesti... 46 0.003
gb|CA737002.1|CA737002 wpi1s.pk009.d7 wpi1s Triticum aestiv... 46 0.003
gb|CA737129.1|CA737129 wpi1s.pk009.d15 wpi1s Triticum aesti... 46 0.003
gb|CA737500.1|CA737500 wpi2s.pk004.i21 wpi2s Triticum aesti... 46 0.003
gb|CA737642.1|CA737642 wpi2s.pk004.d3 wpi2s Triticum aestiv... 46 0.003
gb|CA737658.1|CA737658 wpi2s.pk004.j22 wpi2s Triticum aesti... 46 0.003
gb|CA737684.1|CA737684 wpi2s.pk004.o18 wpi2s Triticum aesti... 46 0.003
gb|CA738399.1|CA738399 wpi2s.pk006.k24 wpi2s Triticum aesti... 46 0.003
gb|CA738435.1|CA738435 wpi2s.pk006.b24 wpi2s Triticum aesti... 46 0.003
gb|CA738699.1|CA738699 wpi2s.pk002.i10 wpi2s Triticum aesti... 46 0.003
gb|CA738771.1|CA738771 wpi2s.pk008.d3 wpi2s Triticum aestiv... 46 0.003
gb|CA738952.1|CA738952 wpi2s.pk008.d12 wpi2s Triticum aesti... 46 0.003
gb|CA739143.1|CA739143 wpi2s.pk009.h10 wpi2s Triticum aesti... 46 0.003
gb|CA739175.1|CA739175 wpi2s.pk009.l7 wpi2s Triticum aestiv... 46 0.003
gb|CA739356.1|CA739356 wpi2s.pk007.k3 wpi2s Triticum aestiv... 46 0.003
gb|CA739617.1|CA739617 wpi2s.pk010.g7 wpi2s Triticum aestiv... 46 0.003
gb|CA739663.1|CA739663 wpi2s.pk010.a10 wpi2s Triticum aesti... 46 0.003
gb|CA739669.1|CA739669 wpi2s.pk010.b13 wpi2s Triticum aesti... 46 0.003
gb|CA739815.1|CA739815 wpi2s.pk010.p16 wpi2s Triticum aesti... 46 0.003
gb|CA740892.1|CA740892 wet2s.pk004.l4 wet2s Triticum aestiv... 46 0.003
gb|CA742642.1|CA742642 wri1s.pk001.d24 wri1s Triticum aesti... 46 0.003
gb|CA743170.1|CA743170 wri1s.pk004.f18 wri1s Triticum aesti... 46 0.003
gb|CA743293.1|CA743293 wri1s.pk002.i18 wri1s Triticum aesti... 46 0.003
gb|CA743365.1|CA743365 wri1s.pk005.a13 wri1s Triticum aesti... 46 0.003
gb|CA743427.1|CA743427 wri1s.pk003.i18 wri1s Triticum aesti... 46 0.003
gb|CA744111.1|CA744111 wri1s.pk006.p5 wri1s Triticum aestiv... 46 0.003
gb|CA744602.1|CA744602 wri1s.pk008.b22 wri1s Triticum aesti... 46 0.003
gb|CA744646.1|CA744646 wri1s.pk008.d16 wri1s Triticum aesti... 46 0.003
gb|CA746179.1|CA746179 wri2s.pk005.c20 wri2s Triticum aesti... 46 0.003
gb|CA746435.1|CA746435 wri2s.pk007.o1 wri2s Triticum aestiv... 46 0.003
gb|CA747214.1|CA747214 wri2s.pk008.c10.f wri2s Triticum aes... 46 0.003
gb|CD929827.1|CD929827 GR45.109E09R010612 GR45 Triticum aes... 46 0.003
gb|AJ602577.1|AJ602577 AJ602577 T06 Triticum aestivum cDNA ... 46 0.003
gb|AJ602817.1|AJ602817 AJ602817 T06 Triticum aestivum cDNA ... 46 0.003
gb|AJ602880.1|AJ602880 AJ602880 T06 Triticum aestivum cDNA ... 46 0.003
gb|AJ602958.1|AJ602958 AJ602958 T06 Triticum aestivum cDNA ... 46 0.003
gb|AJ603400.1|AJ603400 AJ603400 T06 Triticum aestivum cDNA ... 46 0.003
gb|CV523065.1|CV523065 LP-103 Triticum aestivum subtracted,... 46 0.003
gb|CV780327.1|CV780327 FGAS074736 Triticum aestivum FGAS: L... 46 0.003
gb|DN828918.1|DN828918 KUCD01_02_D11_T3 WSWR cDNA library T... 46 0.003
gb|BE442549.1|BE442549 WHE1103_E09_J17ZS Wheat etiolated se... 44 0.013
gb|CA725680.1|CA725680 wet1s.pk001.c14 wet1s Triticum aesti... 44 0.013
gb|CA725682.1|CA725682 wet1s.pk001.g16 wet1s Triticum aesti... 44 0.013
gb|CA725745.1|CA725745 wet1s.pk001.g12 wet1s Triticum aesti... 44 0.013
gb|CA725826.1|CA725826 wet1s.pk001.f15 wet1s Triticum aesti... 44 0.013
gb|CA725853.1|CA725853 wet1s.pk001.b23 wet1s Triticum aesti... 44 0.013
gb|CA725858.1|CA725858 wet1s.pk001.f7 wet1s Triticum aestiv... 44 0.013
gb|CA725876.1|CA725876 wet1s.pk001.h13 wet1s Triticum aesti... 44 0.013
gb|CA725914.1|CA725914 wet1s.pk001.f12 wet1s Triticum aesti... 44 0.013
gb|CA725918.1|CA725918 wet1s.pk001.f20 wet1s Triticum aesti... 44 0.013
gb|CA725922.1|CA725922 wet1s.pk001.n18 wet1s Triticum aesti... 44 0.013
gb|CA725967.1|CA725967 wet1s.pk001.d4 wet1s Triticum aestiv... 44 0.013
gb|CA725984.1|CA725984 wet1s.pk001.h2 wet1s Triticum aestiv... 44 0.013
gb|CA726009.1|CA726009 wet1s.pk002.g17 wet1s Triticum aesti... 44 0.013
gb|CA726032.1|CA726032 wet1s.pk002.m11 wet1s Triticum aesti... 44 0.013
gb|CA726039.1|CA726039 wet1s.pk002.e23 wet1s Triticum aesti... 44 0.013
gb|CA726093.1|CA726093 wet1s.pk002.e12 wet1s Triticum aesti... 44 0.013
gb|CA726113.1|CA726113 wet1s.pk002.o14 wet1s Triticum aesti... 44 0.013
gb|CA726141.1|CA726141 wet1s.pk002.g6 wet1s Triticum aestiv... 44 0.013
gb|CA726224.1|CA726224 wet1s.pk002.l15 wet1s Triticum aesti... 44 0.013
gb|CA726275.1|CA726275 wet1s.pk002.n22 wet1s Triticum aesti... 44 0.013
gb|CA726276.1|CA726276 wet1s.pk002.n2 wet1s Triticum aestiv... 44 0.013
gb|CA726286.1|CA726286 wet1s.pk002.p2 wet1s Triticum aestiv... 44 0.013
gb|CA726305.1|CA726305 wet1s.pk002.d4 wet1s Triticum aestiv... 44 0.013
gb|CA726319.1|CA726319 wet1s.pk003.e18 wet1s Triticum aesti... 44 0.013
gb|CA726349.1|CA726349 wet1s.pk003.k12 wet1s Triticum aesti... 44 0.013
gb|CA726353.1|CA726353 wet1s.pk003.k16 wet1s Triticum aesti... 44 0.013
gb|CA726361.1|CA726361 wet1s.pk003.o18 wet1s Triticum aesti... 44 0.013
gb|CA726378.1|CA726378 wet1s.pk003.m10 wet1s Triticum aesti... 44 0.013
gb|CA726403.1|CA726403 wet1s.pk003.b3 wet1s Triticum aestiv... 44 0.013
gb|CA726408.1|CA726408 wet1s.pk003.f12 wet1s Triticum aesti... 44 0.013
gb|CA726418.1|CA726418 wet1s.pk003.n7 wet1s Triticum aestiv... 44 0.013
gb|CA726420.1|CA726420 wet1s.pk003.n6 wet1s Triticum aestiv... 44 0.013
gb|CA726425.1|CA726425 wet1s.pk003.l21 wet1s Triticum aesti... 44 0.013
gb|CA726434.1|CA726434 wet1s.pk003.j1 wet1s Triticum aestiv... 44 0.013
gb|CA726469.1|CA726469 wet1s.pk003.h10 wet1s Triticum aesti... 44 0.013
gb|CA726475.1|CA726475 wet1s.pk003.h4 wet1s Triticum aestiv... 44 0.013
gb|CA726477.1|CA726477 wet1s.pk003.h8 wet1s Triticum aestiv... 44 0.013
gb|CA726478.1|CA726478 wet1s.pk003.d17 wet1s Triticum aesti... 44 0.013
gb|CA726482.1|CA726482 wet1s.pk003.d2 wet1s Triticum aestiv... 44 0.013
gb|CA726528.1|CA726528 wet1s.pk003.a11 wet1s Triticum aesti... 44 0.013
gb|CA726529.1|CA726529 wet1s.pk003.a13 wet1s Triticum aesti... 44 0.013
gb|CA726543.1|CA726543 wet1s.pk003.l16 wet1s Triticum aesti... 44 0.013
gb|CA726546.1|CA726546 wet1s.pk003.l22 wet1s Triticum aesti... 44 0.013
gb|CA726547.1|CA726547 wet1s.pk003.p24 wet1s Triticum aesti... 44 0.013
gb|CA726572.1|CA726572 wet1s.pk003.k5 wet1s Triticum aestiv... 44 0.013
gb|CA734507.1|CA734507 wpi1s.pk001.e7 wpi1s Triticum aestiv... 44 0.013
gb|CA734788.1|CA734788 wpi1s.pk002.e23 wpi1s Triticum aesti... 44 0.013
gb|CA734808.1|CA734808 wpi1s.pk002.a5 wpi1s Triticum aestiv... 44 0.013
gb|CA734854.1|CA734854 wpi1s.pk002.i8 wpi1s Triticum aestiv... 44 0.013
gb|CA734892.1|CA734892 wpi1s.pk002.a6 wpi1s Triticum aestiv... 44 0.013
gb|CA734912.1|CA734912 wpi1s.pk002.c10 wpi1s Triticum aesti... 44 0.013
gb|CA734925.1|CA734925 wpi1s.pk002.n8 wpi1s Triticum aestiv... 44 0.013
gb|CA735032.1|CA735032 wpi1s.pk003.b12 wpi1s Triticum aesti... 44 0.013
gb|CA735055.1|CA735055 wpi1s.pk003.d1 wpi1s Triticum aestiv... 44 0.013
gb|CA735057.1|CA735057 wpi1s.pk003.d21 wpi1s Triticum aesti... 44 0.013
gb|CA735132.1|CA735132 wpi1s.pk002.j20 wpi1s Triticum aesti... 44 0.013
gb|CA735166.1|CA735166 wpi1s.pk004.e12 wpi1s Triticum aesti... 44 0.013
gb|CA735268.1|CA735268 wpi1s.pk004.c6 wpi1s Triticum aestiv... 44 0.013
gb|CA735275.1|CA735275 wpi1s.pk004.c24 wpi1s Triticum aesti... 44 0.013
gb|CA735299.1|CA735299 wpi1s.pk004.k8 wpi1s Triticum aestiv... 44 0.013
gb|CA735310.1|CA735310 wpi1s.pk004.c16 wpi1s Triticum aesti... 44 0.013
gb|CA735346.1|CA735346 wpi1s.pk004.m14 wpi1s Triticum aesti... 44 0.013
gb|CA735348.1|CA735348 wpi1s.pk004.m18 wpi1s Triticum aesti... 44 0.013
gb|CA735368.1|CA735368 wpi1s.pk002.h7 wpi1s Triticum aestiv... 44 0.013
gb|CA735374.1|CA735374 wpi1s.pk002.h19 wpi1s Triticum aesti... 44 0.013
gb|CA735394.1|CA735394 wpi1s.pk003.a24 wpi1s Triticum aesti... 44 0.013
gb|CA735405.1|CA735405 wpi1s.pk004.e9 wpi1s Triticum aestiv... 44 0.013
gb|CA735483.1|CA735483 wpi1s.pk004.a9 wpi1s Triticum aestiv... 44 0.013
gb|CA735521.1|CA735521 wpi1s.pk002.d3 wpi1s Triticum aestiv... 44 0.013
gb|CA735578.1|CA735578 wpi1s.pk004.b24 wpi1s Triticum aesti... 44 0.013
gb|CA735645.1|CA735645 wpi1s.pk004.k15 wpi1s Triticum aesti... 44 0.013
gb|CA735680.1|CA735680 wpi1s.pk005.a5 wpi1s Triticum aestiv... 44 0.013
gb|CA735707.1|CA735707 wpi1s.pk004.m11 wpi1s Triticum aesti... 44 0.013
gb|CA735724.1|CA735724 wpi1s.pk005.m1 wpi1s Triticum aestiv... 44 0.013
gb|CA735736.1|CA735736 wpi1s.pk005.g1 wpi1s Triticum aestiv... 44 0.013
gb|CA735752.1|CA735752 wpi1s.pk005.i13 wpi1s Triticum aesti... 44 0.013
gb|CA735769.1|CA735769 wpi1s.pk005.f13 wpi1s Triticum aesti... 44 0.013
gb|CA735777.1|CA735777 wpi1s.pk005.f23 wpi1s Triticum aesti... 44 0.013
gb|CA735780.1|CA735780 wpi1s.pk005.h19 wpi1s Triticum aesti... 44 0.013
gb|CA735809.1|CA735809 wpi1s.pk005.j9 wpi1s Triticum aestiv... 44 0.013
gb|CA735824.1|CA735824 wpi1s.pk005.a14 wpi1s Triticum aesti... 44 0.013
gb|CA735841.1|CA735841 wpi1s.pk005.h10 wpi1s Triticum aesti... 44 0.013
gb|CA735856.1|CA735856 wpi1s.pk005.j18 wpi1s Triticum aesti... 44 0.013
gb|CA735869.1|CA735869 wpi1s.pk005.l16 wpi1s Triticum aesti... 44 0.013
gb|CA735939.1|CA735939 wpi1s.pk005.p19 wpi1s Triticum aesti... 44 0.013
gb|CA735947.1|CA735947 wpi1s.pk005.p13 wpi1s Triticum aesti... 44 0.013
gb|CA735978.1|CA735978 wpi1s.pk006.h15 wpi1s Triticum aesti... 44 0.013
gb|CA736007.1|CA736007 wpi1s.pk006.c19 wpi1s Triticum aesti... 44 0.013
gb|CA736031.1|CA736031 wpi1s.pk006.m11 wpi1s Triticum aesti... 44 0.013
gb|CA736069.1|CA736069 wpi1s.pk006.i11 wpi1s Triticum aesti... 44 0.013
gb|CA736073.1|CA736073 wpi1s.pk006.i12 wpi1s Triticum aesti... 44 0.013
gb|CA736104.1|CA736104 wpi1s.pk006.e12 wpi1s Triticum aesti... 44 0.013
gb|CA736174.1|CA736174 wpi1s.pk006.d24 wpi1s Triticum aesti... 44 0.013
gb|CA736200.1|CA736200 wpi1s.pk006.h2 wpi1s Triticum aestiv... 44 0.013
gb|CA736214.1|CA736214 wpi1s.pk006.b16 wpi1s Triticum aesti... 44 0.013
gb|CA736234.1|CA736234 wpi1s.pk006.l23 wpi1s Triticum aesti... 44 0.013
gb|CA736285.1|CA736285 wpi1s.pk007.c7 wpi1s Triticum aestiv... 44 0.013
gb|CA736300.1|CA736300 wpi1s.pk007.c17 wpi1s Triticum aesti... 44 0.013
gb|CA736302.1|CA736302 wpi1s.pk007.c3 wpi1s Triticum aestiv... 44 0.013
gb|CA736309.1|CA736309 wpi1s.pk007.o4 wpi1s Triticum aestiv... 44 0.013
gb|CA736347.1|CA736347 wpi1s.pk006.j10 wpi1s Triticum aesti... 44 0.013
gb|CA736366.1|CA736366 wpi1s.pk007.a18 wpi1s Triticum aesti... 44 0.013
gb|CA736414.1|CA736414 wpi1s.pk007.n10 wpi1s Triticum aesti... 44 0.013
gb|CA736418.1|CA736418 wpi1s.pk007.n17 wpi1s Triticum aesti... 44 0.013
gb|CA736425.1|CA736425 wpi1s.pk007.j14 wpi1s Triticum aesti... 44 0.013
gb|CA736435.1|CA736435 wpi1s.pk007.j24 wpi1s Triticum aesti... 44 0.013
gb|CA736471.1|CA736471 wpi1s.pk007.k20 wpi1s Triticum aesti... 44 0.013
gb|CA736475.1|CA736475 wpi1s.pk007.k18 wpi1s Triticum aesti... 44 0.013
gb|CA736494.1|CA736494 wpi1s.pk007.f13 wpi1s Triticum aesti... 44 0.013
gb|CA736513.1|CA736513 wpi1s.pk007.p15 wpi1s Triticum aesti... 44 0.013
gb|CA736559.1|CA736559 wpi1s.pk007.f7 wpi1s Triticum aestiv... 44 0.013
gb|CA736560.1|CA736560 wpi1s.pk007.g14 wpi1s Triticum aesti... 44 0.013
gb|CA736561.1|CA736561 wpi1s.pk007.g16 wpi1s Triticum aesti... 44 0.013
gb|CA736571.1|CA736571 wpi1s.pk007.p20 wpi1s Triticum aesti... 44 0.013
gb|CA736578.1|CA736578 wpi1s.pk007.n22 wpi1s Triticum aesti... 44 0.013
gb|CA736617.1|CA736617 wpi1s.pk008.g16 wpi1s Triticum aesti... 44 0.013
gb|CA736650.1|CA736650 wpi1s.pk008.e3 wpi1s Triticum aestiv... 44 0.013
gb|CA736832.1|CA736832 wpi1s.pk008.d18 wpi1s Triticum aesti... 44 0.013
gb|CA736846.1|CA736846 wpi1s.pk009.a15 wpi1s Triticum aesti... 44 0.013
gb|CA736873.1|CA736873 wpi1s.pk009.k21 wpi1s Triticum aesti... 44 0.013
gb|CA736900.1|CA736900 wpi1s.pk009.g17 wpi1s Triticum aesti... 44 0.013
gb|CA736912.1|CA736912 wpi1s.pk008.l16 wpi1s Triticum aesti... 44 0.013
gb|CA736946.1|CA736946 wpi1s.pk009.e9 wpi1s Triticum aestiv... 44 0.013
gb|CA736985.1|CA736985 wpi1s.pk009.c12 wpi1s Triticum aesti... 44 0.013
gb|CA736998.1|CA736998 wpi1s.pk009.e14 wpi1s Triticum aesti... 44 0.013
gb|CA737004.1|CA737004 wpi1s.pk009.d22 wpi1s Triticum aesti... 44 0.013
gb|CA737054.1|CA737054 wpi1s.pk009.b24 wpi1s Triticum aesti... 44 0.013
gb|CA737060.1|CA737060 wpi1s.pk009.b9 wpi1s Triticum aestiv... 44 0.013
gb|CA737099.1|CA737099 wpi1s.pk009.j14 wpi1s Triticum aesti... 44 0.013
gb|CA737107.1|CA737107 wpi1s.pk009.f2 wpi1s Triticum aestiv... 44 0.013
gb|CA737120.1|CA737120 wpi1s.pk009.n14 wpi1s Triticum aesti... 44 0.013
gb|CA737125.1|CA737125 wpi1s.pk009.d14 wpi1s Triticum aesti... 44 0.013
gb|CA737148.1|CA737148 wpi1s.pk009.h17 wpi1s Triticum aesti... 44 0.013
gb|CA737150.1|CA737150 wpi1s.pk009.h18 wpi1s Triticum aesti... 44 0.013
gb|CA737496.1|CA737496 wpi2s.pk004.e3 wpi2s Triticum aestiv... 44 0.013
gb|CA737504.1|CA737504 wpi2s.pk004.g9 wpi2s Triticum aestiv... 44 0.013
gb|CA737515.1|CA737515 wpi2s.pk004.i1 wpi2s Triticum aestiv... 44 0.013
gb|CA737522.1|CA737522 wpi2s.pk004.k23 wpi2s Triticum aesti... 44 0.013
gb|CA737556.1|CA737556 wpi2s.pk004.c15 wpi2s Triticum aesti... 44 0.013
gb|CA737578.1|CA737578 wpi2s.pk004.i18 wpi2s Triticum aesti... 44 0.013
gb|CA737604.1|CA737604 wpi2s.pk004.f1 wpi2s Triticum aestiv... 44 0.013
gb|CA737616.1|CA737616 wpi2s.pk004.h13 wpi2s Triticum aesti... 44 0.013
gb|CA737648.1|CA737648 wpi2s.pk004.d24 wpi2s Triticum aesti... 44 0.013
gb|CA737674.1|CA737674 wpi2s.pk004.p17 wpi2s Triticum aesti... 44 0.013
gb|CA737688.1|CA737688 wpi2s.pk004.l13 wpi2s Triticum aesti... 44 0.013
gb|CA737692.1|CA737692 wpi2s.pk004.k6 wpi2s Triticum aestiv... 44 0.013
gb|CA737705.1|CA737705 wpi2s.pk004.n2 wpi2s Triticum aestiv... 44 0.013
gb|CA737866.1|CA737866 wpi2s.pk005.g2 wpi2s Triticum aestiv... 44 0.013
gb|CA737876.1|CA737876 wpi2s.pk005.m11 wpi2s Triticum aesti... 44 0.013
gb|CA737905.1|CA737905 wpi2s.pk005.i22 wpi2s Triticum aesti... 44 0.013
gb|CA737936.1|CA737936 wpi2s.pk005.o4 wpi2s Triticum aestiv... 44 0.013
gb|CA737976.1|CA737976 wpi2s.pk005.j15 wpi2s Triticum aesti... 44 0.013
gb|CA737980.1|CA737980 wpi2s.pk005.b17 wpi2s Triticum aesti... 44 0.013
gb|CA737987.1|CA737987 wpi2s.pk005.b23 wpi2s Triticum aesti... 44 0.013
gb|CA738014.1|CA738014 wpi2s.pk005.n7 wpi2s Triticum aestiv... 44 0.013
gb|CA738060.1|CA738060 wpi2s.pk002.h19 wpi2s Triticum aesti... 44 0.013
gb|CA738097.1|CA738097 wpi2s.pk002.l2 wpi2s Triticum aestiv... 44 0.013
gb|CA738101.1|CA738101 wpi2s.pk002.l19 wpi2s Triticum aesti... 44 0.013
gb|CA738127.1|CA738127 wpi2s.pk006.k13 wpi2s Triticum aesti... 44 0.013
gb|CA738223.1|CA738223 wpi2s.pk006.o19 wpi2s Triticum aesti... 44 0.013
gb|CA738358.1|CA738358 wpi2s.pk006.i24 wpi2s Triticum aesti... 44 0.013
gb|CA738392.1|CA738392 wpi2s.pk006.l13 wpi2s Triticum aesti... 44 0.013
gb|CA738446.1|CA738446 wpi2s.pk006.n22 wpi2s Triticum aesti... 44 0.013
gb|CA738494.1|CA738494 wpi2s.pk008.o5 wpi2s Triticum aestiv... 44 0.013
gb|CA738506.1|CA738506 wpi2s.pk008.g16 wpi2s Triticum aesti... 44 0.013
gb|CA738578.1|CA738578 wpi2s.pk008.k7 wpi2s Triticum aestiv... 44 0.013
gb|CA738630.1|CA738630 wpi2s.pk008.a24 wpi2s Triticum aesti... 44 0.013
gb|CA738655.1|CA738655 wpi2s.pk002.m5 wpi2s Triticum aestiv... 44 0.013
gb|CA738687.1|CA738687 wpi2s.pk002.o14 wpi2s Triticum aesti... 44 0.013
gb|CA738693.1|CA738693 wpi2s.pk002.i13 wpi2s Triticum aesti... 44 0.013
gb|CA738717.1|CA738717 wpi2s.pk002.o7 wpi2s Triticum aestiv... 44 0.013
gb|CA738746.1|CA738746 wpi2s.pk008.h23 wpi2s Triticum aesti... 44 0.013
gb|CA738762.1|CA738762 wpi2s.pk002.c7 wpi2s Triticum aestiv... 44 0.013
gb|CA738763.1|CA738763 wpi2s.pk002.c21 wpi2s Triticum aesti... 44 0.013
gb|CA738905.1|CA738905 wpi2s.pk008.f24 wpi2s Triticum aesti... 44 0.013
gb|CA738909.1|CA738909 wpi2s.pk009.k6 wpi2s Triticum aestiv... 44 0.013
gb|CA738915.1|CA738915 wpi2s.pk009.g21 wpi2s Triticum aesti... 44 0.013
gb|CA738986.1|CA738986 wpi2s.pk009.o21 wpi2s Triticum aesti... 44 0.013
gb|CA739035.1|CA739035 wpi2s.pk009.o12 wpi2s Triticum aesti... 44 0.013
gb|CA739042.1|CA739042 wpi2s.pk009.f21 wpi2s Triticum aesti... 44 0.013
gb|CA739049.1|CA739049 wpi2s.pk009.h21 wpi2s Triticum aesti... 44 0.013
gb|CA739129.1|CA739129 wpi2s.pk009.a20 wpi2s Triticum aesti... 44 0.013
gb|CA739130.1|CA739130 wpi2s.pk009.a22 wpi2s Triticum aesti... 44 0.013
gb|CA739145.1|CA739145 wpi2s.pk009.h13 wpi2s Triticum aesti... 44 0.013
gb|CA739154.1|CA739154 wpi2s.pk009.j12 wpi2s Triticum aesti... 44 0.013
gb|CA739171.1|CA739171 wpi2s.pk009.l6 wpi2s Triticum aestiv... 44 0.013
gb|CA739173.1|CA739173 wpi2s.pk009.l19 wpi2s Triticum aesti... 44 0.013
gb|CA739269.1|CA739269 wpi2s.pk005.d6 wpi2s Triticum aestiv... 44 0.013
gb|CA739286.1|CA739286 wpi2s.pk007.a11 wpi2s Triticum aesti... 44 0.013
gb|CA739288.1|CA739288 wpi2s.pk007.a18 wpi2s Triticum aesti... 44 0.013
gb|CA739303.1|CA739303 wpi2s.pk007.m9 wpi2s Triticum aestiv... 44 0.013
gb|CA739308.1|CA739308 wpi2s.pk007.g18 wpi2s Triticum aesti... 44 0.013
gb|CA739315.1|CA739315 wpi2s.pk007.c17 wpi2s Triticum aesti... 44 0.013
gb|CA739322.1|CA739322 wpi2s.pk007.c16 wpi2s Triticum aesti... 44 0.013
gb|CA739402.1|CA739402 wpi2s.pk005.j4 wpi2s Triticum aestiv... 44 0.013
gb|CA739406.1|CA739406 wpi2s.pk007.a23 wpi2s Triticum aesti... 44 0.013
gb|CA739410.1|CA739410 wpi2s.pk007.m10 wpi2s Triticum aesti... 44 0.013
gb|CA739445.1|CA739445 wpi2s.pk007.i22 wpi2s Triticum aesti... 44 0.013
gb|CA739482.1|CA739482 wpi2s.pk007.p3 wpi2s Triticum aestiv... 44 0.013
gb|CA739507.1|CA739507 wpi2s.pk007.f3 wpi2s Triticum aestiv... 44 0.013
gb|CA739513.1|CA739513 wpi2s.pk007.j19 wpi2s Triticum aesti... 44 0.013
gb|CA739547.1|CA739547 wpi2s.pk007.n14 wpi2s Triticum aesti... 44 0.013
gb|CA739575.1|CA739575 wpi2s.pk007.p12 wpi2s Triticum aesti... 44 0.013
gb|CA739698.1|CA739698 wpi2s.pk010.m12 wpi2s Triticum aesti... 44 0.013
gb|CA739708.1|CA739708 wpi2s.pk010.o15 wpi2s Triticum aesti... 44 0.013
gb|CA739771.1|CA739771 wpi2s.pk010.c22 wpi2s Triticum aesti... 44 0.013
gb|CA739779.1|CA739779 wpi2s.pk010.e18 wpi2s Triticum aesti... 44 0.013
gb|CA739787.1|CA739787 wpi2s.pk010.f19 wpi2s Triticum aesti... 44 0.013
gb|CA739823.1|CA739823 wpi2s.pk010.p22 wpi2s Triticum aesti... 44 0.013
gb|CA739845.1|CA739845 wpi2s.pk010.j18 wpi2s Triticum aesti... 44 0.013
gb|CA742414.1|CA742414 wri1s.pk001.e7 wri1s Triticum aestiv... 44 0.013
gb|CA742426.1|CA742426 wri1s.pk001.i5 wri1s Triticum aestiv... 44 0.013
gb|CA742471.1|CA742471 wri1s.pk001.g11 wri1s Triticum aesti... 44 0.013
gb|CA742484.1|CA742484 wri1s.pk001.a16 wri1s Triticum aesti... 44 0.013
gb|CA742507.1|CA742507 wri1s.pk001.k4 wri1s Triticum aestiv... 44 0.013
gb|CA742517.1|CA742517 wri1s.pk001.m8 wri1s Triticum aestiv... 44 0.013
gb|CA742565.1|CA742565 wri1s.pk001.o20 wri1s Triticum aesti... 44 0.013
gb|CA742567.1|CA742567 wri1s.pk001.i8 wri1s Triticum aestiv... 44 0.013
gb|CA742594.1|CA742594 wri1s.pk001.p12 wri1s Triticum aesti... 44 0.013
gb|CA742639.1|CA742639 wri1s.pk001.d6 wri1s Triticum aestiv... 44 0.013
gb|CA742661.1|CA742661 wri1s.pk001.j11 wri1s Triticum aesti... 44 0.013
gb|CA742801.1|CA742801 wri1s.pk004.h15 wri1s Triticum aesti... 44 0.013
gb|CA742816.1|CA742816 wri1s.pk004.p3 wri1s Triticum aestiv... 44 0.013
gb|CA742819.1|CA742819 wri1s.pk004.d21 wri1s Triticum aesti... 44 0.013
gb|CA742840.1|CA742840 wri1s.pk004.g5 wri1s Triticum aestiv... 44 0.013
gb|CA742861.1|CA742861 wri1s.pk004.m11 wri1s Triticum aesti... 44 0.013
gb|CA742869.1|CA742869 wri1s.pk004.i15 wri1s Triticum aesti... 44 0.013
gb|CA742878.1|CA742878 wri1s.pk004.k13 wri1s Triticum aesti... 44 0.013
gb|CA742889.1|CA742889 wri1s.pk004.e9 wri1s Triticum aestiv... 44 0.013
gb|CA742916.1|CA742916 wri1s.pk004.i8 wri1s Triticum aestiv... 44 0.013
gb|CA742942.1|CA742942 wri1s.pk004.o18 wri1s Triticum aesti... 44 0.013
gb|CA742943.1|CA742943 wri1s.pk004.o20 wri1s Triticum aesti... 44 0.013
gb|CA742971.1|CA742971 wri1s.pk004.c8 wri1s Triticum aestiv... 44 0.013
gb|CA743006.1|CA743006 wri1s.pk002.c13 wri1s Triticum aesti... 44 0.013
gb|CA743021.1|CA743021 wri1s.pk002.c19 wri1s Triticum aesti... 44 0.013
gb|CA743044.1|CA743044 wri1s.pk002.o3 wri1s Triticum aestiv... 44 0.013
gb|CA743095.1|CA743095 wri1s.pk002.h8 wri1s Triticum aestiv... 44 0.013
gb|CA743096.1|CA743096 wri1s.pk002.i11 wri1s Triticum aesti... 44 0.013
gb|CA743101.1|CA743101 wri1s.pk002.i19 wri1s Triticum aesti... 44 0.013
gb|CA743144.1|CA743144 wri1s.pk002.b4 wri1s Triticum aestiv... 44 0.013
gb|CA743204.1|CA743204 wri1s.pk002.h18 wri1s Triticum aesti... 44 0.013
gb|CA743239.1|CA743239 wri1s.pk002.e10 wri1s Triticum aesti... 44 0.013
gb|CA743272.1|CA743272 wri1s.pk002.o4 wri1s Triticum aestiv... 44 0.013
gb|CA743375.1|CA743375 wri1s.pk005.g3 wri1s Triticum aestiv... 44 0.013
gb|CA743395.1|CA743395 wri1s.pk003.c20 wri1s Triticum aesti... 44 0.013
gb|CA743431.1|CA743431 wri1s.pk003.i10 wri1s Triticum aesti... 44 0.013
gb|CA743439.1|CA743439 wri1s.pk003.g10 wri1s Triticum aesti... 44 0.013
gb|CA743451.1|CA743451 wri1s.pk005.i3 wri1s Triticum aestiv... 44 0.013
gb|CA743454.1|CA743454 wri1s.pk005.o7 wri1s Triticum aestiv... 44 0.013
gb|CA743522.1|CA743522 wri1s.pk003.b23 wri1s Triticum aesti... 44 0.013
gb|CA743564.1|CA743564 wri1s.pk003.l1 wri1s Triticum aestiv... 44 0.013
gb|CA743584.1|CA743584 wri1s.pk002.p11 wri1s Triticum aesti... 44 0.013
gb|CA743659.1|CA743659 wri1s.pk005.k10 wri1s Triticum aesti... 44 0.013
gb|CA743681.1|CA743681 wri1s.pk005.m16 wri1s Triticum aesti... 44 0.013
gb|CA743787.1|CA743787 wri1s.pk005.h6 wri1s Triticum aestiv... 44 0.013
gb|CA743820.1|CA743820 wri1s.pk005.d12 wri1s Triticum aesti... 44 0.013
gb|CA743839.1|CA743839 wri1s.pk005.n2 wri1s Triticum aestiv... 44 0.013
gb|CA743865.1|CA743865 wri1s.pk006.k23 wri1s Triticum aesti... 44 0.013
gb|CA743877.1|CA743877 wri1s.pk006.g15 wri1s Triticum aesti... 44 0.013
gb|CA743962.1|CA743962 wri1s.pk005.f18 wri1s Triticum aesti... 44 0.013
gb|CA744019.1|CA744019 wri1s.pk006.j13 wri1s Triticum aesti... 44 0.013
gb|CA744054.1|CA744054 wri1s.pk006.p15 wri1s Triticum aesti... 44 0.013
gb|CA744070.1|CA744070 wri1s.pk006.h9 wri1s Triticum aestiv... 44 0.013
gb|CA744106.1|CA744106 wri1s.pk006.j4 wri1s Triticum aestiv... 44 0.013
gb|CA744109.1|CA744109 wri1s.pk006.j22 wri1s Triticum aesti... 44 0.013
gb|CA744129.1|CA744129 wri1s.pk006.n22 wri1s Triticum aesti... 44 0.013
gb|CA744159.1|CA744159 wri1s.pk006.f10 wri1s Triticum aesti... 44 0.013
gb|CA744164.1|CA744164 wri1s.pk006.p12 wri1s Triticum aesti... 44 0.013
gb|CA744247.1|CA744247 wri1s.pk007.o23 wri1s Triticum aesti... 44 0.013
gb|CA744267.1|CA744267 wri1s.pk007.c12 wri1s Triticum aesti... 44 0.013
gb|CA744293.1|CA744293 wri1s.pk007.k20 wri1s Triticum aesti... 44 0.013
gb|CA744308.1|CA744308 wri1s.pk007.i24 wri1s Triticum aesti... 44 0.013
gb|CA744339.1|CA744339 wri1s.pk007.l13 wri1s Triticum aesti... 44 0.013
gb|CA744340.1|CA744340 wri1s.pk007.m24 wri1s Triticum aesti... 44 0.013
gb|CA744415.1|CA744415 wri1s.pk007.e22 wri1s Triticum aesti... 44 0.013
gb|CA744423.1|CA744423 wri1s.pk007.f15 wri1s Triticum aesti... 44 0.013
gb|CA744432.1|CA744432 wri1s.pk007.j9 wri1s Triticum aestiv... 44 0.013
gb|CA744474.1|CA744474 wri1s.pk007.l4 wri1s Triticum aestiv... 44 0.013
gb|CA744634.1|CA744634 wri1s.pk008.h16 wri1s Triticum aesti... 44 0.013
gb|CA744672.1|CA744672 wri1s.pk009.c19 wri1s Triticum aesti... 44 0.013
gb|CA744704.1|CA744704 wri1s.pk009.g11 wri1s Triticum aesti... 44 0.013
gb|CA744900.1|CA744900 wri1s.pk009.j8 wri1s Triticum aestiv... 44 0.013
gb|CA744906.1|CA744906 wri1s.pk009.d24 wri1s Triticum aesti... 44 0.013
gb|CA744930.1|CA744930 wri1s.pk009.n2 wri1s Triticum aestiv... 44 0.013
gb|CA744998.1|CA744998 wri1s.pk009.p20 wri1s Triticum aesti... 44 0.013
gb|CA745045.1|CA745045 wri1s.pk008.m15 wri1s Triticum aesti... 44 0.013
gb|CA745069.1|CA745069 wri1s.pk008.g12 wri1s Triticum aesti... 44 0.013
gb|CA745076.1|CA745076 wri1s.pk008.g22 wri1s Triticum aesti... 44 0.013
gb|CA745152.1|CA745152 wri1s.pk008.o10 wri1s Triticum aesti... 44 0.013
gb|CA745223.1|CA745223 wri1s.pk003.n12 wri1s Triticum aesti... 44 0.013
gb|CA745253.1|CA745253 wri1s.pk003.a9 wri1s Triticum aestiv... 44 0.013
gb|CA745264.1|CA745264 wri1s.pk003.k7 wri1s Triticum aestiv... 44 0.013
gb|CA745482.1|CA745482 wri2s.pk001.d13 wri2s Triticum aesti... 44 0.013
gb|CA745544.1|CA745544 wri2s.pk001.b10 wri2s Triticum aesti... 44 0.013
gb|CA745548.1|CA745548 wri2s.pk001.b20 wri2s Triticum aesti... 44 0.013
gb|CA745597.1|CA745597 wri2s.pk002.e14 wri2s Triticum aesti... 44 0.013
gb|CA745784.1|CA745784 wri2s.pk002.h20 wri2s Triticum aesti... 44 0.013
gb|CA745920.1|CA745920 wri2s.pk003.l2 wri2s Triticum aestiv... 44 0.013
gb|CA745951.1|CA745951 wri2s.pk003.p3 wri2s Triticum aestiv... 44 0.013
gb|CA745969.1|CA745969 wri2s.pk003.d22 wri2s Triticum aesti... 44 0.013
gb|CA746023.1|CA746023 wri2s.pk003.k5 wri2s Triticum aestiv... 44 0.013
gb|CA746049.1|CA746049 wri2s.pk003.i16 wri2s Triticum aesti... 44 0.013
gb|CA746108.1|CA746108 wri2s.pk003.o4 wri2s Triticum aestiv... 44 0.013
gb|CA746113.1|CA746113 wri2s.pk003.m8 wri2s Triticum aestiv... 44 0.013
gb|CA746167.1|CA746167 wri2s.pk005.a23 wri2s Triticum aesti... 44 0.013
gb|CA746242.1|CA746242 wri2s.pk005.i23 wri2s Triticum aesti... 44 0.013
gb|CA746363.1|CA746363 wri2s.pk005.f3 wri2s Triticum aestiv... 44 0.013
gb|CA746652.1|CA746652 wri2s.pk004.k10 wri2s Triticum aesti... 44 0.013
gb|CA746813.1|CA746813 wri2s.pk006.m17 wri2s Triticum aesti... 44 0.013
gb|CA746840.1|CA746840 wri2s.pk006.g18 wri2s Triticum aesti... 44 0.013
gb|CA746845.1|CA746845 wri2s.pk006.e3 wri2s Triticum aestiv... 44 0.013
gb|CA746847.1|CA746847 wri2s.pk006.e4 wri2s Triticum aestiv... 44 0.013
gb|CA746894.1|CA746894 wri2s.pk006.o15 wri2s Triticum aesti... 44 0.013
gb|CA746988.1|CA746988 wri2s.pk006.d5 wri2s Triticum aestiv... 44 0.013
gb|CA747031.1|CA747031 wri2s.pk006.d6 wri2s Triticum aestiv... 44 0.013
gb|CA747119.1|CA747119 wri2s.pk007.n8 wri2s Triticum aestiv... 44 0.013
gb|CA747221.1|CA747221 wri2s.pk008.k19.f wri2s Triticum aes... 44 0.013
gb|AJ602465.1|AJ602465 AJ602465 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602500.1|AJ602500 AJ602500 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602503.1|AJ602503 AJ602503 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602527.1|AJ602527 AJ602527 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602529.1|AJ602529 AJ602529 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602538.1|AJ602538 AJ602538 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602631.1|AJ602631 AJ602631 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602636.1|AJ602636 AJ602636 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602642.1|AJ602642 AJ602642 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602667.1|AJ602667 AJ602667 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602686.1|AJ602686 AJ602686 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602720.1|AJ602720 AJ602720 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602779.1|AJ602779 AJ602779 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602795.1|AJ602795 AJ602795 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602809.1|AJ602809 AJ602809 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602811.1|AJ602811 AJ602811 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602849.1|AJ602849 AJ602849 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602932.1|AJ602932 AJ602932 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602948.1|AJ602948 AJ602948 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602982.1|AJ602982 AJ602982 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ602994.1|AJ602994 AJ602994 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603041.1|AJ603041 AJ603041 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603093.1|AJ603093 AJ603093 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603148.1|AJ603148 AJ603148 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603163.1|AJ603163 AJ603163 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603207.1|AJ603207 AJ603207 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603239.1|AJ603239 AJ603239 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603240.1|AJ603240 AJ603240 T06 Triticum aestivum cDNA ... 44 0.013
gb|AJ603242.1|AJ603242 AJ603242 T06 Triticum aestivum cDNA ... 44 0.013
>gb|BE400791.1|BE400791 AWB007.C05F000328 ITEC AWB Wheat Meiotic Stage Library Triticum
aestivum cDNA clone AWB007.C05, mRNA sequence
Length = 518
Score = 285 bits (144), Expect = 2e-075
Identities = 288/337 (85%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||||| ||||||||||||||||| |||| || ||||| |||||
Sbjct: 380 gagcccttgactaacttggattgttcaggtgtgaaactaggtaacctctcttttacaata 321
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||| | || |||||||||||||||||||| ||||
Sbjct: 320 tcttgcatggtcttcgggtattggccattcagtagtggatcaagaaaccaaccaacatgg 261
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| ||| || | | |||||| ||| || |||||||
Sbjct: 260 aagtccctagccctttgagctgctgcttggtcggcgggtgagttggtagcagcttcatac 201
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
||||||||||| ||||||||||| || |||||||||||| |||||||||| || ||||||
Sbjct: 200 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggtacttgttgcgg 141
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||| |||
Sbjct: 140 tatctcgcaactgcagtagcatgagataagagaatgttatgaacaacagtgtaaggctct 81
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | ||||||| ||| |||| ||||| |||||||
Sbjct: 80 gttgctgagttcccaccggcagcgcatttggtgcacc 44
>gb|CV782404.1|CV782404 FGAS076817 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 845
Score = 278 bits (140), Expect = 5e-073
Identities = 287/337 (85%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||| | ||||||||||||||||| |||| || ||||| || ||
Sbjct: 472 gagcccttgactaacttagattgttcaggtgtgaaactaggtaacctctcttttacgata 413
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 412 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 353
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| ||| || ||| |||||| ||| || |||||||
Sbjct: 352 aagtccctagccctttgagctgctgcttggtcggcaggtgagttggtagcagcttcatac 293
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
||||||||||| ||||||||||| || |||||||||||| |||||||||| |||||||||
Sbjct: 292 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggtacttattgcgg 233
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||||||||||||||| | ||||||||||||||||||| ||||||| |||
Sbjct: 232 tatctcgcaactgcagtagcatgagacaagagaatgttatgaacaacagtgtaaggctct 173
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | |||||| ||| |||| ||||| |||||||
Sbjct: 172 gttgcggagttcccaccggcagcgcatttggtgcacc 136
Score = 71.9 bits (36), Expect = 6e-011
Identities = 81/96 (84%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||||||| ||||||||| ||| |||||||||| |||||||||||||||||
Sbjct: 686 gtacttctcctttatgtagttcacacatccgtacatgcccgtcgggacgatgtaaagcca 627
Query: 77 aattgagtgcgccatctgtccaatttgcacgccatt 112
| |||| |||| ||||||||||| | ||||||||
Sbjct: 626 atgggagttcgccttctgtccaattggtacgccatt 591
>gb|CD895052.1|CD895052 G118.127N13F010824 G118 Triticum aestivum cDNA clone G118127N13,
mRNA sequence
Length = 703
Score = 270 bits (136), Expect = 1e-070
Identities = 286/337 (84%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||| | ||||||||||||||||| |||| || ||||| || ||
Sbjct: 608 gagcccttgactaacttagattgttcaggtgtgaaactaggtaacctctcttttacgata 549
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 548 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 489
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| || || ||| |||||| ||| || |||||||
Sbjct: 488 aagtccctagccctttgagctgctgcttagtcggcaggtgagttggtagcagcttcatac 429
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
||||||||||| ||||||||||| || |||||||||||| |||||||||| |||||||||
Sbjct: 428 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggtacttattgcgg 369
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||||||||||||||| | ||||||||||||||||||| ||||||| |||
Sbjct: 368 tatctcgcaactgcagtagcatgagacaagagaatgttatgaacaacagtgtaaggctct 309
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | |||||| ||| |||| ||||| |||||||
Sbjct: 308 gttgcggagttcccaccggcagcgcatttggtgcacc 272
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 605 tgctactatccttggctcat 624
||||||||||||||||||||
Sbjct: 234 tgctactatccttggctcat 215
>gb|BQ802514.1|BQ802514 WHE2826_G09_M18ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2826_G09_M18, mRNA
sequence
Length = 785
Score = 262 bits (132), Expect = 3e-068
Identities = 285/337 (84%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||||| ||||||||||||||||| |||| || ||||| |||||
Sbjct: 587 gagcccttgactaacttggattgttcaggtgtgaaactaggtaacctctcttttacaata 528
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||| | || ||| |||||||||||||| | ||||
Sbjct: 527 tcttgcatggtcttcgggtattggccattcagtagtgggtcaagaaaccaaccgacatgg 468
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| || ||| ||| || ||| |||||| ||| || |||||||
Sbjct: 467 aagtccctagccctttgagcggctgcttggtcggcaggtgagttggtagcagcttcatac 408
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
||||||||||| ||||||||||| || |||||||||||| |||||||||| || ||||||
Sbjct: 407 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggtacttgttgcgg 348
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||||| |||
Sbjct: 347 tatctcgcaactgcggtagcatgagataagagaatgttatgaacaacagtgtaaggctct 288
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | ||||||| ||| |||| ||||| |||||||
Sbjct: 287 gttgctgagttcccaccggcagcgcatttggtgcacc 251
Score = 58.0 bits (29), Expect = 8e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 48 tacatgcccgatgggacgatgtaaagccaaattgagtgcgccatctgtccaat 100
|||||||||| |||||||||||||||||| | |||| |||| ||||||||||
Sbjct: 770 tacatgcccgtcgggacgatgtaaagccaattggagttcgccttctgtccaat 718
>gb|CK207361.1|CK207361 FGAS018982 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1118
Score = 262 bits (132), Expect = 3e-068
Identities = 285/337 (84%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||| | ||||||||||||||||| |||| || ||||| || ||
Sbjct: 429 gagcccttgactaacttagattgttcaggtgtgaaactaggtaacctctcttttacgata 370
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 369 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 310
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| ||| | ||| || ||| |||||| ||| || |||||||
Sbjct: 309 aagtccctagccctttgagctcccccttgctcggcaggtgagttggtagcagcttcatac 250
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
||||||||||| ||||||||||| || |||||||||||| |||||||||| |||||||||
Sbjct: 249 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggtacttattgcgg 190
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||||||||||||||| | ||||||||||||||||||| ||||||| |||
Sbjct: 189 tatctcgcaactgcagtagcatgagacaagagaatgttatgaacaacagtgtaaggctct 130
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | |||||| ||| |||| ||||| |||||||
Sbjct: 129 gttgcggagttcccaccggcagcgcatttggtgcacc 93
Score = 71.9 bits (36), Expect = 6e-011
Identities = 81/96 (84%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| |||||||||||||||||
Sbjct: 643 gtacttctcccttatgtagttcacacatccgtacatgcccgtcgggacgatgtaaagcca 584
Query: 77 aattgagtgcgccatctgtccaatttgcacgccatt 112
| | |||| |||| ||||||||||| | ||||||||
Sbjct: 583 attggagttcgccttctgtccaattggtacgccatt 548
>gb|BE607053.1|BE607053 WHE0915_G06_N11ZS Wheat 5-15 DAP spike cDNA library Triticum
aestivum cDNA clone WHE0915_G06_N11, mRNA sequence
Length = 564
Score = 240 bits (121), Expect = 1e-061
Identities = 253/297 (85%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||| | || |||||||| ||||| |||| || ||||| || ||
Sbjct: 330 gagcccttgactaacttagattgctcaggtgtaaaactaggtaacctctcttttacgata 271
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 270 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 211
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| ||| || ||| |||||| ||| || |||||||
Sbjct: 210 aagtccctagccctttgagctgctgcttggtcggcaggtgagttggtagcagcttcatac 151
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
|| |||||||| ||||||||||| || |||||||||||| |||||||||| |||||||||
Sbjct: 150 caattgaagtccagaactatcccaactttgcctttctgacttgcctggtacttattgcgg 91
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggt 527
||||| |||||||| ||||||||||| | ||||||||||||||||||| ||||||||
Sbjct: 90 tatctcgcaactgcggtagcatgagacaagagaatgttatgaacaacagtgtaaggt 34
Score = 58.0 bits (29), Expect = 8e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 544 gtacttctcccttatgtagttcacacatccatacatgcccgtcgggacgatgtaaagcca 485
Query: 77 a 77
|
Sbjct: 484 a 484
>gb|BF483002.1|BF483002 WHE2313_E11_I21ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2313_E11_I21, mRNA sequence
Length = 421
Score = 238 bits (120), Expect = 4e-061
Identities = 237/277 (85%)
Strand = Plus / Minus
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 410 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 351
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| ||| || ||| |||||| ||| || |||||||
Sbjct: 350 aagtccctagccctttgagctgctgcttggtcggcaggtgagttggtagcagcttcatac 291
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcgg 470
|| |||||||| ||||||||||| || |||||||||||| |||||||||| |||||||||
Sbjct: 290 caattgaagtccagaactatcccaactttgcctttctgacttgcctggtacttattgcgg 231
Query: 471 tatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttct 530
||||| |||||||| ||||||||||| | ||||||||||||||||||| ||||||| |||
Sbjct: 230 tatctcgcaactgcggtagcatgagacaagagaatgttatgaacaacagtgtaaggctct 171
Query: 531 gtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| | ||||||| ||| |||| ||||| |||||||
Sbjct: 170 gttgctgagttcccaccggcagcgcatttggtgcacc 134
>gb|BE517860.1|BE517860 WHE0803_A03_B05ZS Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0803_A03_B05, mRNA sequence
Length = 504
Score = 180 bits (91), Expect = 8e-044
Identities = 220/263 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 390 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 331
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 330 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 271
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || ||||||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 270 agagcctcataccagttgaagtccagaactattccaaccttccccttctgagctgcctga 211
Query: 459 tatttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaaca 518
|| ||| | |||||||||||||||||| | |||||| || ||||| || ||| ||||
Sbjct: 210 tacttagtccggtatcttgcaactgcataaccatgagctaagagaaaattgtgagcaacg 151
Query: 519 atgtaaggttctgtcgatgagtt 541
|||||||||||||| | ||||||
Sbjct: 150 atgtaaggttctgttgctgagtt 128
>gb|CD896524.1|CD896524 G174.103C01F010822 G174 Triticum aestivum cDNA clone G174103C01,
mRNA sequence
Length = 649
Score = 180 bits (91), Expect = 8e-044
Identities = 220/263 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 379 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 320
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 319 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 260
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || ||||||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 259 agagcctcataccagttgaagtccagaactattccaaccttccccttctgagctgcctga 200
Query: 459 tatttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaaca 518
|| ||| | |||||||||||||||||| | |||||| || ||||| || ||| ||||
Sbjct: 199 tacttagtccggtatcttgcaactgcataaccatgagctaagagaaaattgtgagcaacg 140
Query: 519 atgtaaggttctgtcgatgagtt 541
|||||||||||||| | ||||||
Sbjct: 139 atgtaaggttctgttgctgagtt 117
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 48 tacatgcccgatgggacgatgtaaagcca 76
||||| ||||| |||||||||||||||||
Sbjct: 610 tacatccccgacgggacgatgtaaagcca 582
>gb|DR739724.1|DR739724 FGAS084941 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1072
Score = 180 bits (91), Expect = 8e-044
Identities = 220/263 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 420 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 361
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 360 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 301
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || ||||||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 300 agagcctcataccagttgaagtccagaactattccaaccttccccttctgagctgcctga 241
Query: 459 tatttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaaca 518
|| ||| | |||||||||||||||||| | |||||| || ||||| || ||| ||||
Sbjct: 240 tacttagtccggtatcttgcaactgcataaccatgagctaagagaaaattgtgagcaacg 181
Query: 519 atgtaaggttctgtcgatgagtt 541
|||||||||||||| | ||||||
Sbjct: 180 atgtaaggttctgttgctgagtt 158
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 763 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 717
>gb|BQ902450.1|BQ902450 Ta02_02e05_R
Ta02_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta02_02e05, mRNA
sequence
Length = 354
Score = 176 bits (89), Expect = 1e-042
Identities = 194/229 (84%)
Strand = Plus / Plus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatg 290
||||||||||||| ||| | ||||||||||||||||| |||| || ||||| || ||
Sbjct: 126 gagcccttgactaacttagattgttcaggtgtgaaactaggtaacctctcttttacgata 185
Query: 291 tcttgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatgg 350
|||||||| |||| || ||||| ||||||| || |||||||||||||||||||| ||||
Sbjct: 186 tcttgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatgg 245
Query: 351 aagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcatac 410
|||||||| |||||||| |||||| ||| || ||| |||||| ||| || |||||||
Sbjct: 246 aagtccctagccctttgagctgctgcttggtcggcaggtgagttggtagcagcttcatac 305
Query: 411 cagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggt 459
||||||||||| ||||||||||| || |||||||||||| |||||||||
Sbjct: 306 cagttgaagtccagaactatcccaactttgcctttctgacttgcctggt 354
>gb|CK199186.1|CK199186 FGAS007680 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 815
Score = 174 bits (88), Expect = 5e-042
Identities = 145/165 (87%)
Strand = Plus / Minus
Query: 403 gttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatt 462
|||||||||| |||||||| ||||||||||| || |||||||||||| |||||||||| |
Sbjct: 578 gttcataccaattgaagtccagaactatcccaactttgcctttctgacttgcctggtact 519
Query: 463 tattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgt 522
||||||||||||| |||||||| ||||||||||| | ||||||||||||||||||| |||
Sbjct: 518 tattgcggtatctcgcaactgcggtagcatgagacaagagaatgttatgaacaacagtgt 459
Query: 523 aaggttctgtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|||| ||||| | ||||||| ||| |||| ||||| |||||||
Sbjct: 458 aaggctctgttgctgagttcccaccggcagcgcatttggtgcacc 414
>gb|BJ210112.1|BJ210112 BJ210112 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh9e23 5', mRNA sequence
Length = 565
Score = 172 bits (87), Expect = 2e-041
Identities = 144/164 (87%)
Strand = Plus / Minus
Query: 404 ttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtattt 463
||||||||| |||||||| ||||||||||| || |||||||||||| |||||||||| ||
Sbjct: 521 ttcataccaattgaagtccagaactatcccaactttgcctttctgacttgcctggtactt 462
Query: 464 attgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgta 523
|||||||||||| |||||||| ||||||||||| | ||||||||||||||||||| ||||
Sbjct: 461 attgcggtatctcgcaactgcggtagcatgagacaagagaatgttatgaacaacagtgta 402
Query: 524 aggttctgtcgatgagttcncacnngcagtgcattgtgtgcacc 567
||| ||||| | ||||||| ||| |||| ||||| |||||||
Sbjct: 401 aggctctgttgctgagttcccaccggcagcgcatttggtgcacc 358
>gb|CK207850.1|CK207850 FGAS019519 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1095
Score = 165 bits (83), Expect = 5e-039
Identities = 230/280 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 460 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 401
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 400 cagccaacatggaagtccctggctctttgagctgctgcttggtcttcagttgagttggta 341
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 340 agagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctga 281
Query: 459 tatttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaaca 518
|| ||| | |||||||||||||||||| | |||| | || ||||| || ||| ||||
Sbjct: 280 tacttagtccggtatcttgcaactgcataaccatgtgctaagagaaaattgtgagcaacg 221
Query: 519 atgtaaggttctgtcgatgagttcncacnngcagtgcatt 558
|||||||||||||| | |||||| ||| |||| |||||
Sbjct: 220 atgtaaggttctgttgccgagttcccaccggcagcgcatt 181
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 709 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 663
>gb|BQ902349.1|BQ902349 Ta02_03h02_R
Ta02_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta02_03h02, mRNA
sequence
Length = 355
Score = 155 bits (78), Expect = 5e-036
Identities = 189/226 (83%)
Strand = Plus / Plus
Query: 234 cccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatgtct 293
|||||||||| ||| | || |||||||| ||||| |||| || ||||| || || |||
Sbjct: 130 cccttgactaacttagattgctcaggtgtaaaactaggtaacctctcttttacgatatct 189
Query: 294 tgcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatggaag 353
||||| |||| || ||||| ||||||| || |||||||||||||||||||| |||||||
Sbjct: 190 tgcatggtcttcgggtattggccatttagtagtggatcaagaaaccaaccaacatggaag 249
Query: 354 tccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcataccag 413
||||| |||||||| |||||| ||| || ||| |||||| ||| || ||||||||||
Sbjct: 250 tccctagccctttgagctgctgcttggtcggcaggtgagttggtagcagcttcataccag 309
Query: 414 ttgaagtcaagaactatcccgaccttgcctttctgagttgcctggt 459
|||||||| ||||||||||| || |||||||||||| |||||||||
Sbjct: 310 ttgaagtccagaactatcccaactttgcctttctgacttgcctggt 355
>gb|DR736805.1|DR736805 FGAS082175 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1054
Score = 145 bits (73), Expect = 5e-033
Identities = 133/154 (86%)
Strand = Plus / Minus
Query: 414 ttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgcggtat 473
|||||||| |||| |||||| || |||| ||||||| |||||||||| ||||||||||||
Sbjct: 901 ttgaagtccagaattatcccaactttgcatttctgacttgcctggtacttattgcggtat 842
Query: 474 cttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttctgtc 533
|| |||||||| ||||||||||| | ||||||||||||||||||| ||||||| |||||
Sbjct: 841 ctcgcaactgcggtagcatgagacaagagaatgttatgaacaacagtgtaaggctctgtt 782
Query: 534 gatgagttcncacnngcagtgcattgtgtgcacc 567
| ||||||| ||| |||| ||||| |||||||
Sbjct: 781 gctgagttcccaccggcagcgcatttggtgcacc 748
>gb|CA709393.1|CA709393 wdk2c.pk012.l16 wdk2c Triticum aestivum cDNA clone wdk2c.pk012.l16
5' end, mRNA sequence
Length = 481
Score = 137 bits (69), Expect = 1e-030
Identities = 178/213 (83%), Gaps = 1/213 (0%)
Strand = Plus / Minus
Query: 235 ccttgactagcttggcctgttcaggtgtgaaacttggtagccggtctttcacaatgtctt 294
||||||||| ||||| ||||||||||||||||| |||| || ||||| ||||| ||||
Sbjct: 213 ccttgactaacttggattgttcaggtgtgaaactaggtaacctctcttttacaatatctt 154
Query: 295 gcattatctttggatattgcccatttattaatggatcaagaaaccaaccaatatggaagt 354
|||| |||| || ||||| ||||| | || |||||||||||||||||||| ||||||||
Sbjct: 153 gcatggtcttcgggtattggccattcagtagtggatcaagaaaccaaccaacatggaagt 94
Query: 355 ccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaaggttcata-ccag 413
|||| |||||||| |||||| ||| || | | |||||| ||| || |||||| ||||
Sbjct: 93 ccctagccctttgagctgctgcttggtcggcgggtgagttggtagcagcttcatacccag 34
Query: 414 ttgaagtcaagaactatcccgaccttgcctttc 446
|||||||| ||||||||||| || |||||||||
Sbjct: 33 ttgaagtccagaactatcccaactttgcctttc 1
Score = 56.0 bits (28), Expect = 3e-006
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| || ||||||||||||||
Sbjct: 433 gtacttctcccttatgtagttcacacatccgtacatgcccgtcggcacgatgtaaagcca 374
Query: 77 aattgagtgcgccatctgtccaat 100
| | |||| |||| ||||||||||
Sbjct: 373 attggagttcgccttctgtccaat 350
>gb|BJ246270.1|BJ246270 BJ246270 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf22d13 5', mRNA sequence
Length = 561
Score = 135 bits (68), Expect = 5e-030
Identities = 146/172 (84%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 174 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 115
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 114 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 55
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgag 450
| || ||||||||||||||||| |||||||| || ||||| || |||||||
Sbjct: 54 agagcctcataccagttgaagtccagaactattccaaccttccccttctgag 3
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 423 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 377
>gb|BJ270032.1|BJ270032 BJ270032 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh5m05 5', mRNA sequence
Length = 573
Score = 133 bits (67), Expect = 2e-029
Identities = 172/207 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 406 tctttcacaaggtcttgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 347
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| |||
Sbjct: 346 cagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggta 287
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 286 agagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctga 227
Query: 459 tatttattgcggtatcttgcaactgca 485
|| ||| | ||||||||||||||||||
Sbjct: 226 tacttagtccggtatcttgcaactgca 200
>gb|CK151519.1|CK151519 FGAS034088 Triticum aestivum FGAS: TaLt3 Triticum aestivum cDNA,
mRNA sequence
Length = 885
Score = 133 bits (67), Expect = 2e-029
Identities = 172/207 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 612 tctttcacaaggtcttgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 553
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| |||
Sbjct: 552 cagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggta 493
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 492 agagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctga 433
Query: 459 tatttattgcggtatcttgcaactgca 485
|| ||| | ||||||||||||||||||
Sbjct: 432 tacttagtccggtatcttgcaactgca 406
>gb|BT009232.1| Triticum aestivum clone wle1n.pk0102.g9:fis, full insert mRNA
sequence
Length = 1023
Score = 133 bits (67), Expect = 2e-029
Identities = 172/207 (83%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 315 tctttcacaaggtcttgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 256
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| |||
Sbjct: 255 cagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggta 196
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctgg 458
| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 195 agagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctga 136
Query: 459 tatttattgcggtatcttgcaactgca 485
|| ||| | ||||||||||||||||||
Sbjct: 135 tacttagtccggtatcttgcaactgca 109
>gb|BE497655.1|BE497655 WHE955_G04_M07ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE955_G04_M07, mRNA sequence
Length = 547
Score = 129 bits (65), Expect = 3e-028
Identities = 137/161 (85%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 163 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 104
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 103 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 44
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgacctt 439
| || ||||||||||||||||| |||||||| || |||||
Sbjct: 43 agagcctcataccagttgaagtccagaactattccaacctt 3
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 412 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 366
>gb|AL829613.1|AL829613 AL829613 p:840 Triticum aestivum cDNA clone F10_p840_plate_3, mRNA
sequence
Length = 486
Score = 119 bits (60), Expect = 3e-025
Identities = 172/208 (82%), Gaps = 1/208 (0%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| ||||||||| |||| || || ||||| ||||| | || || | ||||
Sbjct: 313 tctttcacaaggtcttgcataatctgcgggtaatgcccgtttatcagcgggtcgacaaac 254
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| |||
Sbjct: 253 cagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggta 194
Query: 399 aaaggttcataccagttgaagtcaagaacta-tcccgaccttgcctttctgagttgcctg 457
| || || |||||||||||||| ||||||| |||| ||||| || ||||||| ||||||
Sbjct: 193 agagcctcgtaccagttgaagtccagaactattcccaaccttccccttctgagctgcctg 134
Query: 458 gtatttattgcggtatcttgcaactgca 485
|| ||| | ||||||||||||||||||
Sbjct: 133 atacttagtccggtatcttgcaactgca 106
>gb|CA635613.1|CA635613 wle1n.pk0102.g9 wle1n Triticum aestivum cDNA clone wle1n.pk0102.g9
5' end, mRNA sequence
Length = 595
Score = 119 bits (60), Expect = 3e-025
Identities = 172/208 (82%), Gaps = 1/208 (0%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 309 tctttcacaaggtcttgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 250
Query: 339 caa-ccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgt 397
| | |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| ||
Sbjct: 249 ccagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggt 190
Query: 398 aaaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctg 457
|| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 189 aagagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctg 130
Query: 458 gtatttattgcggtatcttgcaactgca 485
|| ||| | ||||||||||||||||||
Sbjct: 129 atacttagtccggtatcttgcaactgca 102
>gb|CA646056.1|CA646056 wre1n.pk0105.e12 wre1n Triticum aestivum cDNA clone
wre1n.pk0105.e12 5' end, mRNA sequence
Length = 540
Score = 119 bits (60), Expect = 3e-025
Identities = 129/152 (84%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 156 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 97
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 96 cagccaacatggaagtccctggctctttgagctgctgcttggtcttcagttgagttggta 37
Query: 399 aaaggttcataccagttgaagtcaagaactat 430
| || || |||||||||||||| ||||||||
Sbjct: 36 agagcctcgtaccagttgaagtccagaactat 5
Score = 44.1 bits (22), Expect = 0.013
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcc 75
||||||| |||| ||| ||||| ||||| ||||||||||||||||
Sbjct: 406 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcc 361
>gb|BJ207587.1|BJ207587 BJ207587 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh4h17 5', mRNA sequence
Length = 595
Score = 117 bits (59), Expect = 1e-024
Identities = 122/143 (85%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 158 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 99
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 98 cagccaacatggaagtccctggctctttgggctgctgcttggtcttcagttgagttggta 39
Query: 399 aaaggttcataccagttgaagtc 421
| || |||||||||||||||||
Sbjct: 38 agagcctcataccagttgaagtc 16
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 407 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 361
>gb|BU100454.1|BU100454 WHE3353_E04_J07ZS Chinese Spring aluminum-stressed root tip cDNA
library Triticum aestivum cDNA clone WHE3353_E04_J07,
mRNA sequence
Length = 731
Score = 109 bits (55), Expect = 3e-022
Identities = 148/179 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 189 tctttcacaaggtcttgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 130
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| |||||||||||||| |||
Sbjct: 129 cagccaacatggaagtccctggctctttgagccgctgcttggtcttcagttgagttggta 70
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctg 457
| || || |||||||||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 69 agagcctcgtaccagttgaagtccagaactattccaaccttccccttctgagctgcctg 11
>gb|BJ281281.1|BJ281281 BJ281281 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr21f09 5', mRNA sequence
Length = 614
Score = 109 bits (55), Expect = 3e-022
Identities = 121/143 (84%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 152 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 93
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| |||||| ||| |||||||||||||| |||
Sbjct: 92 cagccaacatggaagtccctggctctttgagctgctgcttggtcttcagttgagttggta 33
Query: 399 aaaggttcataccagttgaagtc 421
| || || ||||||||||||||
Sbjct: 32 agagcctcgtaccagttgaagtc 10
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 401 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 355
>gb|BG607282.1|BG607282 WHE2493_F04_L07ZS Triticum monococcum early reproductive apex cDNA
library Triticum monococcum cDNA clone WHE2493_F04_L07,
mRNA sequence
Length = 608
Score = 107 bits (54), Expect = 1e-021
Identities = 90/103 (87%)
Strand = Plus / Minus
Query: 465 ttgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaa 524
||||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |||||
Sbjct: 600 ttgcggtatctcgcaactgcggtagcatgagataagagaatgttatgaacaacagtgtaa 541
Query: 525 ggttctgtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| ||||| | ||||||| ||| |||| ||||| |||||||
Sbjct: 540 ggctctgttgctgagttcccaccggcagcgcatttggtgcacc 498
>gb|DR733159.1|DR733159 FGAS078921 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 629
Score = 103 bits (52), Expect = 2e-020
Identities = 171/208 (82%), Gaps = 2/208 (0%)
Strand = Plus / Minus
Query: 335 aaaccaaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtt 394
|||||| |||| ||||||||||||||| || || |||| | ||| ||||||||||||||
Sbjct: 530 aaaccagccaacatggaagtccctggctctctgggctgttgcttggtcttcagttgagtt 471
Query: 395 tgtaaaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgc 454
|||| || ||||||||||||||||| |||| ||| || || || || ||||||| |||
Sbjct: 470 ggtaagagcctcataccagttgaagtccagaattattccaacattcccgttctgagctgc 411
Query: 455 ctggtatttattgcggtatcttgcaactgcagtag-catgagataggagaatgttatgaa 513
||| || ||| | |||||||||||||||||| ||| |||||| || ||||| || |||
Sbjct: 410 ctgatacttagtccggtatcttgcaactgca-tagccatgagctaagagaaaattgtgag 352
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
|| | |||||||||||||| | ||||||
Sbjct: 351 catcgatgtaaggttctgttgctgagtt 324
>gb|BQ901706.1|BQ901706 Ta02_15c07_R
Ta02_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta02_15c07, mRNA
sequence
Length = 490
Score = 91.7 bits (46), Expect = 6e-017
Identities = 92/107 (85%), Gaps = 1/107 (0%)
Strand = Plus / Plus
Query: 462 ttattgcggtatcttgcaactgcagtagcatgaga-taggagaatgttatgaacaacaat 520
|||||||||||||| |||||||||||||||||||| | ||||||||||||||||||| |
Sbjct: 3 ttattgcggtatctcgcaactgcagtagcatgagagcaagagaatgttatgaacaacagt 62
Query: 521 gtaaggttctgtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|||||| ||||| | |||||| ||| |||| ||||| |||||||
Sbjct: 63 gtaaggctctgttgcggagttcccaccggcagcgcatttggtgcacc 109
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 605 tgctactatccttggctcat 624
||||||||||||||||||||
Sbjct: 147 tgctactatccttggctcat 166
>gb|BQ901504.1|BQ901504 Ta02_16d03_R
Ta02_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta02_16d03, mRNA
sequence
Length = 478
Score = 85.7 bits (43), Expect = 4e-015
Identities = 82/96 (85%)
Strand = Plus / Plus
Query: 472 atcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggttctg 531
|||| |||||||||||||||||||| | ||||||||||||||||||| ||||||| ||||
Sbjct: 1 atctcgcaactgcagtagcatgagacaagagaatgttatgaacaacagtgtaaggctctg 60
Query: 532 tcgatgagttcncacnngcagtgcattgtgtgcacc 567
| | |||||| ||| |||| ||||| |||||||
Sbjct: 61 ttgcggagttcccaccggcagcgcatttggtgcacc 96
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 605 tgctactatccttggctcat 624
||||||||||||||||||||
Sbjct: 134 tgctactatccttggctcat 153
>gb|BF483316.1|BF483316 WHE1791_D05_G09ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1791_D05_G09, mRNA sequence
Length = 553
Score = 79.8 bits (40), Expect = 2e-013
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| |||||||||||||||||
Sbjct: 206 gtacttctcccttatgtagttcacacatccgtacatgcccgtcgggacgatgtaaagcca 147
Query: 77 aattgagtgcgccatctgtccaatttgcacgccatt 112
||| |||| |||| ||||||||||| | ||||||||
Sbjct: 146 aatggagttcgccttctgtccaattggtacgccatt 111
>gb|CD897157.1|CD897157 G174.104P23F010823 G174 Triticum aestivum cDNA clone G174104P23,
mRNA sequence
Length = 636
Score = 79.8 bits (40), Expect = 2e-013
Identities = 98/116 (84%), Gaps = 1/116 (0%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 142 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 83
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtt 394
|| |||| |||||||| |||||| ||||| |||||| ||| ||||||||||||||
Sbjct: 82 cagccaacatggaagt-cctggctctttgggctgctgcttggtcttcagttgagtt 28
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 391 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 345
>gb|CK209455.1|CK209455 FGAS021221 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1126
Score = 79.8 bits (40), Expect = 2e-013
Identities = 133/163 (81%), Gaps = 2/163 (1%)
Strand = Plus / Minus
Query: 405 tcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtattta 464
|||||||| |||||||| ||| |||||| || |||| ||||||| | |||| || |||
Sbjct: 879 tcataccaattgaagtccagacntatcccaactttgc-tttctgactgccctg-tactta 822
Query: 465 ttgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaa 524
||||||||||| ||| |||| ||||||||||| | ||||||||||||| | || |||||
Sbjct: 821 ttgcggtatctcgcanctgcggtagcatgagacaagagaatgttatgacaaccagtgtaa 762
Query: 525 ggttctgtcgatgagttcncacnngcagtgcattgtgtgcacc 567
|| ||||| | ||||||| ||| |||| ||||| |||||||
Sbjct: 761 ggctctgttgctgagttcccaccggcagcgcatttggtgcacc 719
>gb|CA605028.1|CA605028 wr1.pk0046.b2 wr1 Triticum aestivum cDNA clone wr1.pk0046.b2 5'
end, mRNA sequence
Length = 489
Score = 77.8 bits (39), Expect = 9e-013
Identities = 81/95 (85%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| |||||||||||||| ||| || ||||| ||||||| || || | ||||
Sbjct: 95 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttattagcgggtcgacaaac 36
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| |||| ||||||||||||||| ||||| |||||
Sbjct: 35 cagccaacatggaagtccctggctctttgagctgc 1
>gb|BI751302.1|BI751302 Ta01_16f07_R
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta01_16f07, mRNA
sequence
Length = 655
Score = 73.8 bits (37), Expect = 1e-011
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 409 accagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgc 468
||||||||||||| |||||||| || ||||| || ||||||| |||||| || ||| | |
Sbjct: 1 accagttgaagtccagaactattccaaccttccccttctgagctgcctgatacttagtcc 60
Query: 469 ggtatcttgcaactgca 485
|||||||||||||||||
Sbjct: 61 ggtatcttgcaactgca 77
>gb|BI751475.1|BI751475 Ta01_20d11_R
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta01_20d11, mRNA
sequence
Length = 669
Score = 73.8 bits (37), Expect = 1e-011
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 409 accagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtatttattgc 468
||||||||||||| |||||||| || ||||| || ||||||| |||||| || ||| | |
Sbjct: 1 accagttgaagtccagaactattccaaccttccccttctgagctgcctgatacttagtcc 60
Query: 469 ggtatcttgcaactgca 485
|||||||||||||||||
Sbjct: 61 ggtatcttgcaactgca 77
>gb|CA712867.1|CA712867 wdk3c.pk015.l11 wdk3c Triticum aestivum cDNA clone wdk3c.pk015.l11
5' end, mRNA sequence
Length = 483
Score = 73.8 bits (37), Expect = 1e-011
Identities = 142/179 (79%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
|||||||||| ||| |||||||||| || || ||||| ||||| | || || | ||||
Sbjct: 188 tctttcacaaggtcntgcattatctgcgggtaatgcccgtttatcagcgggtcgacaaac 129
Query: 339 caaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgta 398
|| |||| ||||||||||||||| ||||| || ||| ||| | |||||| ||| | |||
Sbjct: 128 cagccaacatggaagtccctggcnctttgagccgctgcttggtattcagtcgagntggta 69
Query: 399 aaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctg 457
| || | |||||| ||||||| |||||||| || ||||| || ||||||| ||||||
Sbjct: 68 agagcctngtaccaggtgaagtccagaactatnccaaccttccccttctgagntgcctg 10
>gb|CD894557.1|CD894557 G118.126I10F010823 G118 Triticum aestivum cDNA clone G118126I10,
mRNA sequence
Length = 669
Score = 71.9 bits (36), Expect = 6e-011
Identities = 81/96 (84%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| |||||||||||||||||
Sbjct: 174 gtacttctcccttatgtagttcacacatccgtacatgcccgtcgggacgatgtaaagcca 115
Query: 77 aattgagtgcgccatctgtccaatttgcacgccatt 112
| | |||| |||| ||||||||||| | ||||||||
Sbjct: 114 attggagttcgccttctgtccaattggtacgccatt 79
>gb|BM138675.1|BM138675 WHE0496_E09_I18ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE0496_E09_I18,
mRNA sequence
Length = 533
Score = 65.9 bits (33), Expect = 3e-009
Identities = 72/85 (84%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| |||||||||||||||||
Sbjct: 92 gtacttctcccttatgtagttcacacatccgtacatgcccgtcgggacgatgtaaagcca 33
Query: 77 aattgagtgcgccatctgtccaatt 101
| | |||| |||| |||||||||||
Sbjct: 32 attggagttcgccttctgtccaatt 8
>gb|CD930609.1|CD930609 GR45.111N11R010612 GR45 Triticum aestivum cDNA clone GR45111N11,
mRNA sequence
Length = 556
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/81 (83%)
Strand = Plus / Minus
Query: 487 tagcatgagataggagaatgttatgaacaacaatgtaaggttctgtcgatgagttcncac 546
|||||||||| | ||||||||||||| ||||| ||||||| ||||| | ||||||| |||
Sbjct: 548 tagcatgagacaagagaatgttatgaccaacagtgtaaggctctgttgctgagttcccac 489
Query: 547 nngcagtgcattgtgtgcacc 567
|||| ||||| |||||||
Sbjct: 488 cggcagcgcatttggtgcacc 468
>gb|BF473283.1|BF473283 WHE0926_F12_K24ZS Wheat 5-15 DAP spike cDNA library Triticum
aestivum cDNA clone WHE0926_F12_K24, mRNA sequence
Length = 592
Score = 58.0 bits (29), Expect = 8e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 114 gtacttctcccttatgtagttcacacatccatacatgcccgtcgggacgatgtaaagcca 55
Query: 77 a 77
|
Sbjct: 54 a 54
>gb|BJ218685.1|BJ218685 BJ218685 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh9e23 3', mRNA sequence
Length = 735
Score = 58.0 bits (29), Expect = 8e-007
Identities = 53/61 (86%)
Strand = Plus / Plus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 606 gtacttctcccttatgtagttcacacatccatacatgcccgtcgggacgatgtaaagcca 665
Query: 77 a 77
|
Sbjct: 666 a 666
>gb|AL810577.1|AL810577 AL810577 e:29 Triticum aestivum cDNA clone F02_e29_plate_4, mRNA
sequence
Length = 565
Score = 56.0 bits (28), Expect = 3e-006
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 17 gtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
|||||| ||| ||| ||||||||| ||| |||||||||| || ||||||||||||||
Sbjct: 277 gtacttctcccttatgtagttcacacatccgtacatgcccgtcggcacgatgtaaagcca 218
Query: 77 aattgagtgcgccatctgtccaat 100
| | |||| |||| ||||||||||
Sbjct: 217 attggagttcgccttctgtccaat 194
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 231 gagcccttgactagcttggcctgttcaggtgtgaaacttggta 273
||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 63 gagcccttgactaacttggattgttcaggtgtgaaactaggta 21
>gb|BQ483400.1|BQ483400 WHE3508_B06_D12ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3508_B06_D12, mRNA sequence
Length = 717
Score = 52.0 bits (26), Expect = 5e-005
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttatta 324
|||||||||| |||||||||||||| ||| || ||||| |||||||
Sbjct: 85 tctttcacaaggtcttgcattatctgtgggtaatgcccgtttatta 40
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagcca 76
||||||| |||| ||| ||||| ||||| |||||||||||||||||
Sbjct: 334 aggtagtgcacgcatccgtacatccccgacgggacgatgtaaagcca 288
>gb|CA735990.1|CA735990 wpi1s.pk006.e4 wpi1s Triticum aestivum cDNA clone wpi1s.pk006.e4 5'
end, mRNA sequence
Length = 390
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtacttttc 25
|||||||||||||||||||||||||
Sbjct: 385 gcggccgcccgggcaggtacttttc 361
>gb|CA736813.1|CA736813 wpi1s.pk008.h16 wpi1s Triticum aestivum cDNA clone wpi1s.pk008.h16
5' end, mRNA sequence
Length = 349
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtacttttc 25
|||||||||||||||||||||||||
Sbjct: 345 gcggccgcccgggcaggtacttttc 321
>gb|CA742769.1|CA742769 wri1s.pk004.l3 wri1s Triticum aestivum cDNA clone wri1s.pk004.l3
5' end, mRNA sequence
Length = 226
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacttttc 25
|||||||||||||||||||||||||
Sbjct: 5 gcggccgcccgggcaggtacttttc 29
>gb|CA743039.1|CA743039 wri1s.pk002.k21 wri1s Triticum aestivum cDNA clone
wri1s.pk002.k21 5' end, mRNA sequence
Length = 521
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacttttccttt 29
||||||||||||||||||||||| |||||
Sbjct: 5 gcggccgcccgggcaggtactttcccttt 33
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,291
Number of Sequences: 636343
Number of extensions: 103291
Number of successful extensions: 38100
Number of sequences better than 0.5: 6156
Number of HSP's better than 0.5 without gapping: 6155
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 31658
Number of HSP's gapped (non-prelim): 6429
length of query: 696
length of database: 367,240,239
effective HSP length: 19
effective length of query: 677
effective length of database: 355,149,722
effective search space: 240436361794
effective search space used: 240436361794
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)