BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8616263.2.1
(509 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ275846.1|BJ275846 BJ275846 Y. Ogihara unpublished cDNA... 244 5e-063
gb|CD453999.1|CD453999 WHE0952_C12_E24ZT CS wheat pre-anthe... 244 5e-063
gb|CD454414.1|CD454414 WHE2310_D09_G18ZT CS wheat pre-anthe... 188 3e-046
gb|BJ261054.1|BJ261054 BJ261054 Y. Ogihara unpublished cDNA... 184 4e-045
gb|CA612399.1|CA612399 wr1.pk0140.g4 wr1 Triticum aestivum ... 178 2e-043
gb|BF201817.1|BF201817 WHE1759-1762_B09_B09ZS Wheat pre-ant... 165 4e-039
gb|BJ253690.1|BJ253690 BJ253690 Y. Ogihara unpublished cDNA... 161 6e-038
gb|BF485349.1|BF485349 WHE2310_D09_G18ZS Wheat pre-anthesis... 151 5e-035
gb|CA620405.1|CA620405 wl1n.pk0055.f2 wl1n Triticum aestivu... 151 5e-035
gb|BJ265154.1|BJ265154 BJ265154 Y. Ogihara unpublished cDNA... 141 5e-032
gb|BJ265155.1|BJ265155 BJ265155 Y. Ogihara unpublished cDNA... 135 3e-030
gb|CK152823.1|CK152823 FGAS035899 Triticum aestivum FGAS: T... 119 2e-025
gb|BJ260602.1|BJ260602 BJ260602 Y. Ogihara unpublished cDNA... 111 5e-023
gb|BJ257672.1|BJ257672 BJ257672 Y. Ogihara unpublished cDNA... 109 2e-022
gb|CA643522.1|CA643522 wre1n.pk0073.d9 wre1n Triticum aesti... 109 2e-022
gb|BG606868.1|BG606868 WHE2454_C06_F12ZS Triticum monococcu... 100 2e-019
gb|BJ257666.1|BJ257666 BJ257666 Y. Ogihara unpublished cDNA... 100 2e-019
gb|BU672356.1|BU672356 WHE3303_F03_L05ZS Chinese Spring whe... 100 2e-019
gb|CD491996.1|CD491996 WHE2454_C06_F12ZT Triticum monococcu... 100 2e-019
gb|BF201692.1|BF201692 WHE1774_E05_J10ZS Wheat pre-anthesis... 94 1e-017
gb|CA602287.1|CA602287 wr1.pk0017.f12 wr1 Triticum aestivum... 94 1e-017
gb|CA613946.1|CA613946 wr1.pk182.f9 wr1 Triticum aestivum c... 94 1e-017
gb|CA614878.1|CA614878 wr1.pk183.d3 wr1 Triticum aestivum c... 94 1e-017
gb|CA644692.1|CA644692 wre1n.pk0081.g7 wre1n Triticum aesti... 94 1e-017
gb|CA642536.1|CA642536 wre1n.pk0058.h8 wre1n Triticum aesti... 88 7e-016
gb|CA641231.1|CA641231 wre1n.pk0041.f4 wre1n Triticum aesti... 84 1e-014
gb|CA618732.1|CA618732 wl1n.pk0037.b2 wl1n Triticum aestivu... 82 4e-014
gb|CA639459.1|CA639459 wre1n.pk0014.d7 wre1n Triticum aesti... 74 1e-011
gb|BJ266294.1|BJ266294 BJ266294 Y. Ogihara unpublished cDNA... 68 6e-010
gb|CA606529.1|CA606529 wr1.pk0071.g7 wr1 Triticum aestivum ... 66 3e-009
gb|CV775699.1|CV775699 FGAS070103 Triticum aestivum FGAS: L... 60 2e-007
gb|CA603455.1|CA603455 wr1.pk0024.b3 wr1 Triticum aestivum ... 58 6e-007
gb|CK200177.1|CK200177 FGAS008684 Triticum aestivum FGAS: L... 58 6e-007
gb|BJ277445.1|BJ277445 BJ277445 Y. Ogihara unpublished cDNA... 56 2e-006
gb|BJ289468.1|BJ289468 BJ289468 Y. Ogihara unpublished cDNA... 56 2e-006
gb|BJ295794.1|BJ295794 BJ295794 Y. Ogihara unpublished cDNA... 56 2e-006
gb|AJ610434.1|AJ610434 AJ610434 Triticum turgidum subsp. du... 56 2e-006
gb|CD453012.1|CD453012 WHE1451_B11_C21ZT CS wheat etiolated... 50 1e-004
gb|BG904426.1|BG904426 TaLr1132A11F TaLr1 Triticum aestivum... 48 6e-004
gb|BG905538.1|BG905538 TaLr1140E03R TaLr1 Triticum aestivum... 48 6e-004
gb|BG906020.1|BG906020 TaLr1144C10F TaLr1 Triticum aestivum... 48 6e-004
gb|CA625829.1|CA625829 wl1n.pk0134.d9 wl1n Triticum aestivu... 48 6e-004
gb|CV776169.1|CV776169 FGAS070573 Triticum aestivum FGAS: L... 48 6e-004
gb|BJ253959.1|BJ253959 BJ253959 Y. Ogihara unpublished cDNA... 46 0.002
gb|CA645095.1|CA645095 wre1n.pk0087.c2 wre1n Triticum aesti... 46 0.002
gb|BQ753073.1|BQ753073 WHE4122_F11_K22ZS Wheat salt-stresse... 44 0.009
gb|CK193650.1|CK193650 FGAS002066 Triticum aestivum FGAS: L... 44 0.009
>gb|BJ275846.1|BJ275846 BJ275846 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh9o22 3', mRNA sequence
Length = 661
Score = 244 bits (123), Expect = 5e-063
Identities = 207/235 (88%)
Strand = Plus / Plus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 215 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 274
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 275 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 334
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
|| || || |||||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 335 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggccggcacgccg 394
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
|||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 395 acggtgttccgctcgacggggtcgacgaggttgaacttggccgggtcgttcacgg 449
>gb|CD453999.1|CD453999 WHE0952_C12_E24ZT CS wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0952_C12_E24, mRNA sequence
Length = 610
Score = 244 bits (123), Expect = 5e-063
Identities = 207/235 (88%)
Strand = Plus / Plus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 236 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 295
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 296 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 355
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
|| || || |||||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 356 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggccggcacgccg 415
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
|||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 416 acggtgttccgctcgacggggtcgacgaggttgaacttggccgggtcgttcacgg 470
>gb|CD454414.1|CD454414 WHE2310_D09_G18ZT CS wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2310_D09_G18, mRNA sequence
Length = 639
Score = 188 bits (95), Expect = 3e-046
Identities = 176/203 (86%)
Strand = Plus / Plus
Query: 288 cggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgccatcct 347
||||||||| | |||||||||| ||| ||| | ||||| ||||||| ||| |||||| |
Sbjct: 395 cggcggcggcgggagcttctggttcggaaggtttccgtccagcaccagccacgccatctt 454
Query: 348 gaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtc 407
|| ||||| | ||||| ||||||||||||||||||||||||| || || ||||||||
Sbjct: 455 cagcccccagctcatgtgcacctccaaatggcaatgcatgaaccatacacctgggttgtc 514
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
|||| | ||||||||||| ||||| |||||||| || |||||||||||||||||||||||
Sbjct: 515 ggcgcgaaagcggatggcgacccagccgccggcggggacgccgacggtgttgcgctcgac 574
Query: 468 ggggtcgacgaggttgaacttgg 490
|||||||||||||||||||||||
Sbjct: 575 ggggtcgacgaggttgaacttgg 597
>gb|BJ261054.1|BJ261054 BJ261054 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh1c05 3', mRNA sequence
Length = 647
Score = 184 bits (93), Expect = 4e-045
Identities = 204/241 (84%)
Strand = Plus / Plus
Query: 269 aacatttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcga 328
|||||||||| | || |||||||| |||||||||||||||| |||||||| |||||
Sbjct: 312 aacatttgggaagatcggacggcggagggagcagcttctggttggggaggctcccgtcct 371
Query: 329 gcaccaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatga 388
|||||| ||| ||||| | |||||||| | |||| ||||||| |||||||||||||
Sbjct: 372 gcaccacccacgccattttcaggccccagctgacgtgcacctccaagtggcaatgcatga 431
Query: 389 accaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgc 448
|||| ||||| || || ||||| |||||||||| |||||||| ||| |||| |||||||
Sbjct: 432 accacacccctggattatcggcacggaagcggattgccacccacccggcggcgggcacgc 491
Query: 449 cgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacggggt 508
|||||||||| | |||||||||||||||||||||| |||||| |||||| ||||||||||
Sbjct: 492 cgacggtgttcctctcgacggggtcgacgaggttgtacttggccgggtccttgacggggt 551
Query: 509 c 509
|
Sbjct: 552 c 552
>gb|CA612399.1|CA612399 wr1.pk0140.g4 wr1 Triticum aestivum cDNA clone wr1.pk0140.g4 5'
end, mRNA sequence
Length = 489
Score = 178 bits (90), Expect = 2e-043
Identities = 169/194 (87%), Gaps = 1/194 (0%)
Strand = Plus / Minus
Query: 289 ggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgccatcctg 348
||||| |||||||||||||||| ||| ||||| ||||| |||||| ||||||||| |
Sbjct: 258 ggcggggggagcagcttctggttcggtaggctcccgtcttgcaccagccatgccattcgt 199
Query: 349 aggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtcg 408
|| ||||| ||||||||| ||||||||||||||||||||||||| | | | |||||||||
Sbjct: 198 agtccccaagttgtgtgcacctccaaatggcaatgcatgaaccata-cactgggttgtcg 140
Query: 409 gcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgacg 468
||||| || || |||||||||||||| || || |||||||| |||||||| |||||||||
Sbjct: 139 gcgagaaaacgtatggccacccatccaccagctggcacgccaacggtgtttcgctcgacg 80
Query: 469 gggtcgacgaggtt 482
||||||||||||||
Sbjct: 79 gggtcgacgaggtt 66
>gb|BF201817.1|BF201817 WHE1759-1762_B09_B09ZS Wheat pre-anthesis spike cDNA library
Triticum aestivum cDNA clone WHE1759-1762_B09_B09, mRNA
sequence
Length = 466
Score = 165 bits (83), Expect = 4e-039
Identities = 131/147 (89%)
Strand = Plus / Minus
Query: 363 gtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggat 422
|||| |||||| ||||||||||||||||| ||||| || || |||||| ||||||||||
Sbjct: 437 gtgcacctccaggtggcaatgcatgaaccacacccctggattatcggcgcggaagcggat 378
Query: 423 ggccacccatccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggtt 482
||||||||| ||| |||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 377 ggccacccacccggcggcgggcacgccgacggtgttccgctcgacggggtcgacgaggtt 318
Query: 483 gaacttggacgggtcgttgacggggtc 509
| |||||| |||||| ||| |||||||
Sbjct: 317 gtacttggccgggtccttggcggggtc 291
>gb|BJ253690.1|BJ253690 BJ253690 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf2o13 3', mRNA sequence
Length = 571
Score = 161 bits (81), Expect = 6e-038
Identities = 192/229 (83%)
Strand = Plus / Plus
Query: 269 aacatttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcga 328
|||||||||| | || |||||||| |||||||||||||||| |||||||| |||||
Sbjct: 336 aacatttgggaagatcggacggcggagggagcagcttctggttggggaggctcccgtcct 395
Query: 329 gcaccaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatga 388
|||||| ||| ||||| | |||||||| | |||| |||||| |||||||||||||
Sbjct: 396 gcaccacccacgccattttcaggccccagctgacgtgcacctccaggtggcaatgcatga 455
Query: 389 accaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgc 448
|||| ||||| || || ||||| ||||||||||||||||||| || |||| |||||||
Sbjct: 456 accacacccctggattatcggcacggaagcggatggccacccacccagcggcgggcacgc 515
Query: 449 cgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtc 497
|||||||||| ||||| |||||||||||||||||| |||||| ||||||
Sbjct: 516 cgacggtgttccgctcaacggggtcgacgaggttgtacttggccgggtc 564
>gb|BF485349.1|BF485349 WHE2310_D09_G18ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2310_D09_G18, mRNA sequence
Length = 451
Score = 151 bits (76), Expect = 5e-035
Identities = 109/120 (90%)
Strand = Plus / Minus
Query: 371 ccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccaccc 430
|||||||||||||||||| ||| || | |||||||||||| | ||||||||||| ||||
Sbjct: 451 ccaaatggcaatgcatgagccatacacgtgggttgtcggcgcgaaagcggatggcgaccc 392
Query: 431 atccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 agccgccggcggggacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 332
>gb|CA620405.1|CA620405 wl1n.pk0055.f2 wl1n Triticum aestivum cDNA clone wl1n.pk0055.f2 5'
end, mRNA sequence
Length = 602
Score = 151 bits (76), Expect = 5e-035
Identities = 195/235 (82%), Gaps = 1/235 (0%)
Strand = Plus / Minus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||||||||| |||||| ||| ||||||||| ||
Sbjct: 381 catttgggcatgtcagacggcggcgggagcag-ttctggctcggcttgctgccgtcatgc 323
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||| || |||||| || ||||||| ||||||||||||
Sbjct: 322 acctgccacgccattctcagaccccacgtcgtgtgcaccnccaaatgacaatgcatgaac 263
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
|| || | |||||||| || |||||||| ||||||||||| ||||| | |||||||||
Sbjct: 262 catacacttgggttgtcagcaaggaagcgaatggccacccacccgcccncnggcacgccg 203
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
||||||| |||| ||||||||||||||||||||||||| ||| ||||| ||||
Sbjct: 202 acggtgtnccgctggacggggtcgacgaggttgaacttgtccggntcgttcacgg 148
>gb|BJ265154.1|BJ265154 BJ265154 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh11o05 3', mRNA sequence
Length = 386
Score = 141 bits (71), Expect = 5e-032
Identities = 146/171 (85%)
Strand = Plus / Plus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 216 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 275
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 276 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 335
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggcc 441
|| || || |||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 336 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggcc 386
>gb|BJ265155.1|BJ265155 BJ265155 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh11o06 3', mRNA sequence
Length = 342
Score = 135 bits (68), Expect = 3e-030
Identities = 145/171 (84%)
Strand = Plus / Plus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 172 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 231
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| ||| |||||||||||||||||||
Sbjct: 232 acctgccacgccattctcagaccccatgttgtgtgcacctncaaatggcaatgcatgaac 291
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggcc 441
|| || || |||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 292 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggcc 342
>gb|CK152823.1|CK152823 FGAS035899 Triticum aestivum FGAS: TaLt3 Triticum aestivum cDNA,
mRNA sequence
Length = 889
Score = 119 bits (60), Expect = 2e-025
Identities = 106/120 (88%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggcca 427
|||||||||||||||||| |||||| || || || | ||||||||||||||| ||| |||
Sbjct: 773 cctccaaatggcaatgcacgaaccatacacctggnt-gtcggcgaggaagcgaatgncca 715
Query: 428 cccatccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaact 487
|||| |||||||||||||||| ||| ||||| |||||||||||||| |||||| ||||||
Sbjct: 714 cccacccgccggccggcacgcngac-gtgttccgctcgacggggtccacgaggntgaact 656
>gb|BJ260602.1|BJ260602 BJ260602 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh25o06 5', mRNA sequence
Length = 412
Score = 111 bits (56), Expect = 5e-023
Identities = 145/172 (84%), Gaps = 2/172 (1%)
Strand = Plus / Minus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 171 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 112
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 111 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 52
Query: 391 caaaccccggggttgt-cggcgaggaagcggatggccacccatccgccggcc 441
|| || || ||||||| | |||||||||| || ||||||||| |||||||||
Sbjct: 51 catacacctgggttgtnctgcgaggaagc-gaaggccacccacccgccggcc 1
>gb|BJ257672.1|BJ257672 BJ257672 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh11p05 5', mRNA sequence
Length = 181
Score = 109 bits (55), Expect = 2e-022
Identities = 136/162 (83%), Gaps = 1/162 (0%)
Strand = Plus / Minus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| | ||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 166 catttgggcatgtcagncggcggcggcggcagcttctggctcggcttgctgccgtcctgc 107
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 106 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 47
Query: 391 caaaccccggggttgt-cggcgaggaagcggatggccaccca 431
|| || || ||||||| | ||||||||||| |||||||||||
Sbjct: 46 catacacctgggttgtnctgcgaggaagcgaatggccaccca 5
>gb|CA643522.1|CA643522 wre1n.pk0073.d9 wre1n Triticum aestivum cDNA clone wre1n.pk0073.d9
5' end, mRNA sequence
Length = 454
Score = 109 bits (55), Expect = 2e-022
Identities = 109/127 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 128 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 69
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
||| ||||||| ||||||||| |||||||||||||||||||||||| |||||| |||
Sbjct: 68 gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttggccgga 9
Query: 496 tcgttga 502
|||||||
Sbjct: 8 tcgttga 2
>gb|BG606868.1|BG606868 WHE2454_C06_F12ZS Triticum monococcum early reproductive apex cDNA
library Triticum monococcum cDNA clone WHE2454_C06_F12,
mRNA sequence
Length = 453
Score = 99.6 bits (50), Expect = 2e-019
Identities = 113/134 (84%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 335 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 276
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
||| ||||||| ||| ||||| || ||||||||||||||||||||| |||||| |||
Sbjct: 275 gcggtgggcacgctgacagtgttccgttcgacggggtcgacgaggttgtacttggccgga 216
Query: 496 tcgttgacggggtc 509
||||||| ||||||
Sbjct: 215 tcgttgatggggtc 202
>gb|BJ257666.1|BJ257666 BJ257666 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh11o05 5', mRNA sequence
Length = 342
Score = 99.6 bits (50), Expect = 2e-019
Identities = 126/150 (84%), Gaps = 1/150 (0%)
Strand = Plus / Minus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| ||||||||||| ||| ||||||||| ||
Sbjct: 151 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 92
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
||| ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 91 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 32
Query: 391 caaaccccggggttgt-cggcgaggaagcg 419
|| || || ||||||| | |||||||||||
Sbjct: 31 catacacctgggttgtcctgcgaggaagcg 2
>gb|BU672356.1|BU672356 WHE3303_F03_L05ZS Chinese Spring wheat drought stressed root cDNA
library Triticum aestivum cDNA clone WHE3303_F03_L05,
mRNA sequence
Length = 537
Score = 99.6 bits (50), Expect = 2e-019
Identities = 113/134 (84%)
Strand = Plus / Plus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 381 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 440
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
||| ||||||| ||||| ||| |||||||||||| ||||||||||| |||||| |||
Sbjct: 441 gcggtgggcacgctgacggagttccgctcgacggggacgacgaggttgtacttggccgga 500
Query: 496 tcgttgacggggtc 509
||||||| ||||||
Sbjct: 501 tcgttgatggggtc 514
>gb|CD491996.1|CD491996 WHE2454_C06_F12ZT Triticum monococcum DV92 early reproductive apex
cDNA library Triticum monococcum cDNA clone
WHE2454_C06_F12, mRNA sequence
Length = 690
Score = 99.6 bits (50), Expect = 2e-019
Identities = 113/134 (84%)
Strand = Plus / Plus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 431 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 490
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
||| ||||||| ||| ||||| || ||||||||||||||||||||| |||||| |||
Sbjct: 491 gcggtgggcacgctgacagtgttccgttcgacggggtcgacgaggttgtacttggccgga 550
Query: 496 tcgttgacggggtc 509
||||||| ||||||
Sbjct: 551 tcgttgatggggtc 564
>gb|BF201692.1|BF201692 WHE1774_E05_J10ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1774_E05_J10, mRNA sequence
Length = 429
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 385 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 326
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
||| ||||||| || |||||| |||| || ||||||||||||||| ||||||
Sbjct: 325 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 271
>gb|CA602287.1|CA602287 wr1.pk0017.f12 wr1 Triticum aestivum cDNA clone wr1.pk0017.f12 5'
end, mRNA sequence
Length = 452
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || ||||| |||||||||||||| || | ||| ||||| |||
Sbjct: 116 tggcagtgcataagccacacaccgggattgtcggcgaggaaccgcacggcgacccagccg 57
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
||| ||||||| ||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 56 gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttgg 2
>gb|CA613946.1|CA613946 wr1.pk182.f9 wr1 Triticum aestivum cDNA clone wr1.pk182.f9 5' end,
mRNA sequence
Length = 519
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 330 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 271
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
||| ||||||| || |||||| |||| || ||||||||||||||| ||||||
Sbjct: 270 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 216
>gb|CA614878.1|CA614878 wr1.pk183.d3 wr1 Triticum aestivum cDNA clone wr1.pk183.d3 5' end,
mRNA sequence
Length = 481
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 195 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 136
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
||| ||||||| || |||||| |||| || ||||||||||||||| ||||||
Sbjct: 135 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 81
>gb|CA644692.1|CA644692 wre1n.pk0081.g7 wre1n Triticum aestivum cDNA clone wre1n.pk0081.g7
5' end, mRNA sequence
Length = 518
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||| ||||| | ||| || ||||| |||||||||||||| || | ||| ||||| |||
Sbjct: 115 tggcagtgcataagccacacaccgggattgtcggcgaggaaccgcacggcgacccagccg 56
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
||| ||||||| ||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 55 gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttgg 1
>gb|CA642536.1|CA642536 wre1n.pk0058.h8 wre1n Triticum aestivum cDNA clone wre1n.pk0058.h8
5' end, mRNA sequence
Length = 559
Score = 87.7 bits (44), Expect = 7e-016
Identities = 62/68 (91%)
Strand = Plus / Minus
Query: 442 ggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttg 501
||||||| ||||||||| |||||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 284 ggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttggccggatcgttg 225
Query: 502 acggggtc 509
| ||||||
Sbjct: 224 atggggtc 217
>gb|CA641231.1|CA641231 wre1n.pk0041.f4 wre1n Triticum aestivum cDNA clone wre1n.pk0041.f4
5' end, mRNA sequence
Length = 538
Score = 83.8 bits (42), Expect = 1e-014
Identities = 90/106 (84%)
Strand = Plus / Minus
Query: 385 atgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggc 444
|||| |||||| |||||||||| ||||| |||||||||||| ||||| ||| ||| |||
Sbjct: 321 atgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccggcggtgggc 262
Query: 445 acgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
|||| || |||||| |||| || ||||||||||||||| ||||||
Sbjct: 261 acgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 216
>gb|CA618732.1|CA618732 wl1n.pk0037.b2 wl1n Triticum aestivum cDNA clone wl1n.pk0037.b2 5'
end, mRNA sequence
Length = 473
Score = 81.8 bits (41), Expect = 4e-014
Identities = 107/129 (82%)
Strand = Plus / Minus
Query: 283 tctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgcc 342
|||| ||||||||| | |||||||||| ||| ||||||||||| |||||| ||| |||
Sbjct: 133 tctgccggcggcggcgggagcttctggttcggaaggctgccgtcctgcaccagccacgcc 74
Query: 343 atcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccgggg 402
||| | || ||||| | ||||| ||||||| ||||||||||||||||| || || |||
Sbjct: 73 atcttcagcccccagctcatgtgcacctccaagtggcaatgcatgaaccatacacctggg 14
Query: 403 ttgtcggcg 411
|||||||||
Sbjct: 13 ttgtcggcg 5
>gb|CA639459.1|CA639459 wre1n.pk0014.d7 wre1n Triticum aestivum cDNA clone wre1n.pk0014.d7
5' end, mRNA sequence
Length = 360
Score = 73.8 bits (37), Expect = 1e-011
Identities = 91/109 (83%)
Strand = Plus / Minus
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
|||||||| | ||| ||||||||||| |||||||||||| ||| ||||||||| ||
Sbjct: 109 catttgggcatgtcagacggcggcggcagcagcttctggctcggcttgctgccgtcctgc 50
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggc 379
||| ||| ||||| || || ||||||||||||||| ||||||||||||
Sbjct: 49 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggc 1
>gb|BJ266294.1|BJ266294 BJ266294 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh25o06 3', mRNA sequence
Length = 178
Score = 67.9 bits (34), Expect = 6e-010
Identities = 81/100 (81%)
Strand = Plus / Plus
Query: 340 gccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccg 399
||||| || || ||| |||||| |||| ||| ||||||| ||||||||||||| || ||
Sbjct: 77 gccattctnagacccnatgttgngtgcacctncaaatggnaatgcatgaaccatacacct 136
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccgg 439
||||||| | || |||||| |||| |||||| ||| |||
Sbjct: 137 gggttgtntgngangaagcgaatggncacccacccgncgg 176
>gb|CA606529.1|CA606529 wr1.pk0071.g7 wr1 Triticum aestivum cDNA clone wr1.pk0071.g7 5'
end, mRNA sequence
Length = 357
Score = 65.9 bits (33), Expect = 3e-009
Identities = 45/49 (91%)
Strand = Plus / Minus
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
|||||||||||||| ||||||||| |||||||||||| |||| ||||||
Sbjct: 58 atggcaatgcatgagccaaacccccgggttgtcggcgcggaaccggatg 10
>gb|CV775699.1|CV775699 FGAS070103 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 818
Score = 60.0 bits (30), Expect = 2e-007
Identities = 46/50 (92%), Gaps = 1/50 (2%)
Strand = Plus / Minus
Query: 375 atggcaatgcatgaaccaaacccc-ggggttgtcggcgaggaagcggatg 423
|||||||||||||| ||||||||| ||||||||||||| |||| ||||||
Sbjct: 613 atggcaatgcatgagccaaacccccggggttgtcggcgcggaaccggatg 564
>gb|CA603455.1|CA603455 wr1.pk0024.b3 wr1 Triticum aestivum cDNA clone wr1.pk0024.b3 5'
end, mRNA sequence
Length = 279
Score = 58.0 bits (29), Expect = 6e-007
Identities = 44/49 (89%)
Strand = Plus / Minus
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
|||||||||||||| ||| ||||| |||||||||||| |||| ||||||
Sbjct: 154 atggcaatgcatgagccacacccccgggttgtcggcgcggaaccggatg 106
>gb|CK200177.1|CK200177 FGAS008684 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 875
Score = 58.0 bits (29), Expect = 6e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
|||||||||||||| ||| ||||| |||||||||||| |||| ||||||
Sbjct: 463 atggcaatgcatgagccacacccccgggttgtcggcgcggaaccggatg 511
>gb|BJ277445.1|BJ277445 BJ277445 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr11i06 5', mRNA sequence
Length = 394
Score = 56.0 bits (28), Expect = 2e-006
Identities = 64/76 (84%)
Strand = Plus / Minus
Query: 348 gaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtc 407
||||||||| || ||||| | |||| |||||| ||||| | ||| ||||||||||||||
Sbjct: 279 gaggccccaggtgatgtgcacatccagatggcagtgcatcagccacaccccggggttgtc 220
Query: 408 ggcgaggaagcggatg 423
||||| ||| ||||||
Sbjct: 219 ggcgacgaaccggatg 204
>gb|BJ289468.1|BJ289468 BJ289468 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
aestivum cDNA clone whsl5h22 5', mRNA sequence
Length = 617
Score = 56.0 bits (28), Expect = 2e-006
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||||||| | |||| || ||||| |||||| ||| |||||||
Sbjct: 516 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 457
Query: 460 cgctcgacggggtcgacgaggttg 483
|| | ||||||||||| ||||||
Sbjct: 456 cgggccacggggtcgaccaggttg 433
>gb|BJ295794.1|BJ295794 BJ295794 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
aestivum cDNA clone whsl5h22 3', mRNA sequence
Length = 734
Score = 56.0 bits (28), Expect = 2e-006
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||||||| | |||| || ||||| |||||| ||| |||||||
Sbjct: 357 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 416
Query: 460 cgctcgacggggtcgacgaggttg 483
|| | ||||||||||| ||||||
Sbjct: 417 cgggccacggggtcgaccaggttg 440
>gb|AJ610434.1|AJ610434 AJ610434 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 02170R, mRNA
sequence
Length = 265
Score = 56.0 bits (28), Expect = 2e-006
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||||||| | |||| || ||||| |||||| ||| |||||||
Sbjct: 181 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 122
Query: 460 cgctcgacggggtcgacgaggttg 483
|| | ||||||||||| ||||||
Sbjct: 121 cgggccacggggtcgaccaggttg 98
>gb|CD453012.1|CD453012 WHE1451_B11_C21ZT CS wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1451_B11_C21,
mRNA sequence
Length = 336
Score = 50.1 bits (25), Expect = 1e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcg 411
|||||||||||||| ||| ||||| ||||||||||||
Sbjct: 300 atggcaatgcatgagccacacccccgggttgtcggcg 336
>gb|BG904426.1|BG904426 TaLr1132A11F TaLr1 Triticum aestivum cDNA clone TaLr1132A11 3',
mRNA sequence
Length = 537
Score = 48.1 bits (24), Expect = 6e-004
Identities = 69/84 (82%)
Strand = Plus / Plus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||| ||| | |||| || ||||| | |||| ||| |||||||
Sbjct: 370 gggttgttggcgacgaagcgtatgacggcccagcctccggcggccacggcgatggtgttg 429
Query: 460 cgctcgacggggtcgacgaggttg 483
|| || ||||||||||| ||||||
Sbjct: 430 cggtccacggggtcgaccaggttg 453
>gb|BG905538.1|BG905538 TaLr1140E03R TaLr1 Triticum aestivum cDNA clone TaLr1140E03 5',
mRNA sequence
Length = 679
Score = 48.1 bits (24), Expect = 6e-004
Identities = 63/76 (82%)
Strand = Plus / Plus
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
||||| |||||||||| | |||| || ||||| |||||| ||| ||||||||| | ||
Sbjct: 402 ggcgacgaagcggatgacggcccagcccccggcgggcacggcgatggtgttgcgggccac 461
Query: 468 ggggtcgacgaggttg 483
||||||||| ||||||
Sbjct: 462 ggggtcgaccaggttg 477
>gb|BG906020.1|BG906020 TaLr1144C10F TaLr1 Triticum aestivum cDNA clone TaLr1144C10 3',
mRNA sequence
Length = 526
Score = 48.1 bits (24), Expect = 6e-004
Identities = 63/76 (82%)
Strand = Plus / Plus
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
||||| |||||||||| | |||| || ||||| |||||| ||| ||||||||| | ||
Sbjct: 391 ggcgacgaagcggatgacggcccagcccccggcgggcacggcgatggtgttgcgggccac 450
Query: 468 ggggtcgacgaggttg 483
||||||||| ||||||
Sbjct: 451 ggggtcgaccaggttg 466
>gb|CA625829.1|CA625829 wl1n.pk0134.d9 wl1n Triticum aestivum cDNA clone wl1n.pk0134.d9 5'
end, mRNA sequence
Length = 520
Score = 48.1 bits (24), Expect = 6e-004
Identities = 69/84 (82%)
Strand = Plus / Minus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||||||| | |||| || ||||| || ||| ||| |||||||
Sbjct: 160 gggttgttggcgacgaagcggatgacggcccagcccccggcggggacggcgatggtgttg 101
Query: 460 cgctcgacggggtcgacgaggttg 483
|| | ||||||||||| ||||||
Sbjct: 100 cgggccacggggtcgaccaggttg 77
>gb|CV776169.1|CV776169 FGAS070573 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 836
Score = 48.1 bits (24), Expect = 6e-004
Identities = 69/84 (82%)
Strand = Plus / Minus
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
||||||| ||||| |||||||||| | |||| || ||||| || ||| ||| |||||||
Sbjct: 428 gggttgttggcgacgaagcggatgacggcccagcccccggcggggacggcgatggtgttg 369
Query: 460 cgctcgacggggtcgacgaggttg 483
|| | ||||||||||| ||||||
Sbjct: 368 cgggccacggggtcgaccaggttg 345
>gb|BJ253959.1|BJ253959 BJ253959 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf3o13 3', mRNA sequence
Length = 361
Score = 46.1 bits (23), Expect = 0.002
Identities = 92/114 (80%), Gaps = 1/114 (0%)
Strand = Plus / Plus
Query: 286 gacggcggcgggagcagc-ttctggtgcgggaggctgccgtcgagcaccaaccatgccat 344
|||||||| ||||||||| ||||||| |||||||| ||||| |||||| ||| |||||
Sbjct: 244 gacggcggagggagcagccttctggttggggaggctcccgtcctgcaccacccacgccat 303
Query: 345 cctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
| |||||||| | |||| |||||| ||| ||||||||||||| |||||
Sbjct: 304 tttcaggccccagctgacgtgcacctccaggtggnaatgcatgaaccacacccc 357
>gb|CA645095.1|CA645095 wre1n.pk0087.c2 wre1n Triticum aestivum cDNA clone wre1n.pk0087.c2
5' end, mRNA sequence
Length = 470
Score = 46.1 bits (23), Expect = 0.002
Identities = 53/63 (84%)
Strand = Plus / Minus
Query: 283 tctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgcc 342
|||| ||||||||| | |||||||||| ||| ||||||||||| |||||| ||| |||
Sbjct: 97 tctgccggcggcggcgggagcttctggttcggaaggctgccgtcctgcaccagccacgcc 38
Query: 343 atc 345
|||
Sbjct: 37 atc 35
>gb|BQ753073.1|BQ753073 WHE4122_F11_K22ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4122_F11_K22, mRNA sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.009
Identities = 44/50 (88%), Gaps = 1/50 (2%)
Strand = Plus / Minus
Query: 375 atggcaatgcatgaacca-aaccccggggttgtcggcgaggaagcggatg 423
|||||||||||||| ||| | ||||||| ||||||||| |||| ||||||
Sbjct: 431 atggcaatgcatgagccacacccccgggcttgtcggcgcggaaccggatg 382
>gb|CK193650.1|CK193650 FGAS002066 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 868
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaaccccggggtt 404
|||||||||||||| ||||||||| |||||
Sbjct: 477 atggcaatgcatgagccaaacccccgggtt 506
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 119,313
Number of Sequences: 636343
Number of extensions: 119313
Number of successful extensions: 34218
Number of sequences better than 0.5: 47
Number of HSP's better than 0.5 without gapping: 45
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 34145
Number of HSP's gapped (non-prelim): 55
length of query: 509
length of database: 367,240,239
effective HSP length: 19
effective length of query: 490
effective length of database: 355,149,722
effective search space: 174023363780
effective search space used: 174023363780
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)