BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8616263.2.1
         (509 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BJ275846.1|BJ275846  BJ275846 Y. Ogihara unpublished cDNA...   244   5e-063
gb|CD453999.1|CD453999  WHE0952_C12_E24ZT CS wheat pre-anthe...   244   5e-063
gb|CD454414.1|CD454414  WHE2310_D09_G18ZT CS wheat pre-anthe...   188   3e-046
gb|BJ261054.1|BJ261054  BJ261054 Y. Ogihara unpublished cDNA...   184   4e-045
gb|CA612399.1|CA612399  wr1.pk0140.g4 wr1 Triticum aestivum ...   178   2e-043
gb|BF201817.1|BF201817  WHE1759-1762_B09_B09ZS Wheat pre-ant...   165   4e-039
gb|BJ253690.1|BJ253690  BJ253690 Y. Ogihara unpublished cDNA...   161   6e-038
gb|BF485349.1|BF485349  WHE2310_D09_G18ZS Wheat pre-anthesis...   151   5e-035
gb|CA620405.1|CA620405  wl1n.pk0055.f2 wl1n Triticum aestivu...   151   5e-035
gb|BJ265154.1|BJ265154  BJ265154 Y. Ogihara unpublished cDNA...   141   5e-032
gb|BJ265155.1|BJ265155  BJ265155 Y. Ogihara unpublished cDNA...   135   3e-030
gb|CK152823.1|CK152823  FGAS035899 Triticum aestivum FGAS: T...   119   2e-025
gb|BJ260602.1|BJ260602  BJ260602 Y. Ogihara unpublished cDNA...   111   5e-023
gb|BJ257672.1|BJ257672  BJ257672 Y. Ogihara unpublished cDNA...   109   2e-022
gb|CA643522.1|CA643522  wre1n.pk0073.d9 wre1n Triticum aesti...   109   2e-022
gb|BG606868.1|BG606868  WHE2454_C06_F12ZS Triticum monococcu...   100   2e-019
gb|BJ257666.1|BJ257666  BJ257666 Y. Ogihara unpublished cDNA...   100   2e-019
gb|BU672356.1|BU672356  WHE3303_F03_L05ZS Chinese Spring whe...   100   2e-019
gb|CD491996.1|CD491996  WHE2454_C06_F12ZT Triticum monococcu...   100   2e-019
gb|BF201692.1|BF201692  WHE1774_E05_J10ZS Wheat pre-anthesis...    94   1e-017
gb|CA602287.1|CA602287  wr1.pk0017.f12 wr1 Triticum aestivum...    94   1e-017
gb|CA613946.1|CA613946  wr1.pk182.f9 wr1 Triticum aestivum c...    94   1e-017
gb|CA614878.1|CA614878  wr1.pk183.d3 wr1 Triticum aestivum c...    94   1e-017
gb|CA644692.1|CA644692  wre1n.pk0081.g7 wre1n Triticum aesti...    94   1e-017
gb|CA642536.1|CA642536  wre1n.pk0058.h8 wre1n Triticum aesti...    88   7e-016
gb|CA641231.1|CA641231  wre1n.pk0041.f4 wre1n Triticum aesti...    84   1e-014
gb|CA618732.1|CA618732  wl1n.pk0037.b2 wl1n Triticum aestivu...    82   4e-014
gb|CA639459.1|CA639459  wre1n.pk0014.d7 wre1n Triticum aesti...    74   1e-011
gb|BJ266294.1|BJ266294  BJ266294 Y. Ogihara unpublished cDNA...    68   6e-010
gb|CA606529.1|CA606529  wr1.pk0071.g7 wr1 Triticum aestivum ...    66   3e-009
gb|CV775699.1|CV775699  FGAS070103 Triticum aestivum FGAS: L...    60   2e-007
gb|CA603455.1|CA603455  wr1.pk0024.b3 wr1 Triticum aestivum ...    58   6e-007
gb|CK200177.1|CK200177  FGAS008684 Triticum aestivum FGAS: L...    58   6e-007
gb|BJ277445.1|BJ277445  BJ277445 Y. Ogihara unpublished cDNA...    56   2e-006
gb|BJ289468.1|BJ289468  BJ289468 Y. Ogihara unpublished cDNA...    56   2e-006
gb|BJ295794.1|BJ295794  BJ295794 Y. Ogihara unpublished cDNA...    56   2e-006
gb|AJ610434.1|AJ610434  AJ610434 Triticum turgidum subsp. du...    56   2e-006
gb|CD453012.1|CD453012  WHE1451_B11_C21ZT CS wheat etiolated...    50   1e-004
gb|BG904426.1|BG904426  TaLr1132A11F TaLr1 Triticum aestivum...    48   6e-004
gb|BG905538.1|BG905538  TaLr1140E03R TaLr1 Triticum aestivum...    48   6e-004
gb|BG906020.1|BG906020  TaLr1144C10F TaLr1 Triticum aestivum...    48   6e-004
gb|CA625829.1|CA625829  wl1n.pk0134.d9 wl1n Triticum aestivu...    48   6e-004
gb|CV776169.1|CV776169  FGAS070573 Triticum aestivum FGAS: L...    48   6e-004
gb|BJ253959.1|BJ253959  BJ253959 Y. Ogihara unpublished cDNA...    46   0.002
gb|CA645095.1|CA645095  wre1n.pk0087.c2 wre1n Triticum aesti...    46   0.002
gb|BQ753073.1|BQ753073  WHE4122_F11_K22ZS Wheat salt-stresse...    44   0.009
gb|CK193650.1|CK193650  FGAS002066 Triticum aestivum FGAS: L...    44   0.009
>gb|BJ275846.1|BJ275846 BJ275846 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
           aestivum cDNA clone whoh9o22 3', mRNA sequence
          Length = 661

 Score =  244 bits (123), Expect = 5e-063
 Identities = 207/235 (88%)
 Strand = Plus / Plus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 215 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 274

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 275 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 334

                                                                       
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
           || || || |||||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 335 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggccggcacgccg 394

                                                                  
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
           |||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 395 acggtgttccgctcgacggggtcgacgaggttgaacttggccgggtcgttcacgg 449
>gb|CD453999.1|CD453999 WHE0952_C12_E24ZT CS wheat pre-anthesis spike cDNA library Triticum
           aestivum cDNA clone WHE0952_C12_E24, mRNA sequence
          Length = 610

 Score =  244 bits (123), Expect = 5e-063
 Identities = 207/235 (88%)
 Strand = Plus / Plus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 236 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 295

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 296 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 355

                                                                       
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
           || || || |||||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 356 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggccggcacgccg 415

                                                                  
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
           |||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 416 acggtgttccgctcgacggggtcgacgaggttgaacttggccgggtcgttcacgg 470
>gb|CD454414.1|CD454414 WHE2310_D09_G18ZT CS wheat pre-anthesis spike cDNA library Triticum
           aestivum cDNA clone WHE2310_D09_G18, mRNA sequence
          Length = 639

 Score =  188 bits (95), Expect = 3e-046
 Identities = 176/203 (86%)
 Strand = Plus / Plus

                                                                       
Query: 288 cggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgccatcct 347
           |||||||||  | |||||||||| ||| ||| | ||||| ||||||| ||| |||||| |
Sbjct: 395 cggcggcggcgggagcttctggttcggaaggtttccgtccagcaccagccacgccatctt 454

                                                                       
Query: 348 gaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtc 407
            || |||||  |  ||||| ||||||||||||||||||||||||| || || ||||||||
Sbjct: 455 cagcccccagctcatgtgcacctccaaatggcaatgcatgaaccatacacctgggttgtc 514

                                                                       
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
           |||| | ||||||||||| ||||| |||||||| || |||||||||||||||||||||||
Sbjct: 515 ggcgcgaaagcggatggcgacccagccgccggcggggacgccgacggtgttgcgctcgac 574

                                  
Query: 468 ggggtcgacgaggttgaacttgg 490
           |||||||||||||||||||||||
Sbjct: 575 ggggtcgacgaggttgaacttgg 597
>gb|BJ261054.1|BJ261054 BJ261054 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh1c05 3', mRNA sequence
          Length = 647

 Score =  184 bits (93), Expect = 4e-045
 Identities = 204/241 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 aacatttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcga 328
           |||||||||| |  || |||||||| ||||||||||||||||  |||||||| |||||  
Sbjct: 312 aacatttgggaagatcggacggcggagggagcagcttctggttggggaggctcccgtcct 371

                                                                       
Query: 329 gcaccaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatga 388
           |||||| ||| |||||  | ||||||||  |   |||| ||||||| |||||||||||||
Sbjct: 372 gcaccacccacgccattttcaggccccagctgacgtgcacctccaagtggcaatgcatga 431

                                                                       
Query: 389 accaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgc 448
           |||| ||||| || || |||||  |||||||||| |||||||| ||| |||| |||||||
Sbjct: 432 accacacccctggattatcggcacggaagcggattgccacccacccggcggcgggcacgc 491

                                                                       
Query: 449 cgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacggggt 508
           |||||||||| | |||||||||||||||||||||| |||||| |||||| ||||||||||
Sbjct: 492 cgacggtgttcctctcgacggggtcgacgaggttgtacttggccgggtccttgacggggt 551

            
Query: 509 c 509
           |
Sbjct: 552 c 552
>gb|CA612399.1|CA612399 wr1.pk0140.g4 wr1 Triticum aestivum cDNA clone wr1.pk0140.g4 5'
           end, mRNA sequence
          Length = 489

 Score =  178 bits (90), Expect = 2e-043
 Identities = 169/194 (87%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 ggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgccatcctg 348
           ||||| |||||||||||||||| ||| ||||| |||||  |||||| ||||||||| |  
Sbjct: 258 ggcggggggagcagcttctggttcggtaggctcccgtcttgcaccagccatgccattcgt 199

                                                                       
Query: 349 aggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtcg 408
           || ||||| ||||||||| ||||||||||||||||||||||||| | | | |||||||||
Sbjct: 198 agtccccaagttgtgtgcacctccaaatggcaatgcatgaaccata-cactgggttgtcg 140

                                                                       
Query: 409 gcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgacg 468
           ||||| || || |||||||||||||| || || |||||||| |||||||| |||||||||
Sbjct: 139 gcgagaaaacgtatggccacccatccaccagctggcacgccaacggtgtttcgctcgacg 80

                         
Query: 469 gggtcgacgaggtt 482
           ||||||||||||||
Sbjct: 79  gggtcgacgaggtt 66
>gb|BF201817.1|BF201817 WHE1759-1762_B09_B09ZS Wheat pre-anthesis spike cDNA library
           Triticum aestivum cDNA clone WHE1759-1762_B09_B09, mRNA
           sequence
          Length = 466

 Score =  165 bits (83), Expect = 4e-039
 Identities = 131/147 (89%)
 Strand = Plus / Minus

                                                                       
Query: 363 gtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggat 422
           |||| ||||||  ||||||||||||||||| ||||| || || |||||| ||||||||||
Sbjct: 437 gtgcacctccaggtggcaatgcatgaaccacacccctggattatcggcgcggaagcggat 378

                                                                       
Query: 423 ggccacccatccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggtt 482
           ||||||||| ||| |||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 377 ggccacccacccggcggcgggcacgccgacggtgttccgctcgacggggtcgacgaggtt 318

                                      
Query: 483 gaacttggacgggtcgttgacggggtc 509
           | |||||| |||||| ||| |||||||
Sbjct: 317 gtacttggccgggtccttggcggggtc 291
>gb|BJ253690.1|BJ253690 BJ253690 Y. Ogihara unpublished cDNA library, Wh_f Triticum
           aestivum cDNA clone whf2o13 3', mRNA sequence
          Length = 571

 Score =  161 bits (81), Expect = 6e-038
 Identities = 192/229 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 aacatttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcga 328
           |||||||||| |  || |||||||| ||||||||||||||||  |||||||| |||||  
Sbjct: 336 aacatttgggaagatcggacggcggagggagcagcttctggttggggaggctcccgtcct 395

                                                                       
Query: 329 gcaccaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatga 388
           |||||| ||| |||||  | ||||||||  |   |||| ||||||  |||||||||||||
Sbjct: 396 gcaccacccacgccattttcaggccccagctgacgtgcacctccaggtggcaatgcatga 455

                                                                       
Query: 389 accaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgc 448
           |||| ||||| || || |||||  ||||||||||||||||||| ||  |||| |||||||
Sbjct: 456 accacacccctggattatcggcacggaagcggatggccacccacccagcggcgggcacgc 515

                                                            
Query: 449 cgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtc 497
           |||||||||| ||||| |||||||||||||||||| |||||| ||||||
Sbjct: 516 cgacggtgttccgctcaacggggtcgacgaggttgtacttggccgggtc 564
>gb|BF485349.1|BF485349 WHE2310_D09_G18ZS Wheat pre-anthesis spike cDNA library Triticum
           aestivum cDNA clone WHE2310_D09_G18, mRNA sequence
          Length = 451

 Score =  151 bits (76), Expect = 5e-035
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccaccc 430
           |||||||||||||||||| ||| || |  |||||||||||| | ||||||||||| ||||
Sbjct: 451 ccaaatggcaatgcatgagccatacacgtgggttgtcggcgcgaaagcggatggcgaccc 392

                                                                       
Query: 431 atccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
           | |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 agccgccggcggggacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 332
>gb|CA620405.1|CA620405 wl1n.pk0055.f2 wl1n Triticum aestivum cDNA clone wl1n.pk0055.f2 5'
           end, mRNA sequence
          Length = 602

 Score =  151 bits (76), Expect = 5e-035
 Identities = 195/235 (82%), Gaps = 1/235 (0%)
 Strand = Plus / Minus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| ||||||||||||||||| ||||||  |||   |||||||||  ||
Sbjct: 381 catttgggcatgtcagacggcggcgggagcag-ttctggctcggcttgctgccgtcatgc 323

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||| || |||||| || ||||||| ||||||||||||
Sbjct: 322 acctgccacgccattctcagaccccacgtcgtgtgcaccnccaaatgacaatgcatgaac 263

                                                                       
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccg 450
           || || |  |||||||| || |||||||| ||||||||||| |||||  | |||||||||
Sbjct: 262 catacacttgggttgtcagcaaggaagcgaatggccacccacccgcccncnggcacgccg 203

                                                                  
Query: 451 acggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttgacgg 505
           |||||||  |||| |||||||||||||||||||||||||  ||| ||||| ||||
Sbjct: 202 acggtgtnccgctggacggggtcgacgaggttgaacttgtccggntcgttcacgg 148
>gb|BJ265154.1|BJ265154 BJ265154 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh11o05 3', mRNA sequence
          Length = 386

 Score =  141 bits (71), Expect = 5e-032
 Identities = 146/171 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 216 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 275

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 276 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 335

                                                              
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggcc 441
           || || || |||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 336 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggcc 386
>gb|BJ265155.1|BJ265155 BJ265155 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh11o06 3', mRNA sequence
          Length = 342

 Score =  135 bits (68), Expect = 3e-030
 Identities = 145/171 (84%)
 Strand = Plus / Plus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 172 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 231

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| ||| |||||||||||||||||||
Sbjct: 232 acctgccacgccattctcagaccccatgttgtgtgcacctncaaatggcaatgcatgaac 291

                                                              
Query: 391 caaaccccggggttgtcggcgaggaagcggatggccacccatccgccggcc 441
           || || || |||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 292 catacacctgggttgtctgcgaggaagcgaatggccacccacccgccggcc 342
>gb|CK152823.1|CK152823 FGAS035899 Triticum aestivum FGAS: TaLt3 Triticum aestivum cDNA,
           mRNA sequence
          Length = 889

 Score =  119 bits (60), Expect = 2e-025
 Identities = 106/120 (88%), Gaps = 2/120 (1%)
 Strand = Plus / Minus

                                                                       
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggcca 427
           |||||||||||||||||| |||||| || || || | ||||||||||||||| ||| |||
Sbjct: 773 cctccaaatggcaatgcacgaaccatacacctggnt-gtcggcgaggaagcgaatgncca 715

                                                                       
Query: 428 cccatccgccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaact 487
           |||| |||||||||||||||| ||| ||||| |||||||||||||| |||||| ||||||
Sbjct: 714 cccacccgccggccggcacgcngac-gtgttccgctcgacggggtccacgaggntgaact 656
>gb|BJ260602.1|BJ260602 BJ260602 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh25o06 5', mRNA sequence
          Length = 412

 Score =  111 bits (56), Expect = 5e-023
 Identities = 145/172 (84%), Gaps = 2/172 (1%)
 Strand = Plus / Minus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 171 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 112

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 111 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 52

                                                               
Query: 391 caaaccccggggttgt-cggcgaggaagcggatggccacccatccgccggcc 441
           || || || ||||||| | |||||||||| || ||||||||| |||||||||
Sbjct: 51  catacacctgggttgtnctgcgaggaagc-gaaggccacccacccgccggcc 1
>gb|BJ257672.1|BJ257672 BJ257672 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh11p05 5', mRNA sequence
          Length = 181

 Score =  109 bits (55), Expect = 2e-022
 Identities = 136/162 (83%), Gaps = 1/162 (0%)
 Strand = Plus / Minus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| | |||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 166 catttgggcatgtcagncggcggcggcggcagcttctggctcggcttgctgccgtcctgc 107

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 106 acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 47

                                                     
Query: 391 caaaccccggggttgt-cggcgaggaagcggatggccaccca 431
           || || || ||||||| | ||||||||||| |||||||||||
Sbjct: 46  catacacctgggttgtnctgcgaggaagcgaatggccaccca 5
>gb|CA643522.1|CA643522 wre1n.pk0073.d9 wre1n Triticum aestivum cDNA clone wre1n.pk0073.d9
           5' end, mRNA sequence
          Length = 454

 Score =  109 bits (55), Expect = 2e-022
 Identities = 109/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 128 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 69

                                                                       
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
            |||  ||||||| ||||||||| |||||||||||||||||||||||| |||||| ||| 
Sbjct: 68  gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttggccgga 9

                  
Query: 496 tcgttga 502
           |||||||
Sbjct: 8   tcgttga 2
>gb|BG606868.1|BG606868 WHE2454_C06_F12ZS Triticum monococcum early reproductive apex cDNA
           library Triticum monococcum cDNA clone WHE2454_C06_F12,
           mRNA sequence
          Length = 453

 Score = 99.6 bits (50), Expect = 2e-019
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 335 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 276

                                                                       
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
            |||  ||||||| ||| ||||| || ||||||||||||||||||||| |||||| ||| 
Sbjct: 275 gcggtgggcacgctgacagtgttccgttcgacggggtcgacgaggttgtacttggccgga 216

                         
Query: 496 tcgttgacggggtc 509
           ||||||| ||||||
Sbjct: 215 tcgttgatggggtc 202
>gb|BJ257666.1|BJ257666 BJ257666 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh11o05 5', mRNA sequence
          Length = 342

 Score = 99.6 bits (50), Expect = 2e-019
 Identities = 126/150 (84%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| |||||||||||  |||||||||||  |||   |||||||||  ||
Sbjct: 151 catttgggcatgtcagacggcggcggcggcagcttctggctcggcttgctgccgtcctgc 92

                                                                       
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaac 390
           |||  ||| ||||| || || ||||||||||||||| |||||||||||||||||||||||
Sbjct: 91  acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggcaatgcatgaac 32

                                         
Query: 391 caaaccccggggttgt-cggcgaggaagcg 419
           || || || ||||||| | |||||||||||
Sbjct: 31  catacacctgggttgtcctgcgaggaagcg 2
>gb|BU672356.1|BU672356 WHE3303_F03_L05ZS Chinese Spring wheat drought stressed root cDNA
           library Triticum aestivum cDNA clone WHE3303_F03_L05,
           mRNA sequence
          Length = 537

 Score = 99.6 bits (50), Expect = 2e-019
 Identities = 113/134 (84%)
 Strand = Plus / Plus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 381 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 440

                                                                       
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
            |||  ||||||| ||||| ||| |||||||||||| ||||||||||| |||||| ||| 
Sbjct: 441 gcggtgggcacgctgacggagttccgctcgacggggacgacgaggttgtacttggccgga 500

                         
Query: 496 tcgttgacggggtc 509
           ||||||| ||||||
Sbjct: 501 tcgttgatggggtc 514
>gb|CD491996.1|CD491996 WHE2454_C06_F12ZT Triticum monococcum DV92 early reproductive apex
           cDNA library Triticum monococcum cDNA clone
           WHE2454_C06_F12, mRNA sequence
          Length = 690

 Score = 99.6 bits (50), Expect = 2e-019
 Identities = 113/134 (84%)
 Strand = Plus / Plus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || |||||||||||||||||||| || | ||| ||||| |||
Sbjct: 431 tggcagtgcataagccacacaccggggttgtcggcgaggaaccgcacggcgacccagccg 490

                                                                       
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacggg 495
            |||  ||||||| ||| ||||| || ||||||||||||||||||||| |||||| ||| 
Sbjct: 491 gcggtgggcacgctgacagtgttccgttcgacggggtcgacgaggttgtacttggccgga 550

                         
Query: 496 tcgttgacggggtc 509
           ||||||| ||||||
Sbjct: 551 tcgttgatggggtc 564
>gb|BF201692.1|BF201692 WHE1774_E05_J10ZS Wheat pre-anthesis spike cDNA library Triticum
           aestivum cDNA clone WHE1774_E05_J10, mRNA sequence
          Length = 429

 Score = 93.7 bits (47), Expect = 1e-017
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 385 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 326

                                                                  
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
            |||  ||||||| || |||||| ||||  || ||||||||||||||| ||||||
Sbjct: 325 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 271
>gb|CA602287.1|CA602287 wr1.pk0017.f12 wr1 Triticum aestivum cDNA clone wr1.pk0017.f12 5'
           end, mRNA sequence
          Length = 452

 Score = 93.7 bits (47), Expect = 1e-017
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || ||||| |||||||||||||| || | ||| ||||| |||
Sbjct: 116 tggcagtgcataagccacacaccgggattgtcggcgaggaaccgcacggcgacccagccg 57

                                                                  
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
            |||  ||||||| ||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 56  gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttgg 2
>gb|CA613946.1|CA613946 wr1.pk182.f9 wr1 Triticum aestivum cDNA clone wr1.pk182.f9 5' end,
           mRNA sequence
          Length = 519

 Score = 93.7 bits (47), Expect = 1e-017
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 330 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 271

                                                                  
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
            |||  ||||||| || |||||| ||||  || ||||||||||||||| ||||||
Sbjct: 270 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 216
>gb|CA614878.1|CA614878 wr1.pk183.d3 wr1 Triticum aestivum cDNA clone wr1.pk183.d3 5' end,
           mRNA sequence
          Length = 481

 Score = 93.7 bits (47), Expect = 1e-017
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||||| |||||| |||||||||| ||||| |||||||||||| ||||| |||
Sbjct: 195 tggcagtgcatgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccg 136

                                                                  
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
            |||  ||||||| || |||||| ||||  || ||||||||||||||| ||||||
Sbjct: 135 gcggtgggcacgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 81
>gb|CA644692.1|CA644692 wre1n.pk0081.g7 wre1n Triticum aestivum cDNA clone wre1n.pk0081.g7
           5' end, mRNA sequence
          Length = 518

 Score = 93.7 bits (47), Expect = 1e-017
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
           ||||| ||||| | ||| || ||||| |||||||||||||| || | ||| ||||| |||
Sbjct: 115 tggcagtgcataagccacacaccgggattgtcggcgaggaaccgcacggcgacccagccg 56

                                                                  
Query: 436 ccggccggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
            |||  ||||||| ||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 55  gcggtgggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttgg 1
>gb|CA642536.1|CA642536 wre1n.pk0058.h8 wre1n Triticum aestivum cDNA clone wre1n.pk0058.h8
           5' end, mRNA sequence
          Length = 559

 Score = 87.7 bits (44), Expect = 7e-016
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 442 ggcacgccgacggtgttgcgctcgacggggtcgacgaggttgaacttggacgggtcgttg 501
           ||||||| ||||||||| |||||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 284 ggcacgctgacggtgttccgctcgacggggtcgacgaggttgtacttggccggatcgttg 225

                   
Query: 502 acggggtc 509
           | ||||||
Sbjct: 224 atggggtc 217
>gb|CA641231.1|CA641231 wre1n.pk0041.f4 wre1n Triticum aestivum cDNA clone wre1n.pk0041.f4
           5' end, mRNA sequence
          Length = 538

 Score = 83.8 bits (42), Expect = 1e-014
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 385 atgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccgccggccggc 444
           |||| |||||| |||||||||| ||||| |||||||||||| ||||| ||| |||  |||
Sbjct: 321 atgatccaaacaccggggttgttggcgacgaagcggatggcgacccagccggcggtgggc 262

                                                         
Query: 445 acgccgacggtgttgcgctcgacggggtcgacgaggttgaacttgg 490
           |||| || |||||| ||||  || ||||||||||||||| ||||||
Sbjct: 261 acgctgatggtgttccgctgcaccgggtcgacgaggttgtacttgg 216
>gb|CA618732.1|CA618732 wl1n.pk0037.b2 wl1n Triticum aestivum cDNA clone wl1n.pk0037.b2 5'
           end, mRNA sequence
          Length = 473

 Score = 81.8 bits (41), Expect = 4e-014
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 283 tctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgcc 342
           |||| |||||||||  | |||||||||| ||| |||||||||||  |||||| ||| |||
Sbjct: 133 tctgccggcggcggcgggagcttctggttcggaaggctgccgtcctgcaccagccacgcc 74

                                                                       
Query: 343 atcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccgggg 402
           ||| | || |||||  |  ||||| ||||||| ||||||||||||||||| || || |||
Sbjct: 73  atcttcagcccccagctcatgtgcacctccaagtggcaatgcatgaaccatacacctggg 14

                    
Query: 403 ttgtcggcg 411
           |||||||||
Sbjct: 13  ttgtcggcg 5
>gb|CA639459.1|CA639459 wre1n.pk0014.d7 wre1n Triticum aestivum cDNA clone wre1n.pk0014.d7
           5' end, mRNA sequence
          Length = 360

 Score = 73.8 bits (37), Expect = 1e-011
 Identities = 91/109 (83%)
 Strand = Plus / Minus

                                                                       
Query: 271 catttgggtaagtctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagc 330
           |||||||| | ||| ||||||||||| ||||||||||||  |||   |||||||||  ||
Sbjct: 109 catttgggcatgtcagacggcggcggcagcagcttctggctcggcttgctgccgtcctgc 50

                                                            
Query: 331 accaaccatgccatcctgaggccccatgttgtgtgcgcctccaaatggc 379
           |||  ||| ||||| || || ||||||||||||||| ||||||||||||
Sbjct: 49  acctgccacgccattctcagaccccatgttgtgtgcacctccaaatggc 1
>gb|BJ266294.1|BJ266294 BJ266294 Y. Ogihara unpublished cDNA library, Wh_h Triticum
           aestivum cDNA clone whh25o06 3', mRNA sequence
          Length = 178

 Score = 67.9 bits (34), Expect = 6e-010
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                       
Query: 340 gccatcctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccg 399
           ||||| || || ||| |||||| |||| ||| ||||||| ||||||||||||| || || 
Sbjct: 77  gccattctnagacccnatgttgngtgcacctncaaatggnaatgcatgaaccatacacct 136

                                                   
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccgg 439
           |||||||  | || |||||| |||| |||||| ||| |||
Sbjct: 137 gggttgtntgngangaagcgaatggncacccacccgncgg 176
>gb|CA606529.1|CA606529 wr1.pk0071.g7 wr1 Triticum aestivum cDNA clone wr1.pk0071.g7 5'
           end, mRNA sequence
          Length = 357

 Score = 65.9 bits (33), Expect = 3e-009
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
           |||||||||||||| ||||||||| |||||||||||| |||| ||||||
Sbjct: 58  atggcaatgcatgagccaaacccccgggttgtcggcgcggaaccggatg 10
>gb|CV775699.1|CV775699 FGAS070103 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
           aestivum cDNA, mRNA sequence
          Length = 818

 Score = 60.0 bits (30), Expect = 2e-007
 Identities = 46/50 (92%), Gaps = 1/50 (2%)
 Strand = Plus / Minus

                                                             
Query: 375 atggcaatgcatgaaccaaacccc-ggggttgtcggcgaggaagcggatg 423
           |||||||||||||| ||||||||| ||||||||||||| |||| ||||||
Sbjct: 613 atggcaatgcatgagccaaacccccggggttgtcggcgcggaaccggatg 564
>gb|CA603455.1|CA603455 wr1.pk0024.b3 wr1 Triticum aestivum cDNA clone wr1.pk0024.b3 5'
           end, mRNA sequence
          Length = 279

 Score = 58.0 bits (29), Expect = 6e-007
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
           |||||||||||||| ||| ||||| |||||||||||| |||| ||||||
Sbjct: 154 atggcaatgcatgagccacacccccgggttgtcggcgcggaaccggatg 106
>gb|CK200177.1|CK200177 FGAS008684 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
           aestivum cDNA, mRNA sequence
          Length = 875

 Score = 58.0 bits (29), Expect = 6e-007
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatg 423
           |||||||||||||| ||| ||||| |||||||||||| |||| ||||||
Sbjct: 463 atggcaatgcatgagccacacccccgggttgtcggcgcggaaccggatg 511
>gb|BJ277445.1|BJ277445 BJ277445 Y. Ogihara unpublished cDNA library, Wh_r Triticum
           aestivum cDNA clone whr11i06 5', mRNA sequence
          Length = 394

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 gaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaaccccggggttgtc 407
           ||||||||| ||  ||||| | |||| |||||| ||||| | ||| ||||||||||||||
Sbjct: 279 gaggccccaggtgatgtgcacatccagatggcagtgcatcagccacaccccggggttgtc 220

                           
Query: 408 ggcgaggaagcggatg 423
           ||||| ||| ||||||
Sbjct: 219 ggcgacgaaccggatg 204
>gb|BJ289468.1|BJ289468 BJ289468 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
           aestivum cDNA clone whsl5h22 5', mRNA sequence
          Length = 617

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||||||| |  |||| || ||||| |||||| ||| |||||||
Sbjct: 516 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 457

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           ||  | ||||||||||| ||||||
Sbjct: 456 cgggccacggggtcgaccaggttg 433
>gb|BJ295794.1|BJ295794 BJ295794 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
           aestivum cDNA clone whsl5h22 3', mRNA sequence
          Length = 734

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||||||| |  |||| || ||||| |||||| ||| |||||||
Sbjct: 357 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 416

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           ||  | ||||||||||| ||||||
Sbjct: 417 cgggccacggggtcgaccaggttg 440
>gb|AJ610434.1|AJ610434 AJ610434 Triticum turgidum subsp. durum etiolated seedling 20 day
           Triticum turgidum subsp. durum cDNA clone 02170R, mRNA
           sequence
          Length = 265

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||||||| |  |||| || ||||| |||||| ||| |||||||
Sbjct: 181 gggttgttggcgacgaagcggatgacggcccagcctccggcgggcacggcgatggtgttg 122

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           ||  | ||||||||||| ||||||
Sbjct: 121 cgggccacggggtcgaccaggttg 98
>gb|CD453012.1|CD453012 WHE1451_B11_C21ZT CS wheat etiolated seedling root normalized cDNA
           library Triticum aestivum cDNA clone WHE1451_B11_C21,
           mRNA sequence
          Length = 336

 Score = 50.1 bits (25), Expect = 1e-004
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 375 atggcaatgcatgaaccaaaccccggggttgtcggcg 411
           |||||||||||||| ||| ||||| ||||||||||||
Sbjct: 300 atggcaatgcatgagccacacccccgggttgtcggcg 336
>gb|BG904426.1|BG904426 TaLr1132A11F TaLr1 Triticum aestivum cDNA clone TaLr1132A11 3',
           mRNA sequence
          Length = 537

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||| ||| |  |||| || ||||| | |||| ||| |||||||
Sbjct: 370 gggttgttggcgacgaagcgtatgacggcccagcctccggcggccacggcgatggtgttg 429

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           || || ||||||||||| ||||||
Sbjct: 430 cggtccacggggtcgaccaggttg 453
>gb|BG905538.1|BG905538 TaLr1140E03R TaLr1 Triticum aestivum cDNA clone TaLr1140E03 5',
           mRNA sequence
          Length = 679

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
           ||||| |||||||||| |  |||| || ||||| |||||| ||| |||||||||  | ||
Sbjct: 402 ggcgacgaagcggatgacggcccagcccccggcgggcacggcgatggtgttgcgggccac 461

                           
Query: 468 ggggtcgacgaggttg 483
           ||||||||| ||||||
Sbjct: 462 ggggtcgaccaggttg 477
>gb|BG906020.1|BG906020 TaLr1144C10F TaLr1 Triticum aestivum cDNA clone TaLr1144C10 3',
           mRNA sequence
          Length = 526

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 ggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttgcgctcgac 467
           ||||| |||||||||| |  |||| || ||||| |||||| ||| |||||||||  | ||
Sbjct: 391 ggcgacgaagcggatgacggcccagcccccggcgggcacggcgatggtgttgcgggccac 450

                           
Query: 468 ggggtcgacgaggttg 483
           ||||||||| ||||||
Sbjct: 451 ggggtcgaccaggttg 466
>gb|CA625829.1|CA625829 wl1n.pk0134.d9 wl1n Triticum aestivum cDNA clone wl1n.pk0134.d9 5'
           end, mRNA sequence
          Length = 520

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||||||| |  |||| || ||||| || ||| ||| |||||||
Sbjct: 160 gggttgttggcgacgaagcggatgacggcccagcccccggcggggacggcgatggtgttg 101

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           ||  | ||||||||||| ||||||
Sbjct: 100 cgggccacggggtcgaccaggttg 77
>gb|CV776169.1|CV776169 FGAS070573 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
           aestivum cDNA, mRNA sequence
          Length = 836

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 400 gggttgtcggcgaggaagcggatggccacccatccgccggccggcacgccgacggtgttg 459
           ||||||| ||||| |||||||||| |  |||| || ||||| || ||| ||| |||||||
Sbjct: 428 gggttgttggcgacgaagcggatgacggcccagcccccggcggggacggcgatggtgttg 369

                                   
Query: 460 cgctcgacggggtcgacgaggttg 483
           ||  | ||||||||||| ||||||
Sbjct: 368 cgggccacggggtcgaccaggttg 345
>gb|BJ253959.1|BJ253959 BJ253959 Y. Ogihara unpublished cDNA library, Wh_f Triticum
           aestivum cDNA clone whf3o13 3', mRNA sequence
          Length = 361

 Score = 46.1 bits (23), Expect = 0.002
 Identities = 92/114 (80%), Gaps = 1/114 (0%)
 Strand = Plus / Plus

                                                                       
Query: 286 gacggcggcgggagcagc-ttctggtgcgggaggctgccgtcgagcaccaaccatgccat 344
           |||||||| ||||||||| |||||||  |||||||| |||||  |||||| ||| |||||
Sbjct: 244 gacggcggagggagcagccttctggttggggaggctcccgtcctgcaccacccacgccat 303

                                                                 
Query: 345 cctgaggccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
             | ||||||||  |   |||| ||||||  ||| ||||||||||||| |||||
Sbjct: 304 tttcaggccccagctgacgtgcacctccaggtggnaatgcatgaaccacacccc 357
>gb|CA645095.1|CA645095 wre1n.pk0087.c2 wre1n Triticum aestivum cDNA clone wre1n.pk0087.c2
           5' end, mRNA sequence
          Length = 470

 Score = 46.1 bits (23), Expect = 0.002
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 283 tctgacggcggcgggagcagcttctggtgcgggaggctgccgtcgagcaccaaccatgcc 342
           |||| |||||||||  | |||||||||| ||| |||||||||||  |||||| ||| |||
Sbjct: 97  tctgccggcggcggcgggagcttctggttcggaaggctgccgtcctgcaccagccacgcc 38

              
Query: 343 atc 345
           |||
Sbjct: 37  atc 35
>gb|BQ753073.1|BQ753073 WHE4122_F11_K22ZS Wheat salt-stressed root cDNA library Triticum
           aestivum cDNA clone WHE4122_F11_K22, mRNA sequence
          Length = 660

 Score = 44.1 bits (22), Expect = 0.009
 Identities = 44/50 (88%), Gaps = 1/50 (2%)
 Strand = Plus / Minus

                                                             
Query: 375 atggcaatgcatgaacca-aaccccggggttgtcggcgaggaagcggatg 423
           |||||||||||||| ||| | ||||||| ||||||||| |||| ||||||
Sbjct: 431 atggcaatgcatgagccacacccccgggcttgtcggcgcggaaccggatg 382
>gb|CK193650.1|CK193650 FGAS002066 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
           aestivum cDNA, mRNA sequence
          Length = 868

 Score = 44.1 bits (22), Expect = 0.009
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 375 atggcaatgcatgaaccaaaccccggggtt 404
           |||||||||||||| ||||||||| |||||
Sbjct: 477 atggcaatgcatgagccaaacccccgggtt 506
  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 119,313
Number of Sequences: 636343
Number of extensions: 119313
Number of successful extensions: 34218
Number of sequences better than  0.5: 47
Number of HSP's better than  0.5 without gapping: 45
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 34145
Number of HSP's gapped (non-prelim): 55
length of query: 509
length of database: 367,240,239
effective HSP length: 19
effective length of query: 490
effective length of database: 355,149,722
effective search space: 174023363780
effective search space used: 174023363780
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)