BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8228901.3.1
(1173 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ752969.1|BQ752969 WHE4121_D03_G05ZS Wheat salt-stresse... 54 2e-005
gb|CV770951.1|CV770951 FGAS065344 Triticum aestivum FGAS: L... 50 4e-004
>gb|BQ752969.1|BQ752969 WHE4121_D03_G05ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4121_D03_G05, mRNA sequence
Length = 664
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 353 cagttcttcctgaatgacctgccgggaaacgacttcaac 391
||||||||||||||||||||||| || ||||| ||||||
Sbjct: 319 cagttcttcctgaatgacctgccagggaacgatttcaac 357
>gb|CV770951.1|CV770951 FGAS065344 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 861
Score = 50.1 bits (25), Expect = 4e-004
Identities = 55/65 (84%)
Strand = Plus / Plus
Query: 230 atggtcgtggccgacttaggctgctcatcggggcctaacacactgcgcttcatctccgag 289
|||||||| |||||| | |||||||| ||||| || ||||| ||||| || ||||||||
Sbjct: 224 atggtcgtcgccgacctcggctgctcgtcgggcccgaacactctgcgtgtcgtctccgag 283
Query: 290 gtgat 294
|||||
Sbjct: 284 gtgat 288
Score = 46.1 bits (23), Expect = 0.005
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 353 cagttcttcctgaatgacctgccgggaaacgacttcaac 391
||||| |||||||||||||||||||| || || ||||||
Sbjct: 347 cagtttttcctgaatgacctgccggggaatgatttcaac 385
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 202,721
Number of Sequences: 636343
Number of extensions: 202721
Number of successful extensions: 58970
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58967
Number of HSP's gapped (non-prelim): 3
length of query: 1173
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1153
effective length of database: 354,513,379
effective search space: 408753925987
effective search space used: 408753925987
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)