BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4790360.2.1
(667 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF473884.1|BF473884 WHE0932_D09_H18ZS Wheat 5-15 DAP spi... 285 2e-075
gb|CV066458.1|CV066458 WNEL4b5 Wheat EST endosperm library ... 278 5e-073
gb|CA657314.1|CA657314 wlm0.pk0034.f11 wlm0 Triticum aestiv... 109 2e-022
>gb|BF473884.1|BF473884 WHE0932_D09_H18ZS Wheat 5-15 DAP spike cDNA library Triticum
aestivum cDNA clone WHE0932_D09_H18, mRNA sequence
Length = 651
Score = 285 bits (144), Expect = 2e-075
Identities = 264/304 (86%)
Strand = Plus / Plus
Query: 21 tactcggatcacaatacttccttcatgcatatgggccaatttatgctttatcagctgacg 80
|||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
Sbjct: 118 tacttggatcagaatacttccttcatgcatatgggcctatttatgctttatcagctgatg 177
Query: 81 tggtggctagcttggttgcattgcgaaacaacagtttccgtatgttcagcaacgaggacg 140
||||||| ||||||||||| || |||||||||||||||| ||||||| ||||||||| |
Sbjct: 178 tggtggcaagcttggttgctgtgagaaacaacagtttccggatgttcaacaacgaggatg 237
Query: 141 ttacaattggatcgtggatgcttgctatgaacgtcaaccatgagaacacacatgcacttt 200
|||| |||||||| |||||||| ||||||||||||||||| |||||||| || || ||
Sbjct: 238 ttactattggatcctggatgctcgctatgaacgtcaaccacgagaacacgcacgctctca 297
Query: 201 gtgaacctgactgcacggagtcttcaattgctgtttgggacatcccaaaatgctcaggtc 260
||||| || ||||| | ||| ||||||||||| |||||||| |||||||||||||| |
Sbjct: 298 ccgaacccgagtgcacagcgtcctcaattgctgtctgggacattccaaaatgctcagggc 357
Query: 261 tatgccacccagaggtaaaaatgctagagctccatgaaagaaaagaatgcacaggtggtc 320
|||||||||| |||||||| ||||||||||| || | | ||||| ||||| |||||||
Sbjct: 358 tatgccacccggaggtaaagatgctagagcttcaccagcggaaagagtgcacgggtggtc 417
Query: 321 caac 324
||||
Sbjct: 418 caac 421
>gb|CV066458.1|CV066458 WNEL4b5 Wheat EST endosperm library Triticum aestivum cDNA clone
WNEL4b5 5' similar to Oryza sativa, mRNA sequence
Length = 546
Score = 278 bits (140), Expect = 5e-073
Identities = 263/304 (86%)
Strand = Plus / Plus
Query: 21 tactcggatcacaatacttccttcatgcatatgggccaatttatgctttatcagctgacg 80
|||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
Sbjct: 75 tacttggatcagaatacttccttcatgcatatgggcctatttatgctttatcagctgatg 134
Query: 81 tggtggctagcttggttgcattgcgaaacaacagtttccgtatgttcagcaacgaggacg 140
||||||| ||| ||||||| || ||||||||||||| || ||||||| ||| ||||| |
Sbjct: 135 tggtggcaagcctggttgctctgagaaacaacagttttcgaatgttcaacaatgaggatg 194
Query: 141 ttacaattggatcgtggatgcttgctatgaacgtcaaccatgagaacacacatgcacttt 200
|||| |||||||| |||||||||||||||||||||||||| |||||||| ||||| || |
Sbjct: 195 ttactattggatcctggatgcttgctatgaacgtcaaccacgagaacacgcatgctctgt 254
Query: 201 gtgaacctgactgcacggagtcttcaattgctgtttgggacatcccaaaatgctcaggtc 260
| ||||| || ||||| | ||| ||||||||||| ||||| || |||||||||||||| |
Sbjct: 255 gcgaacccgagtgcacagcgtcctcaattgctgtctgggatattccaaaatgctcagggc 314
Query: 261 tatgccacccagaggtaaaaatgctagagctccatgaaagaaaagaatgcacaggtggtc 320
|||||||||| |||||||| ||||| ||||| || | | ||||| ||||| |||||||
Sbjct: 315 tatgccacccggaggtaaagatgctggagcttcaccagcggaaagagtgcacgggtggtc 374
Query: 321 caac 324
||||
Sbjct: 375 caac 378
>gb|CA657314.1|CA657314 wlm0.pk0034.f11 wlm0 Triticum aestivum cDNA clone wlm0.pk0034.f11
5' end, mRNA sequence
Length = 463
Score = 109 bits (55), Expect = 2e-022
Identities = 144/167 (86%), Gaps = 5/167 (2%)
Strand = Plus / Plus
Query: 33 aatacttccttcatgcatatgggccaatttatgctttatc-agctgacg-tggtggctag 90
||||||||||||||||||||||||| |||||||||||||| |||||| | ||||||| ||
Sbjct: 223 aatacttccttcatgcatatgggcctatttatgctttatcaagctgatgttggtggcaag 282
Query: 91 cttggttgc-attgcgaaacaacagtttccgtatgttcagcaacgaggacgttacaatt- 148
| ||||||| || ||||||||| ||||| ||||||| ||| ||||| ||||| |||
Sbjct: 283 cctggttgctcctgagaaacaacattttcc-aatgttcaacaatgaggatgttactattg 341
Query: 149 ggatcgtggatgcttgctatgaacgtcaaccatgagaacacacatgc 195
|| || ||||||||||||||||||||||||| |||||||| |||||
Sbjct: 342 ggttctgggatgcttgctatgaacgtcaaccacgagaacacgcatgc 388
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 104,005
Number of Sequences: 636343
Number of extensions: 104005
Number of successful extensions: 27468
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27461
Number of HSP's gapped (non-prelim): 3
length of query: 667
length of database: 367,240,239
effective HSP length: 19
effective length of query: 648
effective length of database: 355,149,722
effective search space: 230137019856
effective search space used: 230137019856
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)