BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829406.2.1
(673 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD491335.1|CD491335 WHE3084_F04_K08ZT CS wheat cold-stre... 367 e-100
gb|BE444273.1|BE444273 WHE1117_C05_E09ZS Wheat etiolated se... 313 9e-084
gb|BE444592.1|BE444592 WHE1126_D05_G10ZS Wheat etiolated se... 313 9e-084
gb|BE444695.1|BE444695 WHE1137_F06_K11ZS Wheat etiolated se... 313 9e-084
gb|CA700586.1|CA700586 wkm1c.pk005.b6 wkm1c Triticum aestiv... 313 9e-084
gb|CA728569.1|CA728569 wdi1c.pk004.h7 wdi1c Triticum aestiv... 313 9e-084
gb|BF474602.1|BF474602 WHE2102_H08_O16ZS Wheat salt-stresse... 309 1e-082
gb|CD869776.1|CD869776 AZO2.112J08F001117 AZO2 Triticum aes... 307 5e-082
gb|BE471229.1|BE471229 WHE0285_B10_D19ZS Wheat drought-stre... 305 2e-081
gb|BU672278.1|BU672278 WHE3302_F08_K16ZS Chinese Spring whe... 305 2e-081
gb|CA734296.1|CA734296 wde2f.pk003.c23 wde2f Triticum aesti... 305 2e-081
gb|BE442922.1|BE442922 WHE1108_C01_F02ZS Wheat etiolated se... 293 8e-078
gb|BE445062.1|BE445062 WHE1131_D03_H05ZS Wheat etiolated se... 293 8e-078
gb|BQ743613.1|BQ743613 WHE4106_A11_A22ZS Wheat salt-stresse... 293 8e-078
gb|CA639674.1|CA639674 wre1n.pk0025.h3 wre1n Triticum aesti... 293 8e-078
gb|CA653444.1|CA653444 wre1n.pk193.g3 wre1n Triticum aestiv... 293 8e-078
gb|CK203042.1|CK203042 FGAS011568 Triticum aestivum FGAS: L... 289 1e-076
gb|BE444255.1|BE444255 WHE1117_A07_A13ZS Wheat etiolated se... 281 3e-074
gb|BE404046.1|BE404046 WHE0410_H05_H05ZS Wheat etiolated se... 280 1e-073
gb|BJ256450.1|BJ256450 BJ256450 Y. Ogihara unpublished cDNA... 278 5e-073
gb|BJ261973.1|BJ261973 BJ261973 Y. Ogihara unpublished cDNA... 278 5e-073
gb|CA653564.1|CA653564 wre1n.pk187.d7 wre1n Triticum aestiv... 266 2e-069
gb|CA602749.1|CA602749 wr1.pk0008.c4 wr1 Triticum aestivum ... 264 7e-069
gb|CA650959.1|CA650959 wre1n.pk166.f10 wre1n Triticum aesti... 260 1e-067
gb|CK202726.1|CK202726 FGAS011251 Triticum aestivum FGAS: L... 260 1e-067
gb|CA484999.1|CA484999 WHE4313_B11_C21ZS Wheat meiotic anth... 244 7e-063
gb|CA649216.1|CA649216 wre1n.pk0139.b12 wre1n Triticum aest... 244 7e-063
gb|CA644523.1|CA644523 wre1n.pk0089.d10 wre1n Triticum aest... 240 1e-061
gb|CA607593.1|CA607593 wr1.pk0079.h7 wr1 Triticum aestivum ... 230 1e-058
gb|CK202769.1|CK202769 FGAS011294 Triticum aestivum FGAS: L... 228 4e-058
gb|CK203088.1|CK203088 FGAS011614 Triticum aestivum FGAS: L... 228 4e-058
gb|CA639576.1|CA639576 wre1n.pk0024.d1 wre1n Triticum aesti... 226 2e-057
gb|CA647078.1|CA647078 wre1n.pk0117.b4 wre1n Triticum aesti... 224 6e-057
gb|CA639141.1|CA639141 wre1n.pk0023.e3 wre1n Triticum aesti... 214 6e-054
gb|CA613027.1|CA613027 wr1.pk0153.h12 wr1 Triticum aestivum... 212 2e-053
gb|CA637982.1|CA637982 wre1n.pk0005.h5 wre1n Triticum aesti... 206 1e-051
gb|BE490716.1|BE490716 WHE0369_C10_F19ZS Wheat cold-stresse... 204 6e-051
gb|BE352629.1|BE352629 WHE0425_H06_O11ZS Wheat etiolated se... 200 9e-050
gb|BE405425.1|BE405425 WHE1216_C02_F04ZS Wheat etiolated se... 200 9e-050
gb|BE405703.1|BE405703 WHE1214_D02_G04ZS Wheat etiolated se... 200 9e-050
gb|BE405768.1|BE405768 WHE0437_H01_O01ZS Wheat etiolated se... 200 9e-050
gb|BE405798.1|BE405798 WHE0437_E05_I09ZS Wheat etiolated se... 200 9e-050
gb|BE419059.1|BE419059 WWR018.E4R000101 ITEC WWR Wheat Root... 200 9e-050
gb|BE445091.1|BE445091 WHE1131_A05_B09ZS Wheat etiolated se... 200 9e-050
gb|BE446399.1|BE446399 WHE1457_H01_P01ZS Wheat etiolated se... 200 9e-050
gb|BJ277641.1|BJ277641 BJ277641 Y. Ogihara unpublished cDNA... 200 9e-050
gb|BJ279738.1|BJ279738 BJ279738 Y. Ogihara unpublished cDNA... 200 9e-050
gb|BJ282831.1|BJ282831 BJ282831 Y. Ogihara unpublished cDNA... 200 9e-050
gb|BJ284722.1|BJ284722 BJ284722 Y. Ogihara unpublished cDNA... 200 9e-050
gb|BQ744042.1|BQ744042 WHE4111_B02_D03ZS Wheat salt-stresse... 200 9e-050
gb|BU100027.1|BU100027 WHE3314_C07_E14ZS Chinese Spring whe... 200 9e-050
gb|CA605300.1|CA605300 wr1.pk0051.f10 wr1 Triticum aestivum... 200 9e-050
gb|CA638263.1|CA638263 wre1n.pk0008.g7 wre1n Triticum aesti... 200 9e-050
gb|CD862774.1|CD862774 AZO1.104J07F010129 AZO1 Triticum aes... 200 9e-050
gb|CD864514.1|CD864514 AZO2.001C21F000630 AZO2 Triticum aes... 200 9e-050
gb|CD864515.1|CD864515 AZO2.001C21R000629 AZO2 Triticum aes... 200 9e-050
gb|CD864516.1|CD864516 AZO2.001C22F000627 AZO2 Triticum aes... 200 9e-050
gb|CD865013.1|CD865013 AZO2.073B13F000912 AZO2 Triticum aes... 200 9e-050
gb|CD865014.1|CD865014 AZO2.073B13R000920 AZO2 Triticum aes... 200 9e-050
gb|CD865661.1|CD865661 AZO2.101H01F001128 AZO2 Triticum aes... 200 9e-050
gb|CD870478.1|CD870478 AZO2.114I21F001116 AZO2 Triticum aes... 200 9e-050
gb|CD870556.1|CD870556 AZO2.114M19F001116 AZO2 Triticum aes... 200 9e-050
gb|CD870766.1|CD870766 AZO2.115H13F010115 AZO2 Triticum aes... 200 9e-050
gb|CD871172.1|CD871172 AZO2.117J17F010207 AZO2 Triticum aes... 200 9e-050
gb|CD872591.1|CD872591 AZO2.120P15F010209 AZO2 Triticum aes... 200 9e-050
gb|CD872942.1|CD872942 AZO2.122A01F010208 AZO2 Triticum aes... 200 9e-050
gb|CK201192.1|CK201192 FGAS009711 Triticum aestivum FGAS: L... 200 9e-050
gb|CK209144.1|CK209144 FGAS020888 Triticum aestivum FGAS: L... 200 9e-050
gb|CV772756.1|CV772756 FGAS067151 Triticum aestivum FGAS: L... 200 9e-050
gb|CV778923.1|CV778923 FGAS073332 Triticum aestivum FGAS: L... 200 9e-050
gb|CV779579.1|CV779579 FGAS073988 Triticum aestivum FGAS: L... 200 9e-050
gb|DN829222.1|DN829222 KUCD01_08_F12_T3 WSWR cDNA library T... 200 9e-050
gb|DN829341.1|DN829341 KUCD01_08_E06_T3 WSWR cDNA library T... 200 9e-050
gb|BE405808.1|BE405808 WHE0437_D07_G13ZS Wheat etiolated se... 194 5e-048
gb|CA598232.1|CA598232 wyr1c.pk003.g12 wyr1c Triticum aesti... 194 5e-048
gb|BE403195.1|BE403195 WHE0426_E06_I12ZS Wheat etiolated se... 192 2e-047
gb|BE404020.1|BE404020 WHE0410_E03_E03ZS Wheat etiolated se... 192 2e-047
gb|BE406490.1|BE406490 WHE0416_d12_h24zB Wheat etiolated se... 192 2e-047
gb|BE499633.1|BE499633 WHE0962_C02_F04ZS Wheat pre-anthesis... 192 2e-047
gb|BG314282.1|BG314282 WHE2461_E06_J11ZS Triticum monococcu... 192 2e-047
gb|BG607685.1|BG607685 WHE2490_B01_D02ZS Triticum monococcu... 192 2e-047
gb|BQ169667.1|BQ169667 WHE0962_C02_F04ZT Wheat pre-anthesis... 192 2e-047
gb|BQ295128.1|BQ295128 WHE2858_E09_J18ZS Wheat unstressed r... 192 2e-047
gb|BQ483156.1|BQ483156 WHE3505_C07_E13ZS Wheat unstressed r... 192 2e-047
gb|BQ483614.1|BQ483614 WHE3510_F03_K06ZS Wheat unstressed r... 192 2e-047
gb|BQ743570.1|BQ743570 WHE4105_E11_I21ZS Wheat salt-stresse... 192 2e-047
gb|BQ838348.1|BQ838348 WHE2909_D10_G19ZS Wheat aluminum-str... 192 2e-047
gb|BQ839493.1|BQ839493 WHE4166_G06_N12ZS Wheat CS whole pla... 192 2e-047
gb|CA612902.1|CA612902 wr1.pk0160.b11 wr1 Triticum aestivum... 192 2e-047
gb|CA615479.1|CA615479 wr1.pk172.h9 wr1 Triticum aestivum c... 192 2e-047
gb|CA641584.1|CA641584 wre1n.pk0046.a9 wre1n Triticum aesti... 192 2e-047
gb|CA650277.1|CA650277 wre1n.pk0150.e5 wre1n Triticum aesti... 192 2e-047
gb|CA727892.1|CA727892 wdi1c.pk003.f5 wdi1c Triticum aestiv... 192 2e-047
gb|CD870654.1|CD870654 AZO2.115B15F010115 AZO2 Triticum aes... 192 2e-047
gb|CD871919.1|CD871919 AZO2.119G05F010207 AZO2 Triticum aes... 192 2e-047
gb|CD878815.1|CD878815 AZO4.103L01F010929 AZO4 Triticum aes... 192 2e-047
gb|CD879036.1|CD879036 AZO4.104D16F010929 AZO4 Triticum aes... 192 2e-047
gb|CD879037.1|CD879037 AZO4.104D16R011122 AZO4 Triticum aes... 192 2e-047
gb|CK162089.1|CK162089 FGAS014674 Triticum aestivum FGAS: L... 192 2e-047
gb|CK193823.1|CK193823 FGAS002240 Triticum aestivum FGAS: L... 192 2e-047
gb|CK194161.1|CK194161 FGAS002580 Triticum aestivum FGAS: L... 192 2e-047
gb|CA648422.1|CA648422 wre1n.pk0130.e8 wre1n Triticum aesti... 190 9e-047
gb|CK194498.1|CK194498 FGAS002929 Triticum aestivum FGAS: L... 186 1e-045
gb|CK194200.1|CK194200 FGAS002619 Triticum aestivum FGAS: L... 182 2e-044
gb|CA627531.1|CA627531 wdr1.pk0002.d8 wdr1 Triticum aestivu... 180 8e-044
gb|CA614889.1|CA614889 wr1.pk183.d12 wr1 Triticum aestivum ... 178 3e-043
gb|AJ612464.1|AJ612464 AJ612464 Triticum turgidum subsp. du... 178 3e-043
gb|CK203872.1|CK203872 FGAS012406 Triticum aestivum FGAS: L... 176 1e-042
gb|CD862775.1|CD862775 AZO1.104J07R010504 AZO1 Triticum aes... 167 1e-039
gb|CK194437.1|CK194437 FGAS002867 Triticum aestivum FGAS: L... 167 1e-039
gb|CD866259.1|CD866259 AZO2.102P08F001107 AZO2 Triticum aes... 165 5e-039
gb|CA607211.1|CA607211 wr1.pk0067.b1 wr1 Triticum aestivum ... 163 2e-038
gb|CK200854.1|CK200854 FGAS009371 Triticum aestivum FGAS: L... 163 2e-038
gb|AJ609760.1|AJ609760 AJ609760 Triticum turgidum subsp. du... 159 3e-037
gb|CD866279.1|CD866279 AZO2.102P23F001123 AZO2 Triticum aes... 157 1e-036
gb|BJ286850.1|BJ286850 BJ286850 Y. Ogihara unpublished cDNA... 151 7e-035
gb|BU100213.1|BU100213 WHE3316_E11_J22ZS Chinese Spring whe... 149 3e-034
gb|CA651553.1|CA651553 wre1n.pk182.c9 wre1n Triticum aestiv... 149 3e-034
gb|BE401114.1|BE401114 CNW01PL0016 ITEC CNW Wheat Powdery M... 145 5e-033
gb|BE445578.1|BE445578 WHE1451_E05_I09ZS Wheat etiolated se... 131 7e-029
gb|CA651091.1|CA651091 wre1n.pk186.f1 wre1n Triticum aestiv... 129 3e-028
gb|BJ281744.1|BJ281744 BJ281744 Y. Ogihara unpublished cDNA... 121 7e-026
gb|CA502668.1|CA502668 WHE4338_C06_E12ZS Wheat meiotic anth... 119 3e-025
gb|CA645592.1|CA645592 wre1n.pk0098.e6 wre1n Triticum aesti... 119 3e-025
gb|CD491461.1|CD491461 WHE3088_C06_E12ZT CS wheat cold-stre... 119 3e-025
gb|CV761667.1|CV761667 FGAS056055 Triticum aestivum FGAS: L... 113 2e-023
gb|BE500508.1|BE500508 WHE0987-0990_O20_O20ZS Wheat pre-ant... 109 2e-022
gb|CA594441.1|CA594441 wpa1c.pk007.f10 wpa1c Triticum aesti... 109 2e-022
gb|CA597654.1|CA597654 wpa1c.pk015.j12 wpa1c Triticum aesti... 109 2e-022
gb|CA643068.1|CA643068 wre1n.pk0070.f6 wre1n Triticum aesti... 109 2e-022
gb|CA641915.1|CA641915 wre1n.pk0049.b10 wre1n Triticum aest... 107 1e-021
gb|CA612566.1|CA612566 wr1.pk0130.g7 wr1 Triticum aestivum ... 105 4e-021
gb|CA648371.1|CA648371 wre1n.pk0134.h9 wre1n Triticum aesti... 101 6e-020
gb|CA644816.1|CA644816 wre1n.pk0093.a10 wre1n Triticum aest... 96 4e-018
gb|CA609756.1|CA609756 wr1.pk0110.f6 wr1 Triticum aestivum ... 94 1e-017
gb|CA645007.1|CA645007 wre1n.pk0086.g3 wre1n Triticum aesti... 86 4e-015
gb|CA620667.1|CA620667 wl1n.pk0058.e8 wl1n Triticum aestivu... 76 3e-012
gb|CA650919.1|CA650919 wre1n.pk160.e9 wre1n Triticum aestiv... 76 3e-012
gb|CA614436.1|CA614436 wr1.pk161.f3 wr1 Triticum aestivum c... 74 1e-011
gb|BQ579597.1|BQ579597 WHE2972_C10_E20ZS Wheat dormant embr... 72 5e-011
gb|CA732197.1|CA732197 wlp1c.pk003.c22 wlp1c Triticum aesti... 72 5e-011
gb|CA653177.1|CA653177 wre1n.pk169.d3 wre1n Triticum aestiv... 68 8e-010
gb|AJ716745.1|AJ716745 AJ716745 Triticum turgidum subsp. du... 68 8e-010
gb|CA602496.1|CA602496 wr1.pk0016.g11 wr1 Triticum aestivum... 66 3e-009
gb|CD869057.1|CD869057 AZO2.110J05F010115 AZO2 Triticum aes... 66 3e-009
gb|CK159571.1|CK159571 FGAS041034 Triticum aestivum FGAS: T... 66 3e-009
gb|CA486018.1|CA486018 WHE4326_A04_A08ZS Wheat meiotic anth... 64 1e-008
gb|CA723714.1|CA723714 wdr1f.pk002.b18 wdr1f Triticum aesti... 64 1e-008
gb|CV777826.1|CV777826 FGAS072233 Triticum aestivum FGAS: L... 64 1e-008
gb|DR737242.1|DR737242 FGAS082538 Triticum aestivum FGAS: L... 64 1e-008
gb|CA484729.1|CA484729 WHE4310_A10_A20ZS Wheat meiotic anth... 62 5e-008
gb|CA723205.1|CA723205 wdr1f.pk002.i19 wdr1f Triticum aesti... 62 5e-008
gb|BE406912.1|BE406912 WHE0433_f10_k19zS Wheat etiolated se... 58 8e-007
gb|CA485083.1|CA485083 WHE4314_C07_E14ZS Wheat meiotic anth... 58 8e-007
gb|CK160130.1|CK160130 FGAS041678 Triticum aestivum FGAS: T... 58 8e-007
gb|BF202085.1|BF202085 WHE1773_E07_I13ZS Wheat pre-anthesis... 50 2e-004
gb|BQ162569.1|BQ162569 WHE0433_f10_k19zT Wheat etiolated se... 50 2e-004
gb|CA648575.1|CA648575 wre1n.pk0135.h10 wre1n Triticum aest... 48 8e-004
gb|CA597910.1|CA597910 wyr1c.pk001.k4 wyr1c Triticum aestiv... 46 0.003
gb|CA646201.1|CA646201 wre1n.pk0102.d3 wre1n Triticum aesti... 40 0.19
>gb|CD491335.1|CD491335 WHE3084_F04_K08ZT CS wheat cold-stressed seedling subtracted cDNA
library Triticum aestivum cDNA clone WHE3084_F04_K08,
mRNA sequence
Length = 687
Score = 367 bits (185), Expect = e-100
Identities = 260/285 (91%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcat 333
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|| ||||||| ||||||||| ||||| | ||||||||||| ||||||| || ||||||
Sbjct: 334 cgtttggggacggtgatggcgacctcagccttgatcccggcgctcttggcagtgttggac 393
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||
Sbjct: 394 agcatgacggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgccgcag 453
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
||| | | |||||||| |||||||||| || |||||| |||||||||||||||||||||
Sbjct: 454 caggagctagacggcgcggagctggggtcctccgccgccgacgcgcacggcgccagcttc 513
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 514 agcgccatcatgtccggcggcgtcgccccgcactcgcccgcgccg 558
>gb|BE444273.1|BE444273 WHE1117_C05_E09ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1117_C05_E09,
mRNA sequence
Length = 530
Score = 313 bits (158), Expect = 9e-084
Identities = 248/278 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 424 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 365
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 364 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 305
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 304 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 245
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 244 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 185
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 184 agcgccatcttgtccgccggcgtcttcccgcactcgcc 147
>gb|BE444592.1|BE444592 WHE1126_D05_G10ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1126_D05_G10,
mRNA sequence
Length = 482
Score = 313 bits (158), Expect = 9e-084
Identities = 248/278 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 418 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 359
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 358 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 299
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 298 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 239
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 238 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 179
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 178 agcgccatcttgtccgccggcgtcttcccgcactcgcc 141
>gb|BE444695.1|BE444695 WHE1137_F06_K11ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1137_F06_K11,
mRNA sequence
Length = 551
Score = 313 bits (158), Expect = 9e-084
Identities = 248/278 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 429 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 370
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 369 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 310
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 309 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 250
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 249 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 190
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 189 agcgccatcttgtccgccggcgtcttcccgcactcgcc 152
>gb|CA700586.1|CA700586 wkm1c.pk005.b6 wkm1c Triticum aestivum cDNA clone wkm1c.pk005.b6 5'
end, mRNA sequence
Length = 531
Score = 313 bits (158), Expect = 9e-084
Identities = 248/278 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 429 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 370
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 369 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 310
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 309 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 250
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 249 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 190
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 189 agcgccatcttgtccgccggcgtcttcccgcactcgcc 152
>gb|CA728569.1|CA728569 wdi1c.pk004.h7 wdi1c Triticum aestivum cDNA clone wdi1c.pk004.h7 5'
end, mRNA sequence
Length = 591
Score = 313 bits (158), Expect = 9e-084
Identities = 248/278 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 439 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 380
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 379 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 320
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 319 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 260
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 259 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 200
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 199 agcgccatcttgtccgccggcgtcttcccgcactcgcc 162
>gb|BF474602.1|BF474602 WHE2102_H08_O16ZS Wheat salt-stressed crown cDNA library Triticum
aestivum cDNA clone WHE2102_H08_O16, mRNA sequence
Length = 576
Score = 309 bits (156), Expect = 1e-082
Identities = 243/272 (89%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 417 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 358
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| ||||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 357 gggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggagagcatg 298
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||||| || ||||||||||| |||
Sbjct: 297 acggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcagcacccg 238
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
||||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||
Sbjct: 237 ctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttcagcgcc 178
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| |||||| ||||||| ||||||||||||
Sbjct: 177 atcttgtccgccggcgtcttcccgcactcgcc 146
>gb|CD869776.1|CD869776 AZO2.112J08F001117 AZO2 Triticum aestivum cDNA clone AZO2112J08,
mRNA sequence
Length = 531
Score = 307 bits (155), Expect = 5e-082
Identities = 247/278 (88%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 218 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 277
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 278 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 337
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 338 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 397
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||||| |||||||||
Sbjct: 398 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggngccagcttc 457
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 458 agcgccatcttgtccgccggcgtcttcccgcactcgcc 495
>gb|BE471229.1|BE471229 WHE0285_B10_D19ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0285_B10_D19, mRNA
sequence
Length = 543
Score = 305 bits (154), Expect = 2e-081
Identities = 247/278 (88%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 386 gctcagggcagagtgtaagctccgcacttgtagccgaccgggcggtcgacgaggttgcag 327
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 326 cgcttggggatggacatggcggcctccggcttgatgccggcgctcttggcggtgtcggag 267
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 266 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 207
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||||||||||||||
Sbjct: 206 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttg 147
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 146 agcgccatcttgtccgccggcgtcttcccgcactcgcc 109
>gb|BU672278.1|BU672278 WHE3302_F08_K16ZS Chinese Spring wheat drought stressed root cDNA
library Triticum aestivum cDNA clone WHE3302_F08_K16,
mRNA sequence
Length = 534
Score = 305 bits (154), Expect = 2e-081
Identities = 247/278 (88%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 237 gctcagggcagagtgtaagctccgcacttgtagccgaccgggcggtcgacgaggttgcag 296
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 297 cgcttggggatggacatggcggcctccggcttgatgccggcgctcttggcggtgtcggag 356
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 357 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 416
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||||||||||||||
Sbjct: 417 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttg 476
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 477 agcgccatcttgtccgccggcgtcttcccgcactcgcc 514
>gb|CA734296.1|CA734296 wde2f.pk003.c23 wde2f Triticum aestivum cDNA clone wde2f.pk003.c23
5' end, mRNA sequence
Length = 549
Score = 305 bits (154), Expect = 2e-081
Identities = 247/278 (88%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 159 gctcagggcagagtgtaagctccgcacttgtagccgaccgggcggtcgacgaggttgcag 218
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 219 cgcttggggatggacatggcggcctccggcttgatgccggcgctcttggcggtgtcggag 278
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 279 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 338
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||||||||||||||
Sbjct: 339 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttg 398
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 399 agcgccatcttgtccgccggcgtcttcccgcactcgcc 436
>gb|BE442922.1|BE442922 WHE1108_C01_F02ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1108_C01_F02,
mRNA sequence
Length = 496
Score = 293 bits (148), Expect = 8e-078
Identities = 241/272 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 382 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 323
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 322 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 263
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 262 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 203
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
| |||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||
Sbjct: 202 cttgacggcgccgagttggggtcctgccccgccgacgcgcacggcgccagcttcagcgcc 143
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| ||||| ||||||| ||||||||||||
Sbjct: 142 atctcgtccgccggcgtcctcccgcactcgcc 111
>gb|BE445062.1|BE445062 WHE1131_D03_H05ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1131_D03_H05,
mRNA sequence
Length = 531
Score = 293 bits (148), Expect = 8e-078
Identities = 241/272 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 399 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 340
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 339 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 280
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 279 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 220
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
| |||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||
Sbjct: 219 cttgacggcgccgagttggggtcctgccccgccgacgcgcacggcgccagcttcagcgcc 160
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| ||||| ||||||| ||||||||||||
Sbjct: 159 atctcgtccgccggcgtcctcccgcactcgcc 128
>gb|BQ743613.1|BQ743613 WHE4106_A11_A22ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4106_A11_A22, mRNA sequence
Length = 521
Score = 293 bits (148), Expect = 8e-078
Identities = 241/272 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 420 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 361
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 360 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 301
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 300 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 241
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
| |||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||
Sbjct: 240 cttgacggcgccgagttggggtcctgccccgccgacgcgcacggcgccagcttcagcgcc 181
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| ||||| ||||||| ||||||||||||
Sbjct: 180 atctcgtccgccggcgtcctcccgcactcgcc 149
>gb|CA639674.1|CA639674 wre1n.pk0025.h3 wre1n Triticum aestivum cDNA clone wre1n.pk0025.h3
5' end, mRNA sequence
Length = 589
Score = 293 bits (148), Expect = 8e-078
Identities = 241/272 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 404 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 345
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 344 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 285
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 284 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 225
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
| |||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||
Sbjct: 224 cttgacggcgccgagttggggtcctgccccgccgacgcgcacggcgccagcttcagcgcc 165
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| ||||| ||||||| ||||||||||||
Sbjct: 164 atctcgtccgccggcgtcctcccgcactcgcc 133
>gb|CA653444.1|CA653444 wre1n.pk193.g3 wre1n Triticum aestivum cDNA clone wre1n.pk193.g3 5'
end, mRNA sequence
Length = 501
Score = 293 bits (148), Expect = 8e-078
Identities = 235/264 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 265 gctcagggcagagtgtaagctccgcacttgtagccgaccgggcggtcgacgaggttgcag 206
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 205 cgcttggggatggacatggcggcctccggcttgatgccggcgctcttggcggtgtcggag 146
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 145 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 86
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||||||||||||||
Sbjct: 85 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttg 26
Query: 536 agcgccatcctgtccggcggcgtc 559
||||||||| |||||| |||||||
Sbjct: 25 agcgccatcttgtccgccggcgtc 2
>gb|CK203042.1|CK203042 FGAS011568 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 884
Score = 289 bits (146), Expect = 1e-076
Identities = 245/278 (88%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| |||||||| |||||||||| |||||||||||||||||||||
Sbjct: 569 gctcacggcagagtgtaagctccgcacctgtagccgacagggcggtcgacgaggttgcag 510
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||| ||||||||| ||||| ||||| |||||||| || | ||||||| || | |||
Sbjct: 509 cgcctggggatggacatggcgacctccggcttgatgcccgcgctcttggcggtgtcggag 450
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 449 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 390
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 389 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 330
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 329 agcgccatcttgtccgccggcgtcttcccgcactcgcc 292
>gb|BE444255.1|BE444255 WHE1117_A07_A13ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1117_A07_A13,
mRNA sequence
Length = 433
Score = 281 bits (142), Expect = 3e-074
Identities = 244/278 (87%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 387 gctcacggcagagtgtaagctccgcacttgtatccgaccgggcggtcgacgaggttgcag 328
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 327 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 268
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 267 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtggacggccgtgcag 208
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| |||||||| |||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 207 cacccgctggacggcaccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 148
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||| ||| ||| ||||||||
Sbjct: 147 agcgccatcttgtccgccggtgtcttcccacactcgcc 110
>gb|BE404046.1|BE404046 WHE0410_H05_H05ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0410_H05_H05, mRNA
sequence
Length = 364
Score = 280 bits (141), Expect = 1e-073
Identities = 239/272 (87%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 355 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 296
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 295 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 236
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 235 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 176
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
| |||||||| ||| |||| | |||| |||| |||||||||||||||||||||||||||
Sbjct: 175 cttgacggcgcngagttgggctcctgccccgccgacgcgcacggcgccagcttcagcgcc 116
Query: 542 atcctgtccggcggcgtcgccccgcactcgcc 573
||| ||||| ||||||| ||||||||||||
Sbjct: 115 atctcgtccgccggcgtcctcccgcactcgcc 84
>gb|BJ256450.1|BJ256450 BJ256450 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh16i16 5', mRNA sequence
Length = 500
Score = 278 bits (140), Expect = 5e-073
Identities = 227/256 (88%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 266 gctcacggcagagtgtaagctccgcacttgtatccgaccgggcggtcgacgaggttgcag 207
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 206 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 147
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 146 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtggacggccgtgcag 87
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| |||||||| |||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 86 cacccgctggacggcaccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 27
Query: 536 agcgccatcctgtccg 551
||||||||| ||||||
Sbjct: 26 agcgccatcttgtccg 11
>gb|BJ261973.1|BJ261973 BJ261973 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh16i16 3', mRNA sequence
Length = 468
Score = 278 bits (140), Expect = 5e-073
Identities = 227/256 (88%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 203 gctcacggcagagtgtaagctccgcacttgtatccgaccgggcggtcgacgaggttgcag 262
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 263 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 322
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 323 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtggacggccgtgcag 382
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| |||||||| |||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 383 cacccgctggacggcaccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 442
Query: 536 agcgccatcctgtccg 551
||||||||| ||||||
Sbjct: 443 agcgccatcttgtccg 458
>gb|CA653564.1|CA653564 wre1n.pk187.d7 wre1n Triticum aestivum cDNA clone wre1n.pk187.d7 5'
end, mRNA sequence
Length = 548
Score = 266 bits (134), Expect = 2e-069
Identities = 233/264 (88%), Gaps = 2/264 (0%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 216 gctcacggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcag 275
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 276 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 335
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 336 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacagccgtgcag 395
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||||||||| | |||||||||
Sbjct: 396 caaccgctggacggcgccgacttggggtcctgccccgccgacgcgcac-gngccagcttc 454
Query: 536 agcgccatcctgtccggcggcgtc 559
| |||||| ||||||| |||||||
Sbjct: 455 ancgccat-ctgtccgccggcgtc 477
>gb|CA602749.1|CA602749 wr1.pk0008.c4 wr1 Triticum aestivum cDNA clone wr1.pk0008.c4 5'
end, mRNA sequence
Length = 483
Score = 264 bits (133), Expect = 7e-069
Identities = 233/264 (88%), Gaps = 2/264 (0%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||
Sbjct: 264 gctcagggcagagtgtaan-tccgcacttgtagccgaccgggcggtcgacgaggttgcag 206
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 205 cgcttggggatggacatggcgccctccggcttgatgccggcgctcttggcggtgtcggag 146
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 145 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 86
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| ||| ||||||||||||||||
Sbjct: 85 cacccgctggacggcgccgacttggggtcctgccccgccgac-cgcacggcgccagcttg 27
Query: 536 agcgccatcctgtccggcggcgtc 559
||||||||| |||||| |||||||
Sbjct: 26 agcgccatcttgtccgccggcgtc 3
>gb|CA650959.1|CA650959 wre1n.pk166.f10 wre1n Triticum aestivum cDNA clone wre1n.pk166.f10
5' end, mRNA sequence
Length = 488
Score = 260 bits (131), Expect = 1e-067
Identities = 221/251 (88%)
Strand = Plus / Minus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 265 ttgtagccgacagggcggtcgacgaggttgcagcgcttggggatggatatggcggcctcc 206
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
|||||||| |||| ||||||| || | ||| |||||||||||||||||||||| ||||
Sbjct: 205 ggcttgatgccggcgctcttggcggtgtcggagagcatgacggcgcagaggcacttgggg 146
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
|||||||| ||||||||| ||||||| |||||||| ||| | |||||||||||| |||||
Sbjct: 145 ctctgcttgccgatggtgcgcaccgctgtgcagcacccgcttgacggcgccgagttgggg 86
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
| |||| |||| |||||||||||||||||||||||||||||| ||||| ||||||| |
Sbjct: 85 tcctgccccgccgacgcgcacggcgccagcttcagcgccatctcgtccgccggcgtcctc 26
Query: 563 ccgcactcgcc 573
|||||||||||
Sbjct: 25 ccgcactcgcc 15
>gb|CK202726.1|CK202726 FGAS011251 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 863
Score = 260 bits (131), Expect = 1e-067
Identities = 242/278 (87%), Gaps = 1/278 (0%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| |||| |||||||||||||| |||||||||||||||||||||
Sbjct: 567 gctcacggcagagtgtaa-ctccccacttgtagccgacagggcggtcgacgaggttgcag 509
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||| ||||||| ||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 508 cgcttagggatggacatgcgaccctccggcttgatgccggcgctcttggcggtgtcggag 449
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || ||||||||
Sbjct: 448 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgtacanccgtgcag 389
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| ||||||||||||| |||||| |||| |||| |||||||||||||||||||||
Sbjct: 388 cacccgctggacggcgccgacttggggtcctgccccgccgacgcgcacggcgccagcttc 329
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||| |||||| ||||||| ||||||||||||
Sbjct: 328 agcgccatcttgtccgccggcgtcttcccgcactcgcc 291
>gb|CA484999.1|CA484999 WHE4313_B11_C21ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4313_B11_C21, mRNA sequence
Length = 430
Score = 244 bits (123), Expect = 7e-063
Identities = 197/218 (90%), Gaps = 4/218 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 216 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 157
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 156 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 99
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 98 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 39
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcat 420
| ||||||||||| ||||||| ||||||||||||||
Sbjct: 38 gccttgatcccggcgctcttggcggtcttggacagcat 1
Score = 77.8 bits (39), Expect = 9e-013
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaac 85
|||||||| ||||||||||||| |||||||||||||||||||||||||||
Sbjct: 386 gtccaagacaacaagttttatttggaggatgcaggacagcatctctggaac 336
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 284 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 238
>gb|CA649216.1|CA649216 wre1n.pk0139.b12 wre1n Triticum aestivum cDNA clone
wre1n.pk0139.b12 5' end, mRNA sequence
Length = 357
Score = 244 bits (123), Expect = 7e-063
Identities = 201/227 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 227 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 168
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 167 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 108
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 107 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 48
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgc 528
| |||||||||||| |||||| |||| |||| ||||||||||||||
Sbjct: 47 cttgacggcgccgagttggggtcctgccccgccgacgcgcacggcgc 1
>gb|CA644523.1|CA644523 wre1n.pk0089.d10 wre1n Triticum aestivum cDNA clone
wre1n.pk0089.d10 5' end, mRNA sequence
Length = 669
Score = 240 bits (121), Expect = 1e-061
Identities = 244/281 (86%), Gaps = 3/281 (1%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgc-acttgtagccgacg-gggcggtcgacgaggttgc 353
||||| |||||||||||| |||||| ||||||| ||||| |||||||||||||||||||
Sbjct: 428 gctcacggcagagtgtaagctccgccacttgtatccgacccgggcggtcgacgaggttgc 369
Query: 354 agcgcttggggatggtgatggccacctcgggcttgatcccggacttctt-ggccgtcttg 412
||||||||||||||| ||||| ||||| |||||||| |||| |||| ||| || | |
Sbjct: 368 agcgcttggggatggacatggcgacctccggcttgatgccggcgctctttggcggtgtcg 309
Query: 413 gacagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtg 472
|| |||||||||||||||||||||| |||||||||||| ||||||||||| || ||||||
Sbjct: 308 gagagcatgacggcgcagaggcacttggggctctgcttgccgatggtgtggacggccgtg 249
Query: 473 cagcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagc 532
||||| ||| |||||||| |||| |||||| |||| |||| ||||||||||||||||||
Sbjct: 248 cagcacccgctggacggcaccgacttggggtcctgccccgccgacgcgcacggcgccagc 189
Query: 533 ttcagcgccatcctgtccggcggcgtcgccccgcactcgcc 573
|||||||||||| |||||| ||| ||| ||| ||||||||
Sbjct: 188 ttcagcgccatcttgtccgccggtgtcttcccacactcgcc 148
>gb|CA607593.1|CA607593 wr1.pk0079.h7 wr1 Triticum aestivum cDNA clone wr1.pk0079.h7 5'
end, mRNA sequence
Length = 503
Score = 230 bits (116), Expect = 1e-058
Identities = 179/200 (89%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 205 gctcagggcagagtgtaagctccgcacttgtagccgaccgggcggtcgacgaggttgcag 146
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| |||| |||||||| |||| ||||||| || | |||
Sbjct: 145 cgcttggggatggacatggcggcctccggcttgatgccggcgctcttggcggtgtcggag 86
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||
Sbjct: 85 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtgcaccgccgcgcag 26
Query: 476 cagccgttggacggcgccga 495
|| ||| |||||||||||||
Sbjct: 25 cacccgctggacggcgccga 6
>gb|CK202769.1|CK202769 FGAS011294 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 827
Score = 228 bits (115), Expect = 4e-058
Identities = 225/259 (86%), Gaps = 2/259 (0%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||| ||||| ||||||| ||||||||| |||||||||||||||| ||||
Sbjct: 547 ctccgcacttgtaaccgacagggcggttgacgaggtt-cagcgcttggggatggacatgg 489
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| |||||||| |||| ||||||| || | ||| |||||||||||||||||||
Sbjct: 488 cgacctccggcttgatgccggcgctcttggcggtgtcggagagcatgacggcgcagaggc 429
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| |||||||||||| ||||||||||| || |||||||||| ||| | ||||| ||||
Sbjct: 428 acttggggctctgcttgccgatggtgtgtacaaccgtgcagcacccgct-gacggggccg 370
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| |||| |||| |||||||||||||||||||||||||||||| |||||| ||
Sbjct: 369 acttggggtcctgccccgccgacgcgcacggcgccagcttcagcgccatcttgtccgccg 310
Query: 555 gcgtcgccccgcactcgcc 573
||||| ||||||||||||
Sbjct: 309 gcgtcttcccgcactcgcc 291
>gb|CK203088.1|CK203088 FGAS011614 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 837
Score = 228 bits (115), Expect = 4e-058
Identities = 223/259 (86%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
|||| |||||||||||||| ||||||| ||||||||| |||||||||||| || ||||
Sbjct: 550 ctccccacttgtagccgacagggcggttgacgaggtttcagcgcttgggggaggacatgg 491
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| |||||||| || | ||||||| || | ||| |||||||||||||||||||
Sbjct: 490 cgacctccggcttgatacccgcgctcttggcggtgtcggagagcatgacggcgcagaggc 431
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||| |||||||||||| || |||||||||| ||| ||||||||||||
Sbjct: 430 acttggggctctgctgcccgatggtgtgtacaaccgtgcagcacccgctggacggcgccg 371
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| |||| || | |||||||||||||||||||||||||||||| |||||| ||
Sbjct: 370 acttggggtcctgcccccccgacgcgcacggcgccagcttcagcgccatcttgtccgccg 311
Query: 555 gcgtcgccccgcactcgcc 573
||||| ||||||||||||
Sbjct: 310 gcgtcttcccgcactcgcc 292
>gb|CA639576.1|CA639576 wre1n.pk0024.d1 wre1n Triticum aestivum cDNA clone wre1n.pk0024.d1
5' end, mRNA sequence
Length = 557
Score = 226 bits (114), Expect = 2e-057
Identities = 230/266 (86%), Gaps = 4/266 (1%)
Strand = Plus / Minus
Query: 308 gtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatg 367
|||||| ||||||||||||| ||||| || ||||||||||||||||||||||||||||
Sbjct: 406 gtgtaagctccgcacttgtanccgacaggc--gtcgacgaggttgcagcgcttggggatg 349
Query: 368 gtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcg 427
| ||||| | || |||||||| |||| | ||||||| || | ||| ||||||||||||
Sbjct: 348 gatatggcggc-tccggcttgatgccgg-cgtcttggcggtgtcggagagcatgacggcg 291
Query: 428 cagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggac 487
|||||||||| |||||||||||| ||||||||| ||||||| |||||||| ||| | |||
Sbjct: 290 cagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccgcttgac 231
Query: 488 ggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctg 547
||||||||| |||||| ||| |||| |||||||||||||||||||||||||||||| |
Sbjct: 230 ggcgccgagttggggtcntgccccgcngacgcgcacggcgccagcttcagcgccatctcg 171
Query: 548 tccggcggcgtcgccccgcactcgcc 573
|||| ||||||| ||||||||||||
Sbjct: 170 tccgccggcgtcctcccgcactcgcc 145
>gb|CA647078.1|CA647078 wre1n.pk0117.b4 wre1n Triticum aestivum cDNA clone wre1n.pk0117.b4
5' end, mRNA sequence
Length = 447
Score = 224 bits (113), Expect = 6e-057
Identities = 191/217 (88%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 217 ggcagagtgtaagctccgcacttgtagccgacagggcggtcgacgaggttgcagcgcttg 158
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
||||||| ||||| |||| |||||||| |||| ||||||| || | ||| ||||||
Sbjct: 157 gggatggatatggcggcctccggcttgatgccggcgctcttggcggtgtcggagagcatg 98
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||| |||
Sbjct: 97 acggcgcagaggcacttggggctctgcttgccgatggtgcgcaccgctgtgcagcacccg 38
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacg 518
| |||||||||||| |||||| |||| |||| ||||
Sbjct: 37 cttgacggcgccgagttggggtcctgccccgccgacg 1
>gb|CA639141.1|CA639141 wre1n.pk0023.e3 wre1n Triticum aestivum cDNA clone wre1n.pk0023.e3
5' end, mRNA sequence
Length = 446
Score = 214 bits (108), Expect = 6e-054
Identities = 177/200 (88%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 201 gctcacggcagagtgtaagctccgcacttgtatccgaccgggcggtcgacgaggttgcag 142
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 141 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 82
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||| ||||||||||| || |||||||||
Sbjct: 81 agcatgacggcgcagaggcacttggggctctgcttgccgatggtgtggacggccgtgcag 22
Query: 476 cagccgttggacggcgccga 495
|| ||| |||||||| ||||
Sbjct: 21 cacccgctggacggcaccga 2
>gb|CA613027.1|CA613027 wr1.pk0153.h12 wr1 Triticum aestivum cDNA clone wr1.pk0153.h12 5'
end, mRNA sequence
Length = 366
Score = 212 bits (107), Expect = 2e-053
Identities = 206/238 (86%), Gaps = 1/238 (0%)
Strand = Plus / Minus
Query: 336 ggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatcccgg 395
|||||||||| ||||||||||||||||||| | ||||| |||| |||||||| ||||
Sbjct: 363 ggcggtcgacngagttgcagcgcttggggatgat-atggcggcctccggcttgatgccgg 305
Query: 396 acttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccga 455
||||||| || | ||| |||||||||||||||||||||| |||||||||||| ||||
Sbjct: 304 cgctcttggcggtgtcggagagcatgacggcgcagaggcacttggggctctgcttgccga 245
Query: 456 tggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcgg 515
||||| ||||||| |||||||| ||| | |||||||||||| |||||| |||| |||| |
Sbjct: 244 tggtgcgcaccgctgtgcagcacccgcttgacggcgccgagttggggtcctgccccgccg 185
Query: 516 acgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcc 573
||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||
Sbjct: 184 acgcgcacggcgccagcttcagcgccatctcgtccgccggcgtcctcccgcactcgcc 127
>gb|CA637982.1|CA637982 wre1n.pk0005.h5 wre1n Triticum aestivum cDNA clone wre1n.pk0005.h5
5' end, mRNA sequence
Length = 404
Score = 206 bits (104), Expect = 1e-051
Identities = 176/200 (88%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||| |||||||||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 212 gctcacggcagagtgtaagctccgcacttgtatccgaccgggcggtcgacgaggttgcag 153
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
||||||||||||| ||||| ||||| |||||||| |||| ||||||| || | |||
Sbjct: 152 cgcttggggatggacatggcgacctccggcttgatgccggcgctcttggcggtgtcggag 93
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| ||||||||||| ||||||||||| || |||||||||
Sbjct: 92 agcatgacggcgcagaggcactttgggctctgcttgccgatggtgtggacggccgtgcag 33
Query: 476 cagccgttggacggcgccga 495
|| ||| |||||||| ||||
Sbjct: 32 cacccgctggacggcaccga 13
>gb|BE490716.1|BE490716 WHE0369_C10_F19ZS Wheat cold-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0369_C10_F19, mRNA
sequence
Length = 354
Score = 204 bits (103), Expect = 6e-051
Identities = 178/203 (87%)
Strand = Plus / Minus
Query: 371 atggccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcag 430
||||| ||||| |||||||| |||| ||||||| || | ||| |||||||||||||||
Sbjct: 349 atggcgacctccggcttgatgccggcgctcttggcggtgtcggagagcatgacggcgcag 290
Query: 431 aggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggc 490
||||||| |||||||||||| ||||||||||| || ||||||||||| ||| ||||||||
Sbjct: 289 aggcacttggggctctgcttgccgatggtgtgtacagccgtgcagcacccgctggacggc 230
Query: 491 gccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtcc 550
||||| |||||| |||| |||| |||||||||||||||||||||||||||||| |||||
Sbjct: 229 gccgacttggggtcctgccccgccgacgcgcacggcgccagcttcagcgccatcttgtcc 170
Query: 551 ggcggcgtcgccccgcactcgcc 573
| ||||||| ||||||||||||
Sbjct: 169 gccggcgtcttcccgcactcgcc 147
>gb|BE352629.1|BE352629 WHE0425_H06_O11ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0425_H06_O11, mRNA
sequence
Length = 620
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 431 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 372
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 371 gggatggtgatggcgacctcgggcttgatcccggccatcttggcggtgccggacagcatg 312
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| ||| ||||||||||||||||||| |||||||| |
Sbjct: 311 acggcgcacaggcagctggggct---cttgccgatggtgtgcaccgccgagcagcagctg 255
Query: 482 ttggacggcgccgag 496
| ||||||||||||
Sbjct: 254 ctcgacggcgccgag 240
>gb|BE405425.1|BE405425 WHE1216_C02_F04ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1216_C02_F04, mRNA
sequence
Length = 564
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 399 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 340
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 339 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 280
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 279 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 223
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 222 ctggagggcgccgag 208
>gb|BE405703.1|BE405703 WHE1214_D02_G04ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1214_D02_G04, mRNA
sequence
Length = 561
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 351 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 292
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 291 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 232
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 231 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 175
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 174 ctggagggcgccgag 160
>gb|BE405768.1|BE405768 WHE0437_H01_O01ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0437_H01_O01, mRNA
sequence
Length = 556
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 325 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 266
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 265 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 206
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 205 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 149
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 148 ctggagggcgccgag 134
>gb|BE405798.1|BE405798 WHE0437_E05_I09ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0437_E05_I09, mRNA
sequence
Length = 533
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 371 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 312
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 311 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 252
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 251 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 195
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 194 ctggagggcgccgag 180
>gb|BE419059.1|BE419059 WWR018.E4R000101 ITEC WWR Wheat Root Library Triticum aestivum cDNA
clone WWR018.E4, mRNA sequence
Length = 567
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 428 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 369
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 368 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 309
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 308 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 252
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 251 ctggagggcgccgag 237
>gb|BE445091.1|BE445091 WHE1131_A05_B09ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1131_A05_B09,
mRNA sequence
Length = 609
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 427 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 368
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 367 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 308
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 307 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 251
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 250 ctggagggcgccgag 236
>gb|BE446399.1|BE446399 WHE1457_H01_P01ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1457_H01_P01,
mRNA sequence
Length = 587
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 356 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 297
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 296 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 237
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 236 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 180
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 179 ctggagggcgccgag 165
>gb|BJ277641.1|BJ277641 BJ277641 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr12g18 5', mRNA sequence
Length = 499
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 278 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 219
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 218 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 159
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 158 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 102
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 101 ctggagggcgccgag 87
>gb|BJ279738.1|BJ279738 BJ279738 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr4i06 5', mRNA sequence
Length = 485
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 264 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 205
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 204 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 145
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 144 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 88
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 87 ctggagggcgccgag 73
>gb|BJ282831.1|BJ282831 BJ282831 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr12g18 3', mRNA sequence
Length = 480
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Plus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 203 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 262
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 263 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 322
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 323 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 379
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 380 ctggagggcgccgag 394
>gb|BJ284722.1|BJ284722 BJ284722 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr4i06 3', mRNA sequence
Length = 375
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Plus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 183 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 242
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 243 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 302
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 303 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 359
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 360 ctggagggcgccgag 374
>gb|BQ744042.1|BQ744042 WHE4111_B02_D03ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4111_B02_D03, mRNA sequence
Length = 645
Score = 200 bits (101), Expect = 9e-050
Identities = 172/195 (88%), Gaps = 3/195 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 433 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 374
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||||||||||||||||||||||| | ||||||| || ||||||||||
Sbjct: 373 gggatggtgatggccacctcgggcttgatcccggccatcttggcggtgccggacagcatg 314
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| |||||| |||||| | |||||||||||||| |||||||| |
Sbjct: 313 acggcgcacaggcagctggggct---cttccctagggtgtgcaccgccgagcagcagctg 257
Query: 482 ttggacggcgccgag 496
|||| |||||||||
Sbjct: 256 ctggagggcgccgag 242
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 176,006
Number of Sequences: 636343
Number of extensions: 176006
Number of successful extensions: 49114
Number of sequences better than 0.5: 160
Number of HSP's better than 0.5 without gapping: 159
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 48760
Number of HSP's gapped (non-prelim): 258
length of query: 673
length of database: 367,240,239
effective HSP length: 19
effective length of query: 654
effective length of database: 355,149,722
effective search space: 232267918188
effective search space used: 232267918188
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)