BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3276111.2.1
(1393 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE500262.1|BE500262 WHE0981_G02_N03ZS Wheat pre-anthesis... 147 2e-033
gb|BJ247679.1|BJ247679 BJ247679 Y. Ogihara unpublished cDNA... 147 2e-033
gb|BJ253781.1|BJ253781 BJ253781 Y. Ogihara unpublished cDNA... 147 2e-033
gb|BQ170591.1|BQ170591 WHE1790_B01_D02ZT Wheat pre-anthesis... 147 2e-033
gb|BE499943.1|BE499943 WHE0976_D07_G14ZS Wheat pre-anthesis... 133 4e-029
gb|BJ244131.1|BJ244131 BJ244131 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ244160.1|BJ244160 BJ244160 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ245012.1|BJ245012 BJ245012 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ245034.1|BJ245034 BJ245034 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ245598.1|BJ245598 BJ245598 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ246003.1|BJ246003 BJ246003 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ246380.1|BJ246380 BJ246380 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ246786.1|BJ246786 BJ246786 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ247502.1|BJ247502 BJ247502 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ248904.1|BJ248904 BJ248904 Y. Ogihara unpublished cDNA... 133 4e-029
gb|BJ259210.1|BJ259210 BJ259210 Y. Ogihara unpublished cDNA... 133 4e-029
gb|CA741601.1|CA741601 wia1c.pk003.c13 wia1c Triticum aesti... 133 4e-029
gb|CA741657.1|CA741657 wia1c.pk003.h1 wia1c Triticum aestiv... 133 4e-029
gb|CA741952.1|CA741952 wia1c.pk002.k17 wia1c Triticum aesti... 133 4e-029
gb|BJ243655.1|BJ243655 BJ243655 Y. Ogihara unpublished cDNA... 127 2e-027
gb|BJ243399.1|BJ243399 BJ243399 Y. Ogihara unpublished cDNA... 125 9e-027
gb|BJ246735.1|BJ246735 BJ246735 Y. Ogihara unpublished cDNA... 125 9e-027
gb|BF202087.1|BF202087 WHE1773_E09_I17ZS Wheat pre-anthesis... 123 3e-026
gb|BF482332.1|BF482332 WHE1797_E02_J03ZS Wheat pre-anthesis... 123 3e-026
gb|BF484522.1|BF484522 WHE2324_E11_J22ZS Wheat pre-anthesis... 123 3e-026
gb|BJ243317.1|BJ243317 BJ243317 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ244360.1|BJ244360 BJ244360 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ245091.1|BJ245091 BJ245091 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ245340.1|BJ245340 BJ245340 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ245470.1|BJ245470 BJ245470 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ246379.1|BJ246379 BJ246379 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ247984.1|BJ247984 BJ247984 Y. Ogihara unpublished cDNA... 123 3e-026
gb|BJ248235.1|BJ248235 BJ248235 Y. Ogihara unpublished cDNA... 123 3e-026
gb|CA595421.1|CA595421 wpa1c.pk009.j22 wpa1c Triticum aesti... 123 3e-026
gb|CA741772.1|CA741772 wia1c.pk003.d15 wia1c Triticum aesti... 123 3e-026
gb|BE498906.1|BE498906 WHE0968_D12_G24ZS Wheat pre-anthesis... 121 1e-025
gb|BJ256554.1|BJ256554 BJ256554 Y. Ogihara unpublished cDNA... 117 2e-024
gb|BG263824.1|BG263824 WHE2338_D11_G22ZS Wheat pre-anthesis... 115 8e-024
gb|BJ247525.1|BJ247525 BJ247525 Y. Ogihara unpublished cDNA... 115 8e-024
gb|BJ253603.1|BJ253603 BJ253603 Y. Ogihara unpublished cDNA... 115 8e-024
gb|BJ253868.1|BJ253868 BJ253868 Y. Ogihara unpublished cDNA... 115 8e-024
gb|BJ247724.1|BJ247724 BJ247724 Y. Ogihara unpublished cDNA... 111 1e-022
gb|BJ243947.1|BJ243947 BJ243947 Y. Ogihara unpublished cDNA... 107 2e-021
gb|BJ245696.1|BJ245696 BJ245696 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ247784.1|BJ247784 BJ247784 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ249710.1|BJ249710 BJ249710 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ249922.1|BJ249922 BJ249922 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ249953.1|BJ249953 BJ249953 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ250880.1|BJ250880 BJ250880 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ250904.1|BJ250904 BJ250904 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ251487.1|BJ251487 BJ251487 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ251584.1|BJ251584 BJ251584 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ251917.1|BJ251917 BJ251917 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ252309.1|BJ252309 BJ252309 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ252746.1|BJ252746 BJ252746 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ253493.1|BJ253493 BJ253493 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ253541.1|BJ253541 BJ253541 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ253576.1|BJ253576 BJ253576 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ255156.1|BJ255156 BJ255156 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ263492.1|BJ263492 BJ263492 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ264640.1|BJ264640 BJ264640 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ265376.1|BJ265376 BJ265376 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BJ285931.1|BJ285931 BJ285931 Y. Ogihara unpublished cDNA... 98 2e-018
gb|CA741900.1|CA741900 wia1c.pk002.g22 wia1c Triticum aesti... 98 2e-018
gb|CD454733.1|CD454733 WHE2340_D02_H04ZT CS wheat pre-anthe... 98 2e-018
gb|BJ253647.2|BJ253647 BJ253647 Y. Ogihara unpublished cDNA... 98 2e-018
gb|BE498680.1|BE498680 WHE0964_B01_C02ZS Wheat pre-anthesis... 92 1e-016
gb|BJ251433.1|BJ251433 BJ251433 Y. Ogihara unpublished cDNA... 92 1e-016
gb|BJ251462.1|BJ251462 BJ251462 Y. Ogihara unpublished cDNA... 90 5e-016
gb|BJ270297.1|BJ270297 BJ270297 Y. Ogihara unpublished cDNA... 90 5e-016
gb|BQ244544.1|BQ244544 TaE15036A09F TaE15 Triticum aestivum... 90 5e-016
gb|CA701268.1|CA701268 wkm2c.pk0003.c10 wkm2c Triticum aest... 90 5e-016
gb|AL815139.1|AL815139 AL815139 h:116 Triticum aestivum cDN... 86 8e-015
gb|BQ903209.1|BQ903209 Ta03_11a06_R Ta03_AAFC_ECORC_Fusariu... 84 3e-014
gb|AL821984.1|AL821984 AL821984 N:130 Triticum aestivum cDN... 82 1e-013
gb|AL815132.1|AL815132 AL815132 h:116 Triticum aestivum cDN... 82 1e-013
gb|BJ244464.1|BJ244464 BJ244464 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ250162.1|BJ250162 BJ250162 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ250272.1|BJ250272 BJ250272 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ250966.1|BJ250966 BJ250966 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ251214.1|BJ251214 BJ251214 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ251309.1|BJ251309 BJ251309 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ251352.1|BJ251352 BJ251352 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ252308.1|BJ252308 BJ252308 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ253835.1|BJ253835 BJ253835 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ254115.1|BJ254115 BJ254115 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ254384.1|BJ254384 BJ254384 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ254774.1|BJ254774 BJ254774 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BJ262062.1|BJ262062 BJ262062 Y. Ogihara unpublished cDNA... 80 5e-013
gb|BQ903554.1|BQ903554 Ta03_15h03_R Ta03_AAFC_ECORC_Fusariu... 80 5e-013
gb|BJ247434.1|BJ247434 BJ247434 Y. Ogihara unpublished cDNA... 78 2e-012
gb|BJ245424.1|BJ245424 BJ245424 Y. Ogihara unpublished cDNA... 74 3e-011
gb|BJ245573.1|BJ245573 BJ245573 Y. Ogihara unpublished cDNA... 74 3e-011
gb|BJ249449.1|BJ249449 BJ249449 Y. Ogihara unpublished cDNA... 74 3e-011
gb|BJ263781.1|BJ263781 BJ263781 Y. Ogihara unpublished cDNA... 72 1e-010
gb|CA593729.1|CA593729 wpa1c.pk002.o7 wpa1c Triticum aestiv... 72 1e-010
gb|BJ247909.1|BJ247909 BJ247909 Y. Ogihara unpublished cDNA... 70 4e-010
gb|BJ262258.1|BJ262258 BJ262258 Y. Ogihara unpublished cDNA... 70 4e-010
gb|BQ744222.1|BQ744222 WHE4113_A12_A23ZS Wheat salt-stresse... 70 4e-010
gb|BQ744497.1|BQ744497 WHE4116_C08_F16ZS Wheat salt-stresse... 70 4e-010
gb|BQ752907.1|BQ752907 WHE4120_E08_J16ZS Wheat salt-stresse... 70 4e-010
gb|BQ839189.1|BQ839189 WHE4163_D03_G05ZS Wheat CS whole pla... 70 4e-010
gb|CD866664.1|CD866664 AZO2.104B09F001128 AZO2 Triticum aes... 70 4e-010
gb|CK193318.1|CK193318 FGAS001732 Triticum aestivum FGAS: L... 70 4e-010
gb|AL810791.1|AL810791 AL810791 d:26 Triticum aestivum cDNA... 70 4e-010
gb|BF202097.1|BF202097 WHE1773_F07_K13ZS Wheat pre-anthesis... 68 2e-009
gb|BJ253910.1|BJ253910 BJ253910 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ258516.1|BJ258516 BJ258516 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ277459.1|BJ277459 BJ277459 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ278373.1|BJ278373 BJ278373 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ278760.1|BJ278760 BJ278760 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ278769.1|BJ278769 BJ278769 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ280642.1|BJ280642 BJ280642 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ280887.1|BJ280887 BJ280887 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ281453.1|BJ281453 BJ281453 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BQ752745.1|BQ752745 WHE4118_F08_K16ZS Wheat salt-stresse... 68 2e-009
gb|CA601668.1|CA601668 wr1.pk0002.d12 wr1 Triticum aestivum... 68 2e-009
gb|CA605908.1|CA605908 wr1.pk0060.d8 wr1 Triticum aestivum ... 68 2e-009
gb|CA613168.1|CA613168 wr1.pk0147.b3 wr1 Triticum aestivum ... 68 2e-009
gb|CA613256.1|CA613256 wr1.pk0155.h2 wr1 Triticum aestivum ... 68 2e-009
gb|CK194009.1|CK194009 FGAS002428 Triticum aestivum FGAS: L... 68 2e-009
gb|CK194762.1|CK194762 FGAS003194 Triticum aestivum FGAS: L... 68 2e-009
gb|CK197911.1|CK197911 FGAS006391 Triticum aestivum FGAS: L... 68 2e-009
gb|CK197915.1|CK197915 FGAS006395 Triticum aestivum FGAS: L... 68 2e-009
gb|CK199302.1|CK199302 FGAS007797 Triticum aestivum FGAS: L... 68 2e-009
gb|CK199779.1|CK199779 FGAS008286 Triticum aestivum FGAS: L... 68 2e-009
gb|CK201818.1|CK201818 FGAS010338 Triticum aestivum FGAS: L... 68 2e-009
gb|CK204664.1|CK204664 FGAS013200 Triticum aestivum FGAS: L... 68 2e-009
gb|CD866342.1|CD866342 AZO2.103C24F001107 AZO2 Triticum aes... 66 7e-009
gb|BE404519.1|BE404519 WHE0443_C07_F13ZS Wheat etiolated se... 62 1e-007
gb|BQ838290.1|BQ838290 WHE2908_G01_N02ZS Wheat aluminum-str... 62 1e-007
gb|BQ838526.1|BQ838526 WHE2911_E06_J11ZS Wheat aluminum-str... 62 1e-007
gb|BQ839225.1|BQ839225 WHE4163_G03_M05ZS Wheat CS whole pla... 62 1e-007
gb|CD871249.1|CD871249 AZO2.117M10F010207 AZO2 Triticum aes... 62 1e-007
gb|CD872349.1|CD872349 AZO2.120G23F010209 AZO2 Triticum aes... 62 1e-007
gb|CD872780.1|CD872780 AZO2.121I10F010209 AZO2 Triticum aes... 62 1e-007
gb|CK193342.1|CK193342 FGAS001756 Triticum aestivum FGAS: L... 62 1e-007
gb|CK195296.1|CK195296 FGAS003735 Triticum aestivum FGAS: L... 62 1e-007
gb|CK196736.1|CK196736 FGAS005196 Triticum aestivum FGAS: L... 62 1e-007
gb|CK197997.1|CK197997 FGAS006478 Triticum aestivum FGAS: L... 62 1e-007
gb|CK198004.1|CK198004 FGAS006485 Triticum aestivum FGAS: L... 62 1e-007
gb|CK198708.1|CK198708 FGAS007195 Triticum aestivum FGAS: L... 62 1e-007
gb|DR735309.1|DR735309 FGAS080979 Triticum aestivum FGAS: L... 62 1e-007
gb|BE443659.1|BE443659 WHE1121_G03_M05ZS Wheat etiolated se... 60 4e-007
gb|BQ484074.1|BQ484074 WHE3516_B03_D06ZS Wheat unstressed r... 60 4e-007
gb|CA611467.1|CA611467 wr1.pk0131.b10 wr1 Triticum aestivum... 60 4e-007
gb|CK197262.1|CK197262 FGAS005733 Triticum aestivum FGAS: L... 60 4e-007
gb|BJ211118.1|BJ211118 BJ211118 Y. Ogihara unpublished cDNA... 58 2e-006
gb|BJ212113.1|BJ212113 BJ212113 Y. Ogihara unpublished cDNA... 58 2e-006
gb|AL820992.1|AL820992 AL820992 O:232 Triticum aestivum cDN... 58 2e-006
gb|CA637432.1|CA637432 wre1.pk0004.e2 wre1 Triticum aestivu... 58 2e-006
gb|BE488780.1|BE488780 WHE1054_F10_L20ZS Wheat unstressed s... 56 7e-006
gb|BE488899.1|BE488899 WHE1077_H07_P13ZS Wheat unstressed s... 56 7e-006
gb|BE488990.1|BE488990 WHE1061_H08_P15ZS Wheat unstressed s... 56 7e-006
gb|BE489677.1|BE489677 WHE1071-1074_F07_F07ZS Wheat unstres... 56 7e-006
gb|BJ280810.1|BJ280810 BJ280810 Y. Ogihara unpublished cDNA... 56 7e-006
gb|BQ789389.1|BQ789389 WHE4161_A02_B03ZS Wheat CS whole pla... 56 7e-006
gb|BQ801851.1|BQ801851 WHE2819_C08_F15ZS Triticum monococcu... 56 7e-006
gb|CA614162.1|CA614162 wr1.pk179.g6 wr1 Triticum aestivum c... 56 7e-006
gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA,... 56 7e-006
gb|BG605337.1|BG605337 WHE2331_E12_J23ZS Wheat pre-anthesis... 54 3e-005
gb|BJ281871.1|BJ281871 BJ281871 Y. Ogihara unpublished cDNA... 54 3e-005
gb|BQ838079.1|BQ838079 WHE2906_C10_E20ZS Wheat aluminum-str... 54 3e-005
gb|CA624679.1|CA624679 wl1n.pk0122.f9 wl1n Triticum aestivu... 54 3e-005
gb|CA625648.1|CA625648 wl1n.pk0133.h3 wl1n Triticum aestivu... 54 3e-005
gb|CD868601.1|CD868601 AZO2.109F21F001114 AZO2 Triticum aes... 54 3e-005
gb|CK195306.1|CK195306 FGAS003745 Triticum aestivum FGAS: L... 54 3e-005
gb|CK195410.1|CK195410 FGAS003849 Triticum aestivum FGAS: L... 54 3e-005
gb|CK197943.1|CK197943 FGAS006424 Triticum aestivum FGAS: L... 54 3e-005
gb|BJ280602.1|BJ280602 BJ280602 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ280621.1|BJ280621 BJ280621 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ286985.1|BJ286985 BJ286985 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BQ752727.1|BQ752727 WHE4118_D10_G20ZS Wheat salt-stresse... 52 1e-004
gb|CA725388.1|CA725388 wds3f.pk002.i3 wds3f Triticum aestiv... 52 1e-004
gb|CD454721.1|CD454721 WHE2338_D11_G22ZT CS wheat pre-anthe... 52 1e-004
gb|CD868301.1|CD868301 AZO2.108H23F001113 AZO2 Triticum aes... 52 1e-004
gb|CD870399.1|CD870399 AZO2.114E20F010115 AZO2 Triticum aes... 52 1e-004
gb|CD877421.1|CD877421 AZO4.100E10F010925 AZO4 Triticum aes... 52 1e-004
gb|CD877723.1|CD877723 AZO4.100P07F010925 AZO4 Triticum aes... 52 1e-004
gb|CD878105.1|CD878105 AZO4.101O13F011002 AZO4 Triticum aes... 52 1e-004
gb|CD879689.1|CD879689 AZO4.106A23F011012 AZO4 Triticum aes... 52 1e-004
gb|CK204266.1|CK204266 FGAS012802 Triticum aestivum FGAS: L... 52 1e-004
gb|BE428351.1|BE428351 MTD006.A08F990616 ITEC MTD Durum Whe... 50 4e-004
gb|BE443047.1|BE443047 WHE1114_C01_E02ZS Wheat etiolated se... 50 4e-004
gb|BE489912.1|BE489912 WHE0363_C06_E11ZS Wheat cold-stresse... 50 4e-004
gb|BJ282645.1|BJ282645 BJ282645 Y. Ogihara unpublished cDNA... 50 4e-004
gb|BJ283425.1|BJ283425 BJ283425 Y. Ogihara unpublished cDNA... 50 4e-004
gb|BJ283820.1|BJ283820 BJ283820 Y. Ogihara unpublished cDNA... 50 4e-004
gb|BJ285645.1|BJ285645 BJ285645 Y. Ogihara unpublished cDNA... 50 4e-004
gb|BQ295179.1|BQ295179 WHE2867_A12_A23ZS Wheat unstressed r... 50 4e-004
gb|BQ483540.1|BQ483540 WHE3509_G11_M21ZS Wheat unstressed r... 50 4e-004
gb|BU101173.1|BU101173 WHE3363_F12_K23ZS Chinese Spring alu... 50 4e-004
gb|CA601604.1|CA601604 wr1.pk0002.f4 wr1 Triticum aestivum ... 50 4e-004
gb|CA602349.1|CA602349 wr1.pk0011.a11 wr1 Triticum aestivum... 50 4e-004
gb|CA606953.1|CA606953 wr1.pk0073.f5 wr1 Triticum aestivum ... 50 4e-004
gb|CA608618.1|CA608618 wr1.pk0092.e9 wr1 Triticum aestivum ... 50 4e-004
gb|CA608683.1|CA608683 wr1.pk0093.d11 wr1 Triticum aestivum... 50 4e-004
gb|CA609179.1|CA609179 wr1.pk0101.f12 wr1 Triticum aestivum... 50 4e-004
gb|CA611273.1|CA611273 wr1.pk0096.h10 wr1 Triticum aestivum... 50 4e-004
gb|CA611866.1|CA611866 wr1.pk0133.e5 wr1 Triticum aestivum ... 50 4e-004
gb|CA639388.1|CA639388 wre1n.pk0015.f12 wre1n Triticum aest... 50 4e-004
gb|CD452589.1|CD452589 WHE1114_C01_E02ZT CS wheat etiolated... 50 4e-004
gb|CD867958.1|CD867958 AZO2.107K10F001110 AZO2 Triticum aes... 50 4e-004
gb|CK155031.1|CK155031 FGAS033751 Triticum aestivum FGAS: T... 50 4e-004
gb|CK162781.1|CK162781 FGAS015380 Triticum aestivum FGAS: L... 50 4e-004
gb|CK162782.1|CK162782 FGAS015381 Triticum aestivum FGAS: L... 50 4e-004
gb|CK163258.1|CK163258 FGAS015880 Triticum aestivum FGAS: L... 50 4e-004
gb|CK163262.1|CK163262 FGAS015884 Triticum aestivum FGAS: L... 50 4e-004
gb|CK195342.1|CK195342 FGAS003781 Triticum aestivum FGAS: L... 50 4e-004
gb|CK200545.1|CK200545 FGAS009060 Triticum aestivum FGAS: L... 50 4e-004
gb|CK202762.1|CK202762 FGAS011287 Triticum aestivum FGAS: L... 50 4e-004
gb|CK202783.1|CK202783 FGAS011308 Triticum aestivum FGAS: L... 50 4e-004
gb|CK203080.1|CK203080 FGAS011606 Triticum aestivum FGAS: L... 50 4e-004
gb|CK203101.1|CK203101 FGAS011627 Triticum aestivum FGAS: L... 50 4e-004
gb|CK207892.1|CK207892 FGAS019564 Triticum aestivum FGAS: L... 50 4e-004
gb|CK210294.1|CK210294 FGAS022095 Triticum aestivum FGAS: L... 50 4e-004
gb|CK210350.1|CK210350 FGAS022155 Triticum aestivum FGAS: L... 50 4e-004
gb|CK211583.1|CK211583 FGAS023434 Triticum aestivum FGAS: L... 50 4e-004
gb|CK217114.1|CK217114 FGAS029115 Triticum aestivum FGAS: L... 50 4e-004
gb|CV762078.1|CV762078 FGAS056467 Triticum aestivum FGAS: L... 50 4e-004
gb|CV762174.1|CV762174 FGAS056563 Triticum aestivum FGAS: L... 50 4e-004
gb|CV765837.1|CV765837 FGAS060224 Triticum aestivum FGAS: L... 50 4e-004
gb|CV770658.1|CV770658 FGAS065051 Triticum aestivum FGAS: L... 50 4e-004
gb|DR736913.1|DR736913 FGAS082283 Triticum aestivum FGAS: L... 50 4e-004
gb|DR739722.1|DR739722 FGAS084939 Triticum aestivum FGAS: L... 50 4e-004
gb|BE637608.1|BE637608 WHE0983-0986_O15_O15ZS Wheat pre-ant... 48 0.002
gb|BJ242559.1|BJ242559 BJ242559 Y. Ogihara unpublished cDNA... 48 0.002
gb|BJ250154.1|BJ250154 BJ250154 Y. Ogihara unpublished cDNA... 48 0.002
gb|BJ283747.1|BJ283747 BJ283747 Y. Ogihara unpublished cDNA... 48 0.002
gb|AL822105.1|AL822105 AL822105 N:130 Triticum aestivum cDN... 48 0.002
gb|BQ744337.1|BQ744337 WHE4114_D07_G14ZS Wheat salt-stresse... 48 0.002
gb|CA734071.1|CA734071 wde2f.pk001.p4 wde2f Triticum aestiv... 48 0.002
gb|CD865834.1|CD865834 AZO2.101O04F010111 AZO2 Triticum aes... 48 0.002
gb|CD890763.1|CD890763 G118.115G05R010926 G118 Triticum aes... 48 0.002
gb|CD923922.1|CD923922 G750.110M07F010710 G750 Triticum aes... 48 0.002
gb|CK168322.1|CK168322 FGAS052842 Triticum aestivum FGAS: T... 48 0.002
gb|AJ610778.1|AJ610778 AJ610778 Triticum turgidum subsp. du... 48 0.002
gb|AJ612538.1|AJ612538 AJ612538 Triticum turgidum subsp. du... 48 0.002
gb|AJ615904.1|AJ615904 AJ615904 Triticum turgidum subsp. du... 48 0.002
gb|CN011144.1|CN011144 WHE3880_E03_I06ZS Wheat Fusarium gra... 48 0.002
gb|CV763868.1|CV763868 FGAS058251 Triticum aestivum FGAS: L... 48 0.002
gb|CV774007.1|CV774007 FGAS068404 Triticum aestivum FGAS: L... 48 0.002
gb|CV782020.1|CV782020 FGAS076433 Triticum aestivum FGAS: L... 48 0.002
dbj|AB109216.1| Triticum aestivum mRNA for cysteine proteas... 48 0.002
gb|BE488351.1|BE488351 WHE1055_H01_O01ZS Wheat unstressed s... 46 0.007
gb|BE489155.1|BE489155 WHE1062_B01_D02ZS Wheat unstressed s... 46 0.007
gb|AL820916.1|AL820916 AL820916 O:232 Triticum aestivum cDN... 46 0.007
gb|AL821550.1|AL821550 AL821550 p:133 Triticum aestivum cDN... 46 0.007
gb|CD869718.1|CD869718 AZO2.112G20F001124 AZO2 Triticum aes... 46 0.007
gb|CD901227.1|CD901227 G356.103C18F010917 G356 Triticum aes... 46 0.007
gb|CD915262.1|CD915262 G550.125I22R010921 G550 Triticum aes... 46 0.007
gb|CK201216.1|CK201216 FGAS009735 Triticum aestivum FGAS: L... 46 0.007
gb|CV761378.1|CV761378 FGAS055766 Triticum aestivum FGAS: L... 46 0.007
gb|CV763039.1|CV763039 FGAS057428 Triticum aestivum FGAS: L... 46 0.007
gb|CV767616.1|CV767616 FGAS062007 Triticum aestivum FGAS: L... 46 0.007
gb|CV781753.1|CV781753 FGAS076166 Triticum aestivum FGAS: L... 46 0.007
gb|DR741363.1|DR741363 FGAS030419 Triticum aestivum FGAS: L... 46 0.007
gb|BE405624.1|BE405624 WHE1209_E04_I07ZS Wheat etiolated se... 44 0.026
gb|BE471170.1|BE471170 WHE0285_H05_P09ZS Wheat drought-stre... 44 0.026
gb|BE488907.1|BE488907 WHE1077_G09_N17ZS Wheat unstressed s... 44 0.026
gb|BF485242.1|BF485242 WHE1790_B01_D02ZS Wheat pre-anthesis... 44 0.026
gb|BI479768.1|BI479768 WHE3451_H02_O03ZS Wheat pre-anthesis... 44 0.026
gb|BJ275299.1|BJ275299 BJ275299 Y. Ogihara unpublished cDNA... 44 0.026
gb|BQ743784.1|BQ743784 WHE4108_B03_D06ZS Wheat salt-stresse... 44 0.026
gb|BQ743882.1|BQ743882 WHE4109_C08_E15ZS Wheat salt-stresse... 44 0.026
gb|CA600619.1|CA600619 waw1c.pk005.k18 waw1c Triticum aesti... 44 0.026
gb|CA721837.1|CA721837 wds1c.pk001.e7.f wds1c Triticum mono... 44 0.026
gb|CD866724.1|CD866724 AZO2.104E01F010112 AZO2 Triticum aes... 44 0.026
gb|CD877328.1|CD877328 AZO4.100B09F010925 AZO4 Triticum aes... 44 0.026
gb|CK198528.1|CK198528 FGAS007014 Triticum aestivum FGAS: L... 44 0.026
gb|CK207903.1|CK207903 FGAS019576 Triticum aestivum FGAS: L... 44 0.026
gb|CV065972.1|CV065972 WNEL29a3 Wheat EST endosperm library... 44 0.026
gb|CV777861.1|CV777861 FGAS072268 Triticum aestivum FGAS: L... 44 0.026
gb|DR736659.1|DR736659 FGAS082029 Triticum aestivum FGAS: L... 44 0.026
gb|AY244510.1| Triticum monococcum cultivar G1777 cysteine ... 44 0.026
gb|AY244511.1| Triticum monococcum cultivar G2528 cysteine ... 44 0.026
gb|BE498288.1|BE498288 WHE0963_D02_G03ZS Wheat pre-anthesis... 42 0.10
gb|BJ243659.1|BJ243659 BJ243659 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ273243.1|BJ273243 BJ273243 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ277552.1|BJ277552 BJ277552 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ279610.1|BJ279610 BJ279610 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ281498.1|BJ281498 BJ281498 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ282735.1|BJ282735 BJ282735 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ283180.1|BJ283180 BJ283180 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ283812.1|BJ283812 BJ283812 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ284600.1|BJ284600 BJ284600 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ284789.1|BJ284789 BJ284789 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ286139.1|BJ286139 BJ286139 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ286571.1|BJ286571 BJ286571 Y. Ogihara unpublished cDNA... 42 0.10
gb|BJ287530.1|BJ287530 BJ287530 Y. Ogihara unpublished cDNA... 42 0.10
gb|AL828218.1|AL828218 AL828218 p:436 Triticum aestivum cDN... 42 0.10
gb|CA601833.1|CA601833 wr1.pk0003.b9 wr1 Triticum aestivum ... 42 0.10
gb|CA602895.1|CA602895 wr1.pk0007.b9 wr1 Triticum aestivum ... 42 0.10
gb|CA602923.1|CA602923 wr1.pk0006.c1 wr1 Triticum aestivum ... 42 0.10
gb|CA603376.1|CA603376 wr1.pk0028.h12 wr1 Triticum aestivum... 42 0.10
gb|CA605594.1|CA605594 wr1.pk0055.c7 wr1 Triticum aestivum ... 42 0.10
gb|CA605616.1|CA605616 wr1.pk0055.e11 wr1 Triticum aestivum... 42 0.10
gb|CA606127.1|CA606127 wr1.pk0063.f7 wr1 Triticum aestivum ... 42 0.10
gb|CA606838.1|CA606838 wr1.pk0069.f11 wr1 Triticum aestivum... 42 0.10
gb|CA606931.1|CA606931 wr1.pk0073.c6 wr1 Triticum aestivum ... 42 0.10
gb|CA607971.1|CA607971 wr1.pk0084.f9 wr1 Triticum aestivum ... 42 0.10
gb|CA608298.1|CA608298 wr1.pk0087.a4 wr1 Triticum aestivum ... 42 0.10
gb|CA610095.1|CA610095 wr1.pk0114.a8 wr1 Triticum aestivum ... 42 0.10
gb|CA610822.1|CA610822 wr1.pk0124.h1 wr1 Triticum aestivum ... 42 0.10
gb|CA611416.1|CA611416 wr1.pk0127.h2 wr1 Triticum aestivum ... 42 0.10
gb|CA611640.1|CA611640 wr1.pk0128.e8 wr1 Triticum aestivum ... 42 0.10
gb|CA613084.1|CA613084 wr1.pk0150.b3 wr1 Triticum aestivum ... 42 0.10
gb|CA613102.1|CA613102 wr1.pk0150.b11 wr1 Triticum aestivum... 42 0.10
gb|CA613362.1|CA613362 wr1.pk0144.c12 wr1 Triticum aestivum... 42 0.10
gb|CA614221.1|CA614221 wr1.pk0154.b3 wr1 Triticum aestivum ... 42 0.10
gb|CA614698.1|CA614698 wr1.pk184.a8 wr1 Triticum aestivum c... 42 0.10
gb|CA614720.1|CA614720 wr1.pk184.g7 wr1 Triticum aestivum c... 42 0.10
gb|CA616246.1|CA616246 wr1.pk180.b1 wr1 Triticum aestivum c... 42 0.10
gb|CA616391.1|CA616391 wr1.pk148.b1 wr1 Triticum aestivum c... 42 0.10
gb|CA637945.1|CA637945 wre1n.pk0005.b10 wre1n Triticum aest... 42 0.10
gb|CA639977.1|CA639977 wre1n.pk0029.b11 wre1n Triticum aest... 42 0.10
gb|CA640435.1|CA640435 wre1n.pk0035.d3 wre1n Triticum aesti... 42 0.10
gb|CA642192.1|CA642192 wre1n.pk0053.g9 wre1n Triticum aesti... 42 0.10
gb|CA643160.1|CA643160 wre1n.pk0071.h1 wre1n Triticum aesti... 42 0.10
gb|CA647626.1|CA647626 wre1n.pk0121.c9 wre1n Triticum aesti... 42 0.10
gb|CA651660.1|CA651660 wre1n.pk174.h2 wre1n Triticum aestiv... 42 0.10
gb|CA653815.1|CA653815 wre1n.pk188.e10 wre1n Triticum aesti... 42 0.10
gb|CA693088.1|CA693088 wlm96.pk061.e6 wlm96 Triticum aestiv... 42 0.10
gb|CD452363.1|CD452363 WHE1054_F10_L20ZT CS wheat unstresse... 42 0.10
gb|CD864948.1|CD864948 AZO2.001P14F000629 AZO2 Triticum aes... 42 0.10
gb|CD865017.1|CD865017 AZO2.073B18R000922 AZO2 Triticum aes... 42 0.10
gb|CD869318.1|CD869318 AZO2.111F06R010402 AZO2 Triticum aes... 42 0.10
gb|CD877329.1|CD877329 AZO4.100B09R011121 AZO4 Triticum aes... 42 0.10
gb|CD877724.1|CD877724 AZO4.100P07R011121 AZO4 Triticum aes... 42 0.10
gb|CD878106.1|CD878106 AZO4.101O13R011121 AZO4 Triticum aes... 42 0.10
gb|CD879653.1|CD879653 AZO4.105O23F011011 AZO4 Triticum aes... 42 0.10
gb|CD879690.1|CD879690 AZO4.106A23R011122 AZO4 Triticum aes... 42 0.10
gb|CD879956.1|CD879956 AZO4.106N23F011012 AZO4 Triticum aes... 42 0.10
gb|CD879957.1|CD879957 AZO4.106N23R011122 AZO4 Triticum aes... 42 0.10
gb|CK193016.1|CK193016 FGAS001425 Triticum aestivum FGAS: L... 42 0.10
gb|CK194957.1|CK194957 FGAS003391 Triticum aestivum FGAS: L... 42 0.10
gb|CK194967.1|CK194967 FGAS003401 Triticum aestivum FGAS: L... 42 0.10
gb|CK196287.1|CK196287 FGAS004741 Triticum aestivum FGAS: L... 42 0.10
gb|CK196440.1|CK196440 FGAS004898 Triticum aestivum FGAS: L... 42 0.10
gb|CK196924.1|CK196924 FGAS005393 Triticum aestivum FGAS: L... 42 0.10
gb|CK197586.1|CK197586 FGAS006063 Triticum aestivum FGAS: L... 42 0.10
gb|CK197665.1|CK197665 FGAS006145 Triticum aestivum FGAS: L... 42 0.10
gb|CK198366.1|CK198366 FGAS006851 Triticum aestivum FGAS: L... 42 0.10
gb|CK198753.1|CK198753 FGAS007240 Triticum aestivum FGAS: L... 42 0.10
gb|CK199455.1|CK199455 FGAS007954 Triticum aestivum FGAS: L... 42 0.10
gb|CK202422.1|CK202422 FGAS010946 Triticum aestivum FGAS: L... 42 0.10
gb|AJ612920.1|AJ612920 AJ612920 Triticum turgidum subsp. du... 42 0.10
gb|CV762871.1|CV762871 FGAS057260 Triticum aestivum FGAS: L... 42 0.10
gb|CV775414.1|CV775414 FGAS069818 Triticum aestivum FGAS: L... 42 0.10
gb|CV775690.1|CV775690 FGAS070094 Triticum aestivum FGAS: L... 42 0.10
gb|CV779460.1|CV779460 FGAS073869 Triticum aestivum FGAS: L... 42 0.10
gb|DR735998.1|DR735998 FGAS081506 Triticum aestivum FGAS: L... 42 0.10
gb|BE471129.1|BE471129 WHE0284_D02_G04ZS Wheat drought-stre... 40 0.40
gb|BE490132.1|BE490132 WHE0365_B05_D09ZS Wheat cold-stresse... 40 0.40
gb|BJ256950.1|BJ256950 BJ256950 Y. Ogihara unpublished cDNA... 40 0.40
gb|BJ262526.1|BJ262526 BJ262526 Y. Ogihara unpublished cDNA... 40 0.40
gb|BJ278470.1|BJ278470 BJ278470 Y. Ogihara unpublished cDNA... 40 0.40
gb|CA612915.1|CA612915 wr1.pk0160.h9 wr1 Triticum aestivum ... 40 0.40
gb|CA650704.1|CA650704 wre1n.pk0154.g8 wre1n Triticum aesti... 40 0.40
gb|CA660902.1|CA660902 wlm1.pk0025.b11 wlm1 Triticum aestiv... 40 0.40
gb|CA685052.1|CA685052 wlm96.pk028.l20 wlm96 Triticum aesti... 40 0.40
gb|CA688243.1|CA688243 wlm96.pk039.l15 wlm96 Triticum aesti... 40 0.40
gb|CD875153.1|CD875153 AZO3.104G15R011124 AZO3 Triticum aes... 40 0.40
gb|CK155271.1|CK155271 FGAS033992 Triticum aestivum FGAS: T... 40 0.40
gb|CK155501.1|CK155501 FGAS036319 Triticum aestivum FGAS: T... 40 0.40
gb|CK156723.1|CK156723 FGAS037734 Triticum aestivum FGAS: T... 40 0.40
gb|CK156893.1|CK156893 FGAS037937 Triticum aestivum FGAS: T... 40 0.40
gb|CK162636.1|CK162636 FGAS015234 Triticum aestivum FGAS: L... 40 0.40
gb|CK162974.1|CK162974 FGAS015585 Triticum aestivum FGAS: L... 40 0.40
gb|CK200960.1|CK200960 FGAS009477 Triticum aestivum FGAS: L... 40 0.40
gb|CK205694.1|CK205694 FGAS017224 Triticum aestivum FGAS: L... 40 0.40
gb|AJ614981.1|AJ614981 AJ614981 Triticum turgidum subsp. du... 40 0.40
gb|CN008810.1|CN008810 WHE2645_D10_G19ZE Wheat Fusarium gra... 40 0.40
gb|AL808731.1|AL808731 AL808731 A:22 Triticum aestivum cDNA... 40 0.40
gb|CV779365.1|CV779365 FGAS073774 Triticum aestivum FGAS: L... 40 0.40
gb|DR740021.1|DR740021 FGAS000288 Triticum aestivum FGAS: L... 40 0.40
>gb|BE500262.1|BE500262 WHE0981_G02_N03ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0981_G02_N03, mRNA sequence
Length = 606
Score = 147 bits (74), Expect = 2e-033
Identities = 125/142 (88%)
Strand = Plus / Plus
Query: 909 cgtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtg 968
||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||
Sbjct: 422 cgtcggctacggcaccgacgcctactcggggctcaagtactggctcgtcaagaactcgtg 481
Query: 969 ggggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgggcgcggggg 1028
||| |||| ||||||||| ||| ||| | || ||||||||||||||||| |||||||
Sbjct: 482 gggccagacatggggcgaggccggctacatccgtatgcgccgcgacgtcggaggcggggg 541
Query: 1029 actgtgcggcatcgcgctcgac 1050
|| ||||||||||||||||||
Sbjct: 542 gctctgcggcatcgcgctcgac 563
Score = 58.0 bits (29), Expect = 2e-006
Identities = 71/85 (83%)
Strand = Plus / Plus
Query: 541 atcacgacagggaagctggtgtcgctgtcggagcaggagctgatcgactgcgacccctac 600
|||| ||| |||| ||||||| | |||||||||||| ||||| | ||||||||| |||
Sbjct: 63 atcaagacggggacgctggtgaccctgtcggagcagcagctggtggactgcgacaagtac 122
Query: 601 gacggcggctgcaacctgggctact 625
||||| |||||||||| |||||||
Sbjct: 123 gacggtggctgcaaccgaggctact 147
>gb|BJ247679.1|BJ247679 BJ247679 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf3e07 5', mRNA sequence
Length = 446
Score = 147 bits (74), Expect = 2e-033
Identities = 125/142 (88%)
Strand = Plus / Plus
Query: 909 cgtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtg 968
||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||
Sbjct: 47 cgtcggctacggcaccgacgcctactcggggctcaagtactggctcgtcaagaactcgtg 106
Query: 969 ggggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgggcgcggggg 1028
||| |||| ||||||||| ||| ||| | || ||||||||||||||||| |||||||
Sbjct: 107 gggccagacatggggcgaggccggctacatccgtatgcgccgcgacgtcggaggcggggg 166
Query: 1029 actgtgcggcatcgcgctcgac 1050
|| ||||||||||||||||||
Sbjct: 167 gctctgcggcatcgcgctcgac 188
>gb|BJ253781.1|BJ253781 BJ253781 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf3e07 3', mRNA sequence
Length = 432
Score = 147 bits (74), Expect = 2e-033
Identities = 125/142 (88%)
Strand = Plus / Minus
Query: 909 cgtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtg 968
||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||
Sbjct: 384 cgtcggctacggcaccgacgcctactcggggctcaagtactggctcgtcaagaactcgtg 325
Query: 969 ggggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgggcgcggggg 1028
||| |||| ||||||||| ||| ||| | || ||||||||||||||||| |||||||
Sbjct: 324 gggccagacatggggcgaggccggctacatccgtatgcgccgcgacgtcggaggcggggg 265
Query: 1029 actgtgcggcatcgcgctcgac 1050
|| ||||||||||||||||||
Sbjct: 264 gctctgcggcatcgcgctcgac 243
>gb|BQ170591.1|BQ170591 WHE1790_B01_D02ZT Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1790_B01_D02, mRNA sequence
Length = 543
Score = 147 bits (74), Expect = 2e-033
Identities = 125/142 (88%)
Strand = Plus / Minus
Query: 909 cgtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtg 968
||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||
Sbjct: 376 cgtcggctacggcaccgacgcctactcggggctcaagtactggctcgtcaagaactcgtg 317
Query: 969 ggggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgggcgcggggg 1028
||| |||| ||||||||| ||| ||| | || ||||||||||||||||| |||||||
Sbjct: 316 gggccagacgtggggcgaggccggctacatccgtatgcgccgcgacgtcggaggcggggg 257
Query: 1029 actgtgcggcatcgcgctcgac 1050
|| ||||||||||||||||||
Sbjct: 256 cctctgcggcatcgcgctcgac 235
Score = 40.1 bits (20), Expect = 0.40
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 836 gcagcctgcagttctacagcggcggcgtcttctcgg 871
||||| |||||||||||| |||||||||||||||
Sbjct: 449 gcagcatgcagttctacaagagcggcgtcttctcgg 414
>gb|BE499943.1|BE499943 WHE0976_D07_G14ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0976_D07_G14, mRNA sequence
Length = 418
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 108 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 167
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 168 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 227
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 228 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 287
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 288 acccaggaggagttcctgg 306
>gb|BJ244131.1|BJ244131 BJ244131 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf14f24 5', mRNA sequence
Length = 614
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 129 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 188
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 189 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 248
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 249 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 308
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 309 acccaggaggagttcctgg 327
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 462 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 521
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 522 tgctgggcgttcgtgacggttgcgacgatcgaga 555
>gb|BJ244160.1|BJ244160 BJ244160 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf14i05 5', mRNA sequence
Length = 550
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 109 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 168
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 169 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 228
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 229 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 288
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 289 acccaggaggagttcctgg 307
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgaga 535
>gb|BJ245012.1|BJ245012 BJ245012 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf17j11 5', mRNA sequence
Length = 544
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 109 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 168
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 169 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 228
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 229 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 288
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 289 acccaggaggagttcctgg 307
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgaga 535
>gb|BJ245034.1|BJ245034 BJ245034 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf17l07 5', mRNA sequence
Length = 600
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 63 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 122
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 123 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 182
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 183 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 242
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 243 acccaggaggagttcctgg 261
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 396 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 455
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 456 tgctgggcgttcgtgacggttgcgacgatcgaga 489
>gb|BJ245598.1|BJ245598 BJ245598 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf1f19 5', mRNA sequence
Length = 646
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 65 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 124
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 125 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 184
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 185 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 244
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 245 acccaggaggagttcctgg 263
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 398 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 457
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 458 tgctgggcgttcgtgacggttgcgacgatcgaga 491
>gb|BJ246003.1|BJ246003 BJ246003 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf21a12 5', mRNA sequence
Length = 658
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 100 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 159
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 160 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 219
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 220 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 279
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 280 acccaggaggagttcctgg 298
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 433 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 492
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 493 tgctgggcgttcgtgacggttgcgacgatcgaga 526
>gb|BJ246380.1|BJ246380 BJ246380 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf22k23 5', mRNA sequence
Length = 610
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 107 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 166
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 167 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 226
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 227 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 286
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 287 acccaggaggagttcctgg 305
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 440 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 499
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 500 tgctgggcgttcgtgacggttgcgacgatcgaga 533
>gb|BJ246786.1|BJ246786 BJ246786 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf25l23 5', mRNA sequence
Length = 621
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 109 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 168
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 169 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 228
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 229 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 288
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 289 acccaggaggagttcctgg 307
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgaga 535
>gb|BJ247502.1|BJ247502 BJ247502 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf2i02 5', mRNA sequence
Length = 700
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 90 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 149
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 150 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 209
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 210 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 269
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 270 acccaggaggagttcctgg 288
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 423 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 482
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 483 tgctgggcgttcgtgacggttgcgacgatcgaga 516
>gb|BJ248904.1|BJ248904 BJ248904 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf8i23 5', mRNA sequence
Length = 620
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 109 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 168
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 169 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 228
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 229 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 288
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 289 acccaggaggagttcctgg 307
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgaga 535
>gb|BJ259210.1|BJ259210 BJ259210 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh15n17 5', mRNA sequence
Length = 663
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 132 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 191
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 192 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 251
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 252 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 311
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 312 acccaggaggagttcctgg 330
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 465 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 524
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 525 tgctgggcgttcgtgacggttgcgacgatcgaga 558
>gb|CA741601.1|CA741601 wia1c.pk003.c13 wia1c Triticum aestivum cDNA clone wia1c.pk003.c13
5' end, mRNA sequence
Length = 608
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 119 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 178
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 179 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 238
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 239 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 298
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 299 acccaggaggagttcctgg 317
Score = 50.1 bits (25), Expect = 4e-004
Identities = 64/79 (81%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| | | ||| |||||
Sbjct: 452 gactggagatccaagggcgccgtcacaccggtcaagtcccannncgcnnnatgcgctagc 511
Query: 496 tgctgggcattcgtgacgg 514
|||||||| ||||||||||
Sbjct: 512 tgctgggcgttcgtgacgg 530
>gb|CA741657.1|CA741657 wia1c.pk003.h1 wia1c Triticum aestivum cDNA clone wia1c.pk003.h1 5'
end, mRNA sequence
Length = 606
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 111 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 170
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 171 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 230
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 231 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 290
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 291 acccaggaggagttcctgg 309
Score = 65.9 bits (33), Expect = 7e-009
Identities = 78/93 (83%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 444 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 503
Query: 496 tgctgggcattcgtgacggcggcgacgatcgag 528
|||||||| |||||||||| ||||||||||||
Sbjct: 504 tgctgggcgttcgtgacggttgcgacgatcgag 536
>gb|CA741952.1|CA741952 wia1c.pk002.k17 wia1c Triticum aestivum cDNA clone wia1c.pk002.k17
5' end, mRNA sequence
Length = 613
Score = 133 bits (67), Expect = 4e-029
Identities = 166/199 (83%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 120 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 179
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 180 agcacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 239
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 240 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 299
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 300 acccaggaggagttcctgg 318
Score = 48.1 bits (24), Expect = 0.002
Identities = 75/93 (80%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| |||||| |||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 454 gactggagatccaagngcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 513
Query: 496 tgctgggcattcgtgacggcggcgacgatcgag 528
| ||||| |||||||||| ||||||||||||
Sbjct: 514 tnntgggcgttcgtgacggttgcgacgatcgag 546
>gb|BJ243655.1|BJ243655 BJ243655 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf12e09 5', mRNA sequence
Length = 458
Score = 127 bits (64), Expect = 2e-027
Identities = 165/199 (82%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 94 gacatgctgatgatggacaggttccgccagtggcaggccacgcacaaccggacgtacctg 153
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || || |||||||||||| |||| | ||| ||||||||
Sbjct: 154 agcacggaggagaggctgcgtcgntttcaggtgtaccgcgacaacgtggagtacatcgag 213
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| ||| |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 214 gccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctc 273
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 274 acccaggaggagttcctgg 292
Score = 44.1 bits (22), Expect = 0.026
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcac 461
|||||||| |||||||||||||||||
Sbjct: 427 gactggagatccaagggcgccgtcac 452
>gb|BJ243399.1|BJ243399 BJ243399 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf11a03 5', mRNA sequence
Length = 518
Score = 125 bits (63), Expect = 9e-027
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 72 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 130
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 131 gancgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 190
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 191 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 250
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 251 cacccaggaggagttcct 268
Score = 40.1 bits (20), Expect = 0.40
Identities = 36/40 (90%), Gaps = 1/40 (2%)
Strand = Plus / Plus
Query: 491 ctagctgctgggca-ttcgtgacggcggcgacgatcgaga 529
||||||||||||| |||||||||| |||||||||||||
Sbjct: 461 ctagctgctgggcggttcgtgacggttgcgacgatcgaga 500
>gb|BJ246735.1|BJ246735 BJ246735 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf25h23 5', mRNA sequence
Length = 390
Score = 125 bits (63), Expect = 9e-027
Identities = 165/199 (82%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacccg 195
|||| ||||||||||||| |||||| | |||||||| ||| |||||||| |||||| |
Sbjct: 16 gacatgctgatgatggacaggttccgccattggcaggccacgcacaaccggacgtacctg 75
Query: 196 acggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgag 255
| |||||||||||| ||| || ||||||||||||||| |||| | ||| ||||||||
Sbjct: 76 aacacggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgag 135
Query: 256 gccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctc 315
|||||||||||| || |||| || ||| |||||||||||| ||||||||||||||
Sbjct: 136 gccaccaaccggcgcggtgacctcacctacgagctcggcgagaatgagttcgccgacctc 195
Query: 316 acggaggaggagttcctgg 334
|| |||||||||||||||
Sbjct: 196 acccaggaggagttcctgg 214
Score = 42.1 bits (21), Expect = 0.10
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaag 471
|||||||| |||||||||||||| || ||| |||||
Sbjct: 349 gactggagatccaagggcgccgtnacaccggtcaag 384
>gb|BF202087.1|BF202087 WHE1773_E09_I17ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1773_E09_I17, mRNA sequence
Length = 498
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 129 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 187
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 188 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 247
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 248 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 307
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 308 cacccaggaggagttcct 325
Score = 44.1 bits (22), Expect = 0.026
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcac 461
|||||||| |||||||||||||||||
Sbjct: 462 gactggagatccaagggcgccgtcac 487
>gb|BF482332.1|BF482332 WHE1797_E02_J03ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1797_E02_J03, mRNA sequence
Length = 399
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 94 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 152
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 153 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 212
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 213 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 272
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 273 cacccaggaggagttcct 290
>gb|BF484522.1|BF484522 WHE2324_E11_J22ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2324_E11_J22, mRNA sequence
Length = 422
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 96 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 154
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 155 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 214
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 215 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 274
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 275 cacccaggaggagttcct 292
>gb|BJ243317.1|BJ243317 BJ243317 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf10k03 5', mRNA sequence
Length = 535
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 109 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 167
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 168 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 227
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 228 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 287
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 288 cacccaggaggagttcct 305
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgaga 535
>gb|BJ244360.1|BJ244360 BJ244360 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf9g11 5', mRNA sequence
Length = 615
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 121 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 179
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 180 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 239
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 240 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 299
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 300 cacccaggaggagttcct 317
Score = 54.0 bits (27), Expect = 3e-005
Identities = 79/95 (83%), Gaps = 1/95 (1%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 454 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 513
Query: 496 tgctggg-cattcgtgacggcggcgacgatcgaga 529
||||||| | |||||||||| |||||||||||||
Sbjct: 514 tgctgggccgttcgtgacggttgcgacgatcgaga 548
>gb|BJ245091.1|BJ245091 BJ245091 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf17p23 5', mRNA sequence
Length = 687
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 129 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 187
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 188 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 247
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 248 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 307
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 308 cacccaggaggagttcct 325
Score = 73.8 bits (37), Expect = 3e-011
Identities = 145/181 (80%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 462 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 521
Query: 496 tgctgggcattcgtgacggcggcgacgatcgagagcatcaccaagatcacgacagggaag 555
|||||||| |||||||||| ||||||||||||| | | | ||||| ||| ||| ||
Sbjct: 522 tgctgggcgttcgtgacggttgcgacgatcgagactctgaactggatcaggacggggcag 581
Query: 556 ctggtgtcgctgtcggagcaggagctgatcgactgcgacccctacgacggcggctgcaac 615
||||| | || ||||||||| ||||| | ||||| |||| ||||||||||| ||||||
Sbjct: 582 ttggtgcccctctcggagcagcagctggtggactgtgaccaatacgacggcgggtgcaac 641
Query: 616 c 616
|
Sbjct: 642 c 642
>gb|BJ245340.1|BJ245340 BJ245340 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf19b03 5', mRNA sequence
Length = 594
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 132 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 190
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 191 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 250
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 251 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 310
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 311 cacccaggaggagttcct 328
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 465 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 524
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 525 tgctgggcgttcgtgacggttgcgacgatcgaga 558
>gb|BJ245470.1|BJ245470 BJ245470 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf19m03 5', mRNA sequence
Length = 627
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 113 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 171
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 172 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 231
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 232 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 291
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 292 cacccaggaggagttcct 309
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 446 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 505
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 506 tgctgggcgttcgtgacggttgcgacgatcgaga 539
>gb|BJ246379.1|BJ246379 BJ246379 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf22k22 5', mRNA sequence
Length = 642
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 109 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 167
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 168 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 227
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 228 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 287
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 288 cacccaggaggagttcct 305
Score = 73.8 bits (37), Expect = 3e-011
Identities = 145/181 (80%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 442 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 501
Query: 496 tgctgggcattcgtgacggcggcgacgatcgagagcatcaccaagatcacgacagggaag 555
|||||||| |||||||||| ||||||||||||| | | | ||||| ||| ||| ||
Sbjct: 502 tgctgggcgttcgtgacggttgcgacgatcgagactctgaactggatcaggacggggcag 561
Query: 556 ctggtgtcgctgtcggagcaggagctgatcgactgcgacccctacgacggcggctgcaac 615
||||| | || ||||||||| ||||| | ||||| |||| ||||||||||| ||||||
Sbjct: 562 ttggtgcccctctcggagcagcagctggtggactgtgaccaatacgacggcgggtgcaac 621
Query: 616 c 616
|
Sbjct: 622 c 622
>gb|BJ247984.1|BJ247984 BJ247984 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4h11 5', mRNA sequence
Length = 502
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 125 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 183
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 184 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 243
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 244 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 303
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 304 cacccaggaggagttcct 321
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaag 471
|||||||| ||||||||||||||||| ||| |||||
Sbjct: 458 gactggagatccaagggcgccgtcacaccggtcaag 493
>gb|BJ248235.1|BJ248235 BJ248235 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf5h11 5', mRNA sequence
Length = 415
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 131 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 189
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 190 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 249
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 250 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 309
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 310 cacccaggaggagttcct 327
>gb|CA595421.1|CA595421 wpa1c.pk009.j22 wpa1c Triticum aestivum cDNA clone wpa1c.pk009.j22
5' end, mRNA sequence
Length = 615
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 123 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 181
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 182 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 241
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 242 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 301
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 302 cacccaggaggagttcct 319
Score = 65.9 bits (33), Expect = 7e-009
Identities = 78/93 (83%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 456 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 515
Query: 496 tgctgggcattcgtgacggcggcgacgatcgag 528
|||||||| |||||||||| ||||||||||||
Sbjct: 516 tgctgggcgttcgtgacggttgcgacgatcgag 548
>gb|CA741772.1|CA741772 wia1c.pk003.d15 wia1c Triticum aestivum cDNA clone wia1c.pk003.d15
5' end, mRNA sequence
Length = 598
Score = 123 bits (62), Expect = 3e-026
Identities = 166/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 113 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 171
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 172 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 231
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 232 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 291
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 292 cacccaggaggagttcct 309
Score = 54.0 bits (27), Expect = 3e-005
Identities = 75/94 (79%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| || | ||| |||||
Sbjct: 447 gactggagatccaagggcgccgtcacaccggtcaagtcccnnnnngcnnnntgcgctagc 506
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 507 tgctgggcgttcgtgacggttgcgacgatcgaga 540
>gb|BE498906.1|BE498906 WHE0968_D12_G24ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0968_D12_G24, mRNA sequence
Length = 554
Score = 121 bits (61), Expect = 1e-025
Identities = 163/197 (82%)
Strand = Plus / Plus
Query: 134 gtgacaggctgatgatggaccggttcctcagctggcaggcgacgtacaaccggtcgtacc 193
|||||| ||||||||||||| |||||| | |||||||| || ||||||| |||||||
Sbjct: 120 gtgacatgctgatgatggacaggttccgccagtggcaggccacccacaaccgttcgtacc 179
Query: 194 cgacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcg 253
|| ||||||||||||| ||| || ||| ||||||||||| ||||| | ||| ||||||
Sbjct: 180 tgagcgcggaggagaggctgcggcgcttcgaggtgtaccgcagcaacgtggagtacatcg 239
Query: 254 aggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacc 313
| |||||||||||| ||| |||| || ||| |||||| |||||||| ||||||||||
Sbjct: 240 acgccaccaaccggcgcggcgacctcacctacgagctcggagagaaccaattcgccgacc 299
Query: 314 tcacggaggaggagttc 330
|||| | ||||||||||
Sbjct: 300 tcaccggggaggagttc 316
>gb|BJ256554.1|BJ256554 BJ256554 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh16p23 5', mRNA sequence
Length = 475
Score = 117 bits (59), Expect = 2e-024
Identities = 165/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 130 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 188
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || || | |||||||||| |||| | ||| |||||||
Sbjct: 189 gagcgcggaggagaggctgcgtcgcttncgggtgtaccgcgacaacgtggagtacatcga 248
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 249 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 308
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 309 cacccaggaggagttcct 326
>gb|BG263824.1|BG263824 WHE2338_D11_G22ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2338_D11_G22, mRNA sequence
Length = 533
Score = 115 bits (58), Expect = 8e-024
Identities = 165/198 (83%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 94 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 152
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | || |||||||
Sbjct: 153 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtgaagtacatcga 212
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| |||||||||||||
Sbjct: 213 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacct 272
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 273 cacccaggaggagttcct 290
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 427 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 486
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 487 tgctgggcgttcgtgacggttgcgacgatcgaga 520
>gb|BJ247525.1|BJ247525 BJ247525 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf2j13 5', mRNA sequence
Length = 621
Score = 115 bits (58), Expect = 8e-024
Identities = 97/110 (88%)
Strand = Plus / Plus
Query: 910 gtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtgg 969
|||||||| ||| ||||| |||||||||| ||||||||||||||||||||||||||||||
Sbjct: 477 gtcggctatggcaccgacgcctcctcggggctcaagtactggctcgtcaagaactcgtgg 536
Query: 970 gggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgg 1019
|| |||| ||||||||| ||| ||| | || |||||||||||||||||
Sbjct: 537 ggccagacgtggggcgaggccggctacatccgtatgcgccgcgacgtcgg 586
Score = 58.0 bits (29), Expect = 2e-006
Identities = 71/85 (83%)
Strand = Plus / Plus
Query: 541 atcacgacagggaagctggtgtcgctgtcggagcaggagctgatcgactgcgacccctac 600
|||| ||| |||| ||||||| | |||||||||||| ||||| | ||||||||| |||
Sbjct: 117 atcaagacggggacgctggtgcccctgtcggagcagcagctggtggactgcgacaagtac 176
Query: 601 gacggcggctgcaacctgggctact 625
||||| |||||||||| |||||||
Sbjct: 177 gacggtggctgcaaccgaggctact 201
>gb|BJ253603.1|BJ253603 BJ253603 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf2j13 3', mRNA sequence
Length = 625
Score = 115 bits (58), Expect = 8e-024
Identities = 97/110 (88%)
Strand = Plus / Minus
Query: 910 gtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtgg 969
|||||||| ||| ||||| |||||||||| ||||||||||||||||||||||||||||||
Sbjct: 341 gtcggctatggcaccgacgcctcctcggggctcaagtactggctcgtcaagaactcgtgg 282
Query: 970 gggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgg 1019
|| |||| ||||||||| ||| ||| | || |||||||||||||||||
Sbjct: 281 ggccagacgtggggcgaggccggctacatccgtatgcgccgcgacgtcgg 232
>gb|BJ253868.1|BJ253868 BJ253868 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf3j13 3', mRNA sequence
Length = 290
Score = 115 bits (58), Expect = 8e-024
Identities = 97/110 (88%)
Strand = Plus / Minus
Query: 910 gtcggctacggcgccgactcctcctcgggcctcaagtactggctcgtcaagaactcgtgg 969
|||||||| ||| ||||| |||||||||| ||||||||||||||||||||||||||||||
Sbjct: 180 gtcggctatggcaccgacgcctcctcggggctcaagtactggctcgtcaagaactcgtgg 121
Query: 970 gggcagagctggggcgagcgcggatacctgcggatgcgccgcgacgtcgg 1019
|| |||| ||||||||| ||| ||| | || |||||||||||||||||
Sbjct: 120 ggccagacgtggggcgaggccggctacatccgtatgcgccgcgacgtcgg 71
>gb|BJ247724.1|BJ247724 BJ247724 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf3h11 5', mRNA sequence
Length = 356
Score = 111 bits (56), Expect = 1e-022
Identities = 164/198 (82%), Gaps = 2/198 (1%)
Strand = Plus / Plus
Query: 136 gacaggctgatgatggaccggttcc-tcagctggcaggcgacgtacaaccggtcgtaccc 194
|||| ||||||||||||| |||||| ||| |||||||| ||| |||||||||||||||
Sbjct: 65 gacatgctgatgatggacaggttccgtcaa-tggcaggccacgcacaaccggtcgtacct 123
Query: 195 gacggcggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcga 254
|| ||||||||||||| ||| || |||| |||||||||| |||| | ||| |||||||
Sbjct: 124 gagcgcggaggagaggctgcgtcgcttccgggtgtaccgcgacaacgtggagtacatcga 183
Query: 255 ggccaccaaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacct 314
|||||||||||| ||| |||| || ||| |||||||||||| || |||||||||
Sbjct: 184 cgccaccaaccggcgcggcgacctcacctacgagctcggcgagaatgagnncgccgacct 243
Query: 315 cacggaggaggagttcct 332
||| |||||||||||||
Sbjct: 244 cacccaggaggagttcct 261
>gb|BJ243947.1|BJ243947 BJ243947 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf13i03 5', mRNA sequence
Length = 601
Score = 107 bits (54), Expect = 2e-021
Identities = 114/134 (85%)
Strand = Plus / Plus
Query: 201 ggaggagaggcagcgccggttccaggtgtaccgccgcaacattgagcacatcgaggccac 260
||||||||||| ||| || ||||||||||||||| |||| | ||| |||||||||||||
Sbjct: 2 ggaggagaggctgcgtcgcttccaggtgtaccgcgacaacgtggagtacatcgaggccac 61
Query: 261 caaccgggcgggcaacctgacgtacacgctcggcgagaaccagttcgccgacctcacgga 320
||||||| ||| |||| || ||| |||||||||||| |||||||||||||||| |
Sbjct: 62 caaccggcgcggcgacctcacctacgagctcggcgagaatgagttcgccgacctcaccca 121
Query: 321 ggaggagttcctgg 334
||||||||||||||
Sbjct: 122 ggaggagttcctgg 135
Score = 67.9 bits (34), Expect = 2e-009
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 436 gactggaggtccaagggcgccgtcacgccgatcaagaaccagggcccgtcgtgctctagc 495
|||||||| ||||||||||||||||| ||| ||||| ||| ||| | ||| |||||
Sbjct: 270 gactggagatccaagggcgccgtcacaccggtcaagtcccaaggcgcaggatgcgctagc 329
Query: 496 tgctgggcattcgtgacggcggcgacgatcgaga 529
|||||||| |||||||||| |||||||||||||
Sbjct: 330 tgctgggcgttcgtgacggttgcgacgatcgaga 363
>gb|BJ245696.1|BJ245696 BJ245696 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf1m01 5', mRNA sequence
Length = 354
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Plus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 70 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 129
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 130 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 178
>gb|BJ247784.1|BJ247784 BJ247784 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf3m01 5', mRNA sequence
Length = 312
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Plus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 28 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 87
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 88 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 136
>gb|BJ249710.1|BJ249710 BJ249710 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf12e09 3', mRNA sequence
Length = 539
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Minus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 276 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 217
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 216 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 168
Score = 44.1 bits (22), Expect = 0.026
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 819 ggccatcgagatgggcggcagcctgcagttctacagcggcggcgtcttctcggg 872
|||||||||| | ||| || || ||||||||||||| ||||||||| ||||||
Sbjct: 399 ggccatcgaggtcggcagcggcatgcagttctacaggagcggcgtctactcggg 346
>gb|BJ249922.1|BJ249922 BJ249922 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf14f24 3', mRNA sequence
Length = 692
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Minus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 223 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 164
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 163 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 115
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 491 ctagctgctgggcattcgtgacggcggcgacgatcgaga 529
||||||||||||| |||||||||| |||||||||||||
Sbjct: 677 ctagctgctgggcgttcgtgacggttgcgacgatcgaga 639
Score = 44.1 bits (22), Expect = 0.026
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 819 ggccatcgagatgggcggcagcctgcagttctacagcggcggcgtcttctcggg 872
|||||||||| | ||| || || ||||||||||||| ||||||||| ||||||
Sbjct: 346 ggccatcgaggtcggcagcggcatgcagttctacaggagcggcgtctactcggg 293
>gb|BJ249953.1|BJ249953 BJ249953 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf14i05 3', mRNA sequence
Length = 639
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Minus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 268 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 209
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 208 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 160
Score = 44.1 bits (22), Expect = 0.026
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 819 ggccatcgagatgggcggcagcctgcagttctacagcggcggcgtcttctcggg 872
|||||||||| | ||| || || ||||||||||||| ||||||||| ||||||
Sbjct: 391 ggccatcgaggtcggcagcggcatgcagttctacaggagcggcgtctactcggg 338
>gb|BJ250880.1|BJ250880 BJ250880 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf17j11 3', mRNA sequence
Length = 640
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Minus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 268 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 209
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 208 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 160
Score = 44.1 bits (22), Expect = 0.026
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 819 ggccatcgagatgggcggcagcctgcagttctacagcggcggcgtcttctcggg 872
|||||||||| | ||| || || ||||||||||||| ||||||||| ||||||
Sbjct: 391 ggccatcgaggtcggcagcggcatgcagttctacaggagcggcgtctactcggg 338
>gb|BJ250904.1|BJ250904 BJ250904 Y. Ogihara unpublished cDNA library, Wh_f Triticum aestivum
cDNA clone whf17l07 3', mRNA sequence
Length = 676
Score = 97.6 bits (49), Expect = 2e-018
Identities = 94/109 (86%)
Strand = Plus / Minus
Query: 942 caagtactggctcgtcaagaactcgtgggggcagagctggggcgagcgcggatacctgcg 1001
||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| | ||
Sbjct: 274 caagtactggctcgtcaagaactcgtgggggcagacgtggggtgagagcggctacatccg 215
Query: 1002 gatgcgccgcgacgtcgggcgcgggggactgtgcggcatcgcgctcgac 1050
||||||||||||||||| || || || ||||||||||||||||||
Sbjct: 214 catgcgccgcgacgtcggtggcccagggctctgcggcatcgcgctcgac 166
Score = 44.1 bits (22), Expect = 0.026
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 819 ggccatcgagatgggcggcagcctgcagttctacagcggcggcgtcttctcggg 872
|||||||||| | ||| || || ||||||||||||| ||||||||| ||||||
Sbjct: 397 ggccatcgaggtcggcagcggcatgcagttctacaggagcggcgtctactcggg 344
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 465,599
Number of Sequences: 636343
Number of extensions: 465599
Number of successful extensions: 142037
Number of sequences better than 0.5: 379
Number of HSP's better than 0.5 without gapping: 375
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 140909
Number of HSP's gapped (non-prelim): 1017
length of query: 1393
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1373
effective length of database: 354,513,379
effective search space: 486746869367
effective search space used: 486746869367
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)