BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3203838.2.1
(534 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD899405.1|CD899405 G174.112E14F010824 G174 Triticum aes... 184 4e-045
gb|CD927291.1|CD927291 GR45.101K24F010315 GR45 Triticum aes... 165 4e-039
gb|CD933152.1|CD933152 GR45.120A11R010830 GR45 Triticum aes... 127 8e-028
gb|CD454065.1|CD454065 WHE0966_H06_P12ZT CS wheat pre-anthe... 117 8e-025
gb|CK213093.1|CK213093 FGAS024995 Triticum aestivum FGAS: L... 117 8e-025
gb|AL811162.1|AL811162 AL811162 d:37 Triticum aestivum cDNA... 111 5e-023
gb|CD933096.1|CD933096 GR45.119N23R010831 GR45 Triticum aes... 109 2e-022
gb|BT008979.1| Triticum aestivum clone wdk2c.pk005.k24:fis,... 109 2e-022
gb|BJ247961.1|BJ247961 BJ247961 Y. Ogihara unpublished cDNA... 101 5e-020
gb|BJ254093.1|BJ254093 BJ254093 Y. Ogihara unpublished cDNA... 101 5e-020
gb|BJ310496.1|BJ310496 BJ310496 Y. Ogihara unpublished cDNA... 101 5e-020
gb|BQ620375.1|BQ620375 TaLr1166D05R TaLr1 Triticum aestivum... 101 5e-020
gb|BQ620530.1|BQ620530 TaLr1148C05R TaLr1 Triticum aestivum... 101 5e-020
gb|CK214851.1|CK214851 FGAS026792 Triticum aestivum FGAS: L... 101 5e-020
gb|CK215277.1|CK215277 FGAS027232 Triticum aestivum FGAS: L... 101 5e-020
gb|CD889394.1|CD889394 G118.111M14R010926 G118 Triticum aes... 96 3e-018
gb|CD889857.1|CD889857 G118.113E16R010925 G118 Triticum aes... 94 1e-017
gb|BE471117.1|BE471117 WHE0284_F09_K18ZS Wheat drought-stre... 86 3e-015
gb|CA670433.1|CA670433 wlsu1.pk026.l7 wlsu1 Triticum aestiv... 84 1e-014
gb|CD927552.1|CD927552 GR45.102H22F010316 GR45 Triticum aes... 84 1e-014
gb|BQ903765.1|BQ903765 Ta03_14e09_R Ta03_AAFC_ECORC_Fusariu... 78 7e-013
gb|CD933681.1|CD933681 GR45.121K23R010831 GR45 Triticum aes... 78 7e-013
gb|CD934233.1|CD934233 GR45.123H21F010723 GR45 Triticum aes... 78 7e-013
gb|CA731743.1|CA731743 wlp1c.pk002.a15 wlp1c Triticum aesti... 76 3e-012
gb|BJ310577.1|BJ310577 BJ310577 Y. Ogihara unpublished cDNA... 70 2e-010
gb|CA628424.1|CA628424 wle1n.pk0003.a4 wle1n Triticum aesti... 68 7e-010
gb|BQ903810.1|BQ903810 Ta03_19c03_R Ta03_AAFC_ECORC_Fusariu... 64 1e-008
gb|CA690653.1|CA690653 wlm96.pk051.d14 wlm96 Triticum aesti... 56 3e-006
gb|CA736526.1|CA736526 wpi1s.pk007.k10 wpi1s Triticum aesti... 56 3e-006
gb|CA739730.1|CA739730 wpi2s.pk010.i8 wpi2s Triticum aestiv... 56 3e-006
gb|CA744766.1|CA744766 wri1s.pk009.m21 wri1s Triticum aesti... 56 3e-006
gb|DT948978.1|DT948978 14-1-22 SSH-cDNA Library of stripe r... 56 3e-006
gb|CA725691.1|CA725691 wet1s.pk001.k18 wet1s Triticum aesti... 54 1e-005
gb|CA725877.1|CA725877 wet1s.pk001.i17 wet1s Triticum aesti... 54 1e-005
gb|CA725929.1|CA725929 wet1s.pk001.j22 wet1s Triticum aesti... 54 1e-005
gb|CA735122.1|CA735122 wpi1s.pk003.l21 wpi1s Triticum aesti... 54 1e-005
gb|CA735235.1|CA735235 wpi1s.pk003.j8 wpi1s Triticum aestiv... 54 1e-005
gb|CA735676.1|CA735676 wpi1s.pk004.p24 wpi1s Triticum aesti... 54 1e-005
gb|CA735748.1|CA735748 wpi1s.pk004.h4 wpi1s Triticum aestiv... 54 1e-005
gb|CA735945.1|CA735945 wpi1s.pk005.p20 wpi1s Triticum aesti... 54 1e-005
gb|CA736882.1|CA736882 wpi1s.pk008.j6 wpi1s Triticum aestiv... 54 1e-005
gb|CA737088.1|CA737088 wpi1s.pk009.b17 wpi1s Triticum aesti... 54 1e-005
gb|CA738291.1|CA738291 wpi2s.pk006.b5 wpi2s Triticum aestiv... 54 1e-005
gb|CA738407.1|CA738407 wpi2s.pk006.p18 wpi2s Triticum aesti... 54 1e-005
gb|CA738452.1|CA738452 wpi2s.pk006.j8 wpi2s Triticum aestiv... 54 1e-005
gb|CA738871.1|CA738871 wpi2s.pk008.l4 wpi2s Triticum aestiv... 54 1e-005
gb|CA739079.1|CA739079 wpi2s.pk009.n21 wpi2s Triticum aesti... 54 1e-005
gb|CA739376.1|CA739376 wpi2s.pk007.e13 wpi2s Triticum aesti... 54 1e-005
gb|CA739524.1|CA739524 wpi2s.pk007.b16 wpi2s Triticum aesti... 54 1e-005
gb|CA739661.1|CA739661 wpi2s.pk010.e11 wpi2s Triticum aesti... 54 1e-005
gb|CA739745.1|CA739745 wpi2s.pk010.i20 wpi2s Triticum aesti... 54 1e-005
gb|CA739752.1|CA739752 wpi2s.pk010.k15 wpi2s Triticum aesti... 54 1e-005
gb|CA739817.1|CA739817 wpi2s.pk010.n12 wpi2s Triticum aesti... 54 1e-005
gb|CA739818.1|CA739818 wpi2s.pk010.n14 wpi2s Triticum aesti... 54 1e-005
gb|CA742562.1|CA742562 wri1s.pk001.a6 wri1s Triticum aestiv... 54 1e-005
gb|CA742905.1|CA742905 wri1s.pk004.c20 wri1s Triticum aesti... 54 1e-005
gb|CA743224.1|CA743224 wri1s.pk002.j18 wri1s Triticum aesti... 54 1e-005
gb|CA744604.1|CA744604 wri1s.pk008.b18 wri1s Triticum aesti... 54 1e-005
gb|CA744921.1|CA744921 wri1s.pk009.h15 wri1s Triticum aesti... 54 1e-005
gb|CA744996.1|CA744996 wri1s.pk009.p6 wri1s Triticum aestiv... 54 1e-005
gb|CA745153.1|CA745153 wri1s.pk008.o12 wri1s Triticum aesti... 54 1e-005
gb|CA745662.1|CA745662 wri2s.pk002.a23 wri2s Triticum aesti... 54 1e-005
gb|CA746036.1|CA746036 wri2s.pk003.c10 wri2s Triticum aesti... 54 1e-005
gb|CA746044.1|CA746044 wri2s.pk003.g12 wri2s Triticum aesti... 54 1e-005
gb|CA746589.1|CA746589 wri2s.pk004.k8 wri2s Triticum aestiv... 54 1e-005
gb|CB275421.1|CB275421 WLR15I-15C_ID01 Subtracted wheat lea... 54 1e-005
gb|CB275425.1|CB275425 WLR15I-15C_IDO8 Subtracted wheat lea... 54 1e-005
gb|CD930447.1|CD930447 GR45.111E23F010418 GR45 Triticum aes... 54 1e-005
gb|AJ602523.1|AJ602523 AJ602523 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ602593.1|AJ602593 AJ602593 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ602745.1|AJ602745 AJ602745 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ602832.1|AJ602832 AJ602832 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ602996.1|AJ602996 AJ602996 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ603039.1|AJ603039 AJ603039 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ603069.1|AJ603069 AJ603069 T06 Triticum aestivum cDNA ... 54 1e-005
gb|AJ603387.1|AJ603387 AJ603387 T06 Triticum aestivum cDNA ... 54 1e-005
gb|CV522475.1|CV522475 RP-103 Triticum aestivum subtracted,... 54 1e-005
gb|CV523011.1|CV523011 LP-9 Triticum aestivum subtracted, c... 54 1e-005
gb|CV523137.1|CV523137 LP-232 Triticum aestivum subtracted,... 54 1e-005
gb|DV799619.1|DV799619 05D24 AAFC_CRC Fusarium graminearum ... 54 1e-005
gb|DV799683.1|DV799683 09L13 AAFC_CRC Fusarium graminearum ... 54 1e-005
gb|DV799684.1|DV799684 09M06 AAFC_CRC Fusarium graminearum ... 54 1e-005
gb|DV799706.1|DV799706 11E18 AAFC_CRC Fusarium graminearum ... 54 1e-005
gb|DV799712.1|DV799712 11L21 AAFC_CRC Fusarium graminearum ... 54 1e-005
gb|CA725694.1|CA725694 wet1s.pk001.k22 wet1s Triticum aesti... 52 4e-005
gb|CA725759.1|CA725759 wet1s.pk001.o10 wet1s Triticum aesti... 52 4e-005
gb|CA725769.1|CA725769 wet1s.pk001.g3 wet1s Triticum aestiv... 52 4e-005
gb|CA725867.1|CA725867 wet1s.pk001.l19 wet1s Triticum aesti... 52 4e-005
gb|CA725870.1|CA725870 wet1s.pk001.p5 wet1s Triticum aestiv... 52 4e-005
gb|CA725958.1|CA725958 wet1s.pk001.l7 wet1s Triticum aestiv... 52 4e-005
gb|CA725969.1|CA725969 wet1s.pk001.d8 wet1s Triticum aestiv... 52 4e-005
gb|CA726010.1|CA726010 wet1s.pk002.g13 wet1s Triticum aesti... 52 4e-005
gb|CA726028.1|CA726028 wet1s.pk002.m21 wet1s Triticum aesti... 52 4e-005
gb|CA726273.1|CA726273 wet1s.pk003.a14 wet1s Triticum aesti... 52 4e-005
gb|CA726309.1|CA726309 wet1s.pk002.l14 wet1s Triticum aesti... 52 4e-005
gb|CA726352.1|CA726352 wet1s.pk003.k2 wet1s Triticum aestiv... 52 4e-005
gb|CA726531.1|CA726531 wet1s.pk003.a19 wet1s Triticum aesti... 52 4e-005
gb|CA726538.1|CA726538 wet1s.pk003.n24 wet1s Triticum aesti... 52 4e-005
gb|CA726548.1|CA726548 wet1s.pk003.p20 wet1s Triticum aesti... 52 4e-005
gb|CA726557.1|CA726557 wet1s.pk003.j18 wet1s Triticum aesti... 52 4e-005
gb|CA726574.1|CA726574 wet1s.pk003.l14 wet1s Triticum aesti... 52 4e-005
gb|CA726578.1|CA726578 wet1s.pk003.n12 wet1s Triticum aesti... 52 4e-005
gb|CA734638.1|CA734638 wpi1s.pk001.d5 wpi1s Triticum aestiv... 52 4e-005
gb|CA734844.1|CA734844 wpi1s.pk002.a12 wpi1s Triticum aesti... 52 4e-005
gb|CA735070.1|CA735070 wpi1s.pk003.p19 wpi1s Triticum aesti... 52 4e-005
gb|CA735077.1|CA735077 wpi1s.pk003.h17 wpi1s Triticum aesti... 52 4e-005
gb|CA735115.1|CA735115 wpi1s.pk003.p23 wpi1s Triticum aesti... 52 4e-005
gb|CA735229.1|CA735229 wpi1s.pk003.f18 wpi1s Triticum aesti... 52 4e-005
gb|CA735411.1|CA735411 wpi1s.pk002.b23 wpi1s Triticum aesti... 52 4e-005
gb|CA735450.1|CA735450 wpi1s.pk003.g24 wpi1s Triticum aesti... 52 4e-005
gb|CA735540.1|CA735540 wpi1s.pk002.l1 wpi1s Triticum aestiv... 52 4e-005
gb|CA735623.1|CA735623 wpi1s.pk004.l10 wpi1s Triticum aesti... 52 4e-005
gb|CA735655.1|CA735655 wpi1s.pk005.a11 wpi1s Triticum aesti... 52 4e-005
gb|CA735815.1|CA735815 wpi1s.pk005.d17 wpi1s Triticum aesti... 52 4e-005
gb|CA735870.1|CA735870 wpi1s.pk005.l18 wpi1s Triticum aesti... 52 4e-005
gb|CA735908.1|CA735908 wpi1s.pk005.g16 wpi1s Triticum aesti... 52 4e-005
gb|CA735925.1|CA735925 wpi1s.pk006.g1 wpi1s Triticum aestiv... 52 4e-005
gb|CA735968.1|CA735968 wpi1s.pk006.k5 wpi1s Triticum aestiv... 52 4e-005
gb|CA735973.1|CA735973 wpi1s.pk006.k9 wpi1s Triticum aestiv... 52 4e-005
gb|CA736126.1|CA736126 wpi1s.pk006.a17 wpi1s Triticum aesti... 52 4e-005
gb|CA736141.1|CA736141 wpi1s.pk006.i7 wpi1s Triticum aestiv... 52 4e-005
gb|CA736204.1|CA736204 wpi1s.pk006.h20 wpi1s Triticum aesti... 52 4e-005
gb|CA736213.1|CA736213 wpi1s.pk006.b14 wpi1s Triticum aesti... 52 4e-005
gb|CA736255.1|CA736255 wpi1s.pk006.j8 wpi1s Triticum aestiv... 52 4e-005
gb|CA736293.1|CA736293 wpi1s.pk007.m21 wpi1s Triticum aesti... 52 4e-005
gb|CA736477.1|CA736477 wpi1s.pk007.e18 wpi1s Triticum aesti... 52 4e-005
gb|CA736479.1|CA736479 wpi1s.pk007.i22 wpi1s Triticum aesti... 52 4e-005
gb|CA736568.1|CA736568 wpi1s.pk007.p8 wpi1s Triticum aestiv... 52 4e-005
gb|CA736725.1|CA736725 wpi1s.pk008.k16 wpi1s Triticum aesti... 52 4e-005
gb|CA736744.1|CA736744 wpi1s.pk008.h7 wpi1s Triticum aestiv... 52 4e-005
gb|CA736780.1|CA736780 wpi1s.pk008.j16 wpi1s Triticum aesti... 52 4e-005
gb|CA736796.1|CA736796 wpi1s.pk008.p12 wpi1s Triticum aesti... 52 4e-005
gb|CA736963.1|CA736963 wpi1s.pk009.o22 wpi1s Triticum aesti... 52 4e-005
gb|CA736997.1|CA736997 wpi1s.pk009.e12 wpi1s Triticum aesti... 52 4e-005
gb|CA737028.1|CA737028 wpi1s.pk009.l18 wpi1s Triticum aesti... 52 4e-005
gb|CA737045.1|CA737045 wpi1s.pk009.j6 wpi1s Triticum aestiv... 52 4e-005
gb|CA737126.1|CA737126 wpi1s.pk009.d11 wpi1s Triticum aesti... 52 4e-005
gb|CA737516.1|CA737516 wpi2s.pk004.i9 wpi2s Triticum aestiv... 52 4e-005
gb|CA737529.1|CA737529 wpi2s.pk004.m17 wpi2s Triticum aesti... 52 4e-005
gb|CA737624.1|CA737624 wpi2s.pk004.h23 wpi2s Triticum aesti... 52 4e-005
gb|CA737667.1|CA737667 wpi2s.pk004.k22 wpi2s Triticum aesti... 52 4e-005
gb|CA737680.1|CA737680 wpi2s.pk004.m20 wpi2s Triticum aesti... 52 4e-005
gb|CA737716.1|CA737716 wpi2s.pk004.n23 wpi2s Triticum aesti... 52 4e-005
gb|CA737895.1|CA737895 wpi2s.pk005.k13 wpi2s Triticum aesti... 52 4e-005
gb|CA737925.1|CA737925 wpi2s.pk005.m3 wpi2s Triticum aestiv... 52 4e-005
gb|CA737954.1|CA737954 wpi2s.pk005.l21 wpi2s Triticum aesti... 52 4e-005
gb|CA737964.1|CA737964 wpi2s.pk005.p13 wpi2s Triticum aesti... 52 4e-005
gb|CA738024.1|CA738024 wpi2s.pk002.d22 wpi2s Triticum aesti... 52 4e-005
gb|CA738131.1|CA738131 wpi2s.pk002.h7 wpi2s Triticum aestiv... 52 4e-005
gb|CA738199.1|CA738199 wpi2s.pk002.b22 wpi2s Triticum aesti... 52 4e-005
gb|CA738209.1|CA738209 wpi2s.pk002.j6 wpi2s Triticum aestiv... 52 4e-005
gb|CA738232.1|CA738232 wpi2s.pk006.e4 wpi2s Triticum aestiv... 52 4e-005
gb|CA738397.1|CA738397 wpi2s.pk006.k8 wpi2s Triticum aestiv... 52 4e-005
gb|CA738414.1|CA738414 wpi2s.pk006.j24 wpi2s Triticum aesti... 52 4e-005
gb|CA738472.1|CA738472 wpi2s.pk008.m16 wpi2s Triticum aesti... 52 4e-005
gb|CA738475.1|CA738475 wpi2s.pk008.a6 wpi2s Triticum aestiv... 52 4e-005
gb|CA738487.1|CA738487 wpi2s.pk008.k18 wpi2s Triticum aesti... 52 4e-005
gb|CA738568.1|CA738568 wpi2s.pk006.l6 wpi2s Triticum aestiv... 52 4e-005
gb|CA738694.1|CA738694 wpi2s.pk002.i12 wpi2s Triticum aesti... 52 4e-005
gb|CA738800.1|CA738800 wpi2s.pk008.j21 wpi2s Triticum aesti... 52 4e-005
gb|CA738926.1|CA738926 wpi2s.pk009.i5 wpi2s Triticum aestiv... 52 4e-005
gb|CA738953.1|CA738953 wpi2s.pk008.d16 wpi2s Triticum aesti... 52 4e-005
gb|CA739100.1|CA739100 wpi2s.pk009.d3 wpi2s Triticum aestiv... 52 4e-005
gb|CA739164.1|CA739164 wpi2s.pk009.l22 wpi2s Triticum aesti... 52 4e-005
gb|CA739202.1|CA739202 wpi2s.pk009.p3 wpi2s Triticum aestiv... 52 4e-005
gb|CA739205.1|CA739205 wpi2s.pk009.p7 wpi2s Triticum aestiv... 52 4e-005
gb|CA739221.1|CA739221 wpi2s.pk005.p24 wpi2s Triticum aesti... 52 4e-005
gb|CA739312.1|CA739312 wpi2s.pk007.c1 wpi2s Triticum aestiv... 52 4e-005
gb|CA739349.1|CA739349 wpi2s.pk007.e19 wpi2s Triticum aesti... 52 4e-005
gb|CA739373.1|CA739373 wpi2s.pk007.k10 wpi2s Triticum aesti... 52 4e-005
gb|CA739394.1|CA739394 wpi2s.pk007.g12 wpi2s Triticum aesti... 52 4e-005
gb|CA739450.1|CA739450 wpi2s.pk007.o22 wpi2s Triticum aesti... 52 4e-005
gb|CA739458.1|CA739458 wpi2s.pk007.k24 wpi2s Triticum aesti... 52 4e-005
gb|CA739651.1|CA739651 wpi2s.pk010.c17 wpi2s Triticum aesti... 52 4e-005
gb|CA739658.1|CA739658 wpi2s.pk010.e21 wpi2s Triticum aesti... 52 4e-005
gb|CA739674.1|CA739674 wpi2s.pk010.c10 wpi2s Triticum aesti... 52 4e-005
gb|CA739696.1|CA739696 wpi2s.pk010.o2 wpi2s Triticum aestiv... 52 4e-005
gb|CA739832.1|CA739832 wpi2s.pk010.l10 wpi2s Triticum aesti... 52 4e-005
gb|CA742410.1|CA742410 wri1s.pk001.a15 wri1s Triticum aesti... 52 4e-005
gb|CA742503.1|CA742503 wri1s.pk001.g2 wri1s Triticum aestiv... 52 4e-005
gb|CA742550.1|CA742550 wri1s.pk001.e4 wri1s Triticum aestiv... 52 4e-005
gb|CA742559.1|CA742559 wri1s.pk001.b12 wri1s Triticum aesti... 52 4e-005
gb|CA742665.1|CA742665 wri1s.pk001.h1 wri1s Triticum aestiv... 52 4e-005
gb|CA742759.1|CA742759 wri1s.pk004.b11 wri1s Triticum aesti... 52 4e-005
gb|CA742900.1|CA742900 wri1s.pk004.a17 wri1s Triticum aesti... 52 4e-005
gb|CA743208.1|CA743208 wri1s.pk002.j12 wri1s Triticum aesti... 52 4e-005
gb|CA743260.1|CA743260 wri1s.pk002.a22 wri1s Triticum aesti... 52 4e-005
gb|CA743261.1|CA743261 wri1s.pk002.a24 wri1s Triticum aesti... 52 4e-005
gb|CA743283.1|CA743283 wri1s.pk002.m22 wri1s Triticum aesti... 52 4e-005
gb|CA743426.1|CA743426 wri1s.pk003.i12 wri1s Triticum aesti... 52 4e-005
gb|CA743432.1|CA743432 wri1s.pk003.i16 wri1s Triticum aesti... 52 4e-005
gb|CA743467.1|CA743467 wri1s.pk005.e21 wri1s Triticum aesti... 52 4e-005
gb|CA743497.1|CA743497 wri1s.pk002.d15 wri1s Triticum aesti... 52 4e-005
gb|CA743506.1|CA743506 wri1s.pk002.f9 wri1s Triticum aestiv... 52 4e-005
gb|CA743604.1|CA743604 wri1s.pk002.l15 wri1s Triticum aesti... 52 4e-005
gb|CA743651.1|CA743651 wri1s.pk005.o8 wri1s Triticum aestiv... 52 4e-005
gb|CA743676.1|CA743676 wri1s.pk005.e22 wri1s Triticum aesti... 52 4e-005
gb|CA743754.1|CA743754 wri1s.pk005.f15 wri1s Triticum aesti... 52 4e-005
gb|CA743779.1|CA743779 wri1s.pk005.a6 wri1s Triticum aestiv... 52 4e-005
gb|CA743904.1|CA743904 wri1s.pk006.i5 wri1s Triticum aestiv... 52 4e-005
gb|CA743942.1|CA743942 wri1s.pk006.a7 wri1s Triticum aestiv... 52 4e-005
gb|CA743950.1|CA743950 wri1s.pk006.m15 wri1s Triticum aesti... 52 4e-005
gb|CA743988.1|CA743988 wri1s.pk006.o10 wri1s Triticum aesti... 52 4e-005
gb|CA743994.1|CA743994 wri1s.pk006.g13 wri1s Triticum aesti... 52 4e-005
gb|CA744122.1|CA744122 wri1s.pk006.n5 wri1s Triticum aestiv... 52 4e-005
gb|CA744160.1|CA744160 wri1s.pk006.f12 wri1s Triticum aesti... 52 4e-005
gb|CA744377.1|CA744377 wri1s.pk007.i12 wri1s Triticum aesti... 52 4e-005
gb|CA744438.1|CA744438 wri1s.pk007.n3 wri1s Triticum aestiv... 52 4e-005
gb|CA744562.1|CA744562 wri1s.pk008.h21 wri1s Triticum aesti... 52 4e-005
gb|CA744579.1|CA744579 wri1s.pk008.p11 wri1s Triticum aesti... 52 4e-005
gb|CA744623.1|CA744623 wri1s.pk008.b8 wri1s Triticum aestiv... 52 4e-005
gb|CA744638.1|CA744638 wri1s.pk008.n10 wri1s Triticum aesti... 52 4e-005
gb|CA744654.1|CA744654 wri1s.pk008.h14 wri1s Triticum aesti... 52 4e-005
gb|CA744678.1|CA744678 wri1s.pk009.k5 wri1s Triticum aestiv... 52 4e-005
gb|CA744710.1|CA744710 wri1s.pk009.i15 wri1s Triticum aesti... 52 4e-005
gb|CA744752.1|CA744752 wri1s.pk009.d23 wri1s Triticum aesti... 52 4e-005
gb|CA744833.1|CA744833 wri1s.pk009.k16 wri1s Triticum aesti... 52 4e-005
gb|CA744847.1|CA744847 wri1s.pk009.g10 wri1s Triticum aesti... 52 4e-005
gb|CA744853.1|CA744853 wri1s.pk009.h9 wri1s Triticum aestiv... 52 4e-005
gb|CA745146.1|CA745146 wri1s.pk008.m21 wri1s Triticum aesti... 52 4e-005
gb|CA745249.1|CA745249 wri1s.pk003.f10 wri1s Triticum aesti... 52 4e-005
gb|CA745319.1|CA745319 wri1s.pk003.m23 wri1s Triticum aesti... 52 4e-005
gb|CA745325.1|CA745325 wri1s.pk003.g23 wri1s Triticum aesti... 52 4e-005
gb|CA745472.1|CA745472 wri2s.pk001.f21 wri2s Triticum aesti... 52 4e-005
gb|CA745474.1|CA745474 wri2s.pk001.h5 wri2s Triticum aestiv... 52 4e-005
gb|CA745606.1|CA745606 wri2s.pk002.i15 wri2s Triticum aesti... 52 4e-005
gb|CA745629.1|CA745629 wri2s.pk002.g13 wri2s Triticum aesti... 52 4e-005
gb|CA745717.1|CA745717 wri2s.pk002.l9 wri2s Triticum aestiv... 52 4e-005
gb|CA745795.1|CA745795 wri2s.pk002.d7 wri2s Triticum aestiv... 52 4e-005
gb|CA745882.1|CA745882 wri2s.pk003.b21 wri2s Triticum aesti... 52 4e-005
gb|CA745887.1|CA745887 wri2s.pk003.l21 wri2s Triticum aesti... 52 4e-005
gb|CA745980.1|CA745980 wri2s.pk003.c21 wri2s Triticum aesti... 52 4e-005
gb|CA746060.1|CA746060 wri2s.pk003.o10 wri2s Triticum aesti... 52 4e-005
gb|CA746122.1|CA746122 wri2s.pk005.g19 wri2s Triticum aesti... 52 4e-005
gb|CA746379.1|CA746379 wri2s.pk005.l6 wri2s Triticum aestiv... 52 4e-005
gb|CA746454.1|CA746454 wri2s.pk007.a20 wri2s Triticum aesti... 52 4e-005
gb|CA746618.1|CA746618 wri2s.pk004.e6 wri2s Triticum aestiv... 52 4e-005
gb|CA746620.1|CA746620 wri2s.pk004.e14 wri2s Triticum aesti... 52 4e-005
gb|CA746628.1|CA746628 wri2s.pk004.i7 wri2s Triticum aestiv... 52 4e-005
gb|CA746729.1|CA746729 wri2s.pk004.j14 wri2s Triticum aesti... 52 4e-005
gb|CA746752.1|CA746752 wri2s.pk004.p18 wri2s Triticum aesti... 52 4e-005
gb|CA746974.1|CA746974 wri2s.pk006.b12 wri2s Triticum aesti... 52 4e-005
gb|CA746977.1|CA746977 wri2s.pk006.b11 wri2s Triticum aesti... 52 4e-005
gb|CA747056.1|CA747056 wri2s.pk007.b19 wri2s Triticum aesti... 52 4e-005
gb|CA747145.1|CA747145 wri2s.pk007.h2 wri2s Triticum aestiv... 52 4e-005
gb|CA747256.1|CA747256 wri2s.pk008.n3.f wri2s Triticum aest... 52 4e-005
gb|CA747306.1|CA747306 wri2s.pk008.k18.f wri2s Triticum aes... 52 4e-005
gb|CA747337.1|CA747337 wri2s.pk008.f5.f wri2s Triticum aest... 52 4e-005
gb|CA747345.1|CA747345 wri2s.pk008.n20.f wri2s Triticum aes... 52 4e-005
gb|CB275426.1|CB275426 WLR15I-15C_ID09 Subtracted wheat lea... 52 4e-005
gb|AJ602461.1|AJ602461 AJ602461 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602470.1|AJ602470 AJ602470 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602473.1|AJ602473 AJ602473 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602482.1|AJ602482 AJ602482 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602517.1|AJ602517 AJ602517 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602557.1|AJ602557 AJ602557 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602599.1|AJ602599 AJ602599 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602602.1|AJ602602 AJ602602 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602662.1|AJ602662 AJ602662 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602664.1|AJ602664 AJ602664 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602674.1|AJ602674 AJ602674 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602676.1|AJ602676 AJ602676 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602702.1|AJ602702 AJ602702 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602763.1|AJ602763 AJ602763 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602821.1|AJ602821 AJ602821 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602863.1|AJ602863 AJ602863 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602881.1|AJ602881 AJ602881 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602886.1|AJ602886 AJ602886 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602898.1|AJ602898 AJ602898 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602909.1|AJ602909 AJ602909 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602934.1|AJ602934 AJ602934 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602960.1|AJ602960 AJ602960 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ602963.1|AJ602963 AJ602963 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603018.1|AJ603018 AJ603018 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603023.1|AJ603023 AJ603023 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603028.1|AJ603028 AJ603028 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603060.1|AJ603060 AJ603060 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603086.1|AJ603086 AJ603086 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603112.1|AJ603112 AJ603112 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603119.1|AJ603119 AJ603119 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603160.1|AJ603160 AJ603160 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603178.1|AJ603178 AJ603178 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603195.1|AJ603195 AJ603195 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603233.1|AJ603233 AJ603233 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603236.1|AJ603236 AJ603236 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603237.1|AJ603237 AJ603237 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603245.1|AJ603245 AJ603245 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603265.1|AJ603265 AJ603265 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603283.1|AJ603283 AJ603283 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603285.1|AJ603285 AJ603285 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603312.1|AJ603312 AJ603312 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603377.1|AJ603377 AJ603377 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603384.1|AJ603384 AJ603384 T06 Triticum aestivum cDNA ... 52 4e-005
gb|AJ603414.1|AJ603414 AJ603414 T06 Triticum aestivum cDNA ... 52 4e-005
gb|CF569151.1|CF569151 EST012 Subtracted, Clontech (cat. # ... 52 4e-005
gb|CF569209.1|CF569209 EST070 Subtracted, Clontech (cat. # ... 52 4e-005
gb|CV523154.1|CV523154 LP-251 Triticum aestivum subtracted,... 52 4e-005
gb|DV799635.1|DV799635 06H04 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799657.1|DV799657 07J21 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799682.1|DV799682 09E23 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799696.1|DV799696 10K04 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799701.1|DV799701 11B02 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799703.1|DV799703 11B21 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799721.1|DV799721 12E11 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799742.1|DV799742 14P09 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DV799754.1|DV799754 15M14 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|DW986534.1|DW986534 01G21 AAFC_CRC Fusarium graminearum ... 52 4e-005
gb|BI750410.1|BI750410 Ta01_08a04_R Ta01_AAFC_ECORC_Fusariu... 50 2e-004
gb|CA667229.1|CA667229 wlsu1.pk0011.d5 wlsu1 Triticum aesti... 50 2e-004
gb|CA667547.1|CA667547 wlsu1.pk017.k7 wlsu1 Triticum aestiv... 50 2e-004
gb|CA668067.1|CA668067 wlsu1.pk017.n22 wlsu1 Triticum aesti... 50 2e-004
gb|CA668147.1|CA668147 wlsu1.pk018.n22 wlsu1 Triticum aesti... 50 2e-004
gb|CA668387.1|CA668387 wlsu1.pk019.j4 wlsu1 Triticum aestiv... 50 2e-004
gb|CA668688.1|CA668688 wlsu1.pk021.j17 wlsu1 Triticum aesti... 50 2e-004
gb|CA668954.1|CA668954 wlsu1.pk023.c10 wlsu1 Triticum aesti... 50 2e-004
gb|CA668970.1|CA668970 wlsu1.pk023.a10 wlsu1 Triticum aesti... 50 2e-004
gb|CA669470.1|CA669470 wlsu1.pk022.e4 wlsu1 Triticum aestiv... 50 2e-004
gb|CA669697.1|CA669697 wlsu1.pk022.b8 wlsu1 Triticum aestiv... 50 2e-004
gb|CA672963.1|CA672963 wlsu2.pk019.f9 wlsu2 Triticum aestiv... 50 2e-004
gb|CA673259.1|CA673259 wlsu2.pk021.c3 wlsu2 Triticum aestiv... 50 2e-004
gb|CA673332.1|CA673332 wlsu2.pk021.h16 wlsu2 Triticum aesti... 50 2e-004
gb|CA673430.1|CA673430 wlsu2.pk022.c15 wlsu2 Triticum aesti... 50 2e-004
gb|CA673633.1|CA673633 wlsu2.pk021.p1 wlsu2 Triticum aestiv... 50 2e-004
gb|CA675558.1|CA675558 wlsu2.pk027.n10 wlsu2 Triticum aesti... 50 2e-004
gb|CA725683.1|CA725683 wet1s.pk001.g2 wet1s Triticum aestiv... 50 2e-004
gb|CA725686.1|CA725686 wet1s.pk001.g20 wet1s Triticum aesti... 50 2e-004
gb|CA725690.1|CA725690 wet1s.pk001.k2 wet1s Triticum aestiv... 50 2e-004
gb|CA725706.1|CA725706 wet1s.pk001.e20 wet1s Triticum aesti... 50 2e-004
gb|CA725712.1|CA725712 wet1s.pk001.i24 wet1s Triticum aesti... 50 2e-004
gb|CA725721.1|CA725721 wet1s.pk001.a18 wet1s Triticum aesti... 50 2e-004
gb|CA725723.1|CA725723 wet1s.pk001.a22 wet1s Triticum aesti... 50 2e-004
gb|CA725729.1|CA725729 wet1s.pk001.o4 wet1s Triticum aestiv... 50 2e-004
gb|CA725732.1|CA725732 wet1s.pk001.a4 wet1s Triticum aestiv... 50 2e-004
gb|CA725740.1|CA725740 wet1s.pk001.m10 wet1s Triticum aesti... 50 2e-004
gb|CA725750.1|CA725750 wet1s.pk001.i14 wet1s Triticum aesti... 50 2e-004
gb|CA725756.1|CA725756 wet1s.pk001.e10 wet1s Triticum aesti... 50 2e-004
gb|CA725764.1|CA725764 wet1s.pk001.c15 wet1s Triticum aesti... 50 2e-004
gb|CA725768.1|CA725768 wet1s.pk001.g23 wet1s Triticum aesti... 50 2e-004
gb|CA725774.1|CA725774 wet1s.pk001.k21 wet1s Triticum aesti... 50 2e-004
gb|CA725784.1|CA725784 wet1s.pk001.e3 wet1s Triticum aestiv... 50 2e-004
gb|CA725789.1|CA725789 wet1s.pk001.i3 wet1s Triticum aestiv... 50 2e-004
gb|CA725792.1|CA725792 wet1s.pk001.i23 wet1s Triticum aesti... 50 2e-004
gb|CA725800.1|CA725800 wet1s.pk001.a19 wet1s Triticum aesti... 50 2e-004
gb|CA725801.1|CA725801 wet1s.pk001.a21 wet1s Triticum aesti... 50 2e-004
gb|CA725811.1|CA725811 wet1s.pk001.o5 wet1s Triticum aestiv... 50 2e-004
gb|CA725813.1|CA725813 wet1s.pk001.p11 wet1s Triticum aesti... 50 2e-004
gb|CA725814.1|CA725814 wet1s.pk001.p13 wet1s Triticum aesti... 50 2e-004
gb|CA725829.1|CA725829 wet1s.pk001.f21 wet1s Triticum aesti... 50 2e-004
gb|CA725838.1|CA725838 wet1s.pk001.i9 wet1s Triticum aestiv... 50 2e-004
gb|CA725842.1|CA725842 wet1s.pk001.p17 wet1s Triticum aesti... 50 2e-004
gb|CA725843.1|CA725843 wet1s.pk001.p19 wet1s Triticum aesti... 50 2e-004
gb|CA725858.1|CA725858 wet1s.pk001.f7 wet1s Triticum aestiv... 50 2e-004
gb|CA725861.1|CA725861 wet1s.pk001.j9 wet1s Triticum aestiv... 50 2e-004
gb|CA725875.1|CA725875 wet1s.pk001.g9 wet1s Triticum aestiv... 50 2e-004
gb|CA725876.1|CA725876 wet1s.pk001.h13 wet1s Triticum aesti... 50 2e-004
gb|CA725906.1|CA725906 wet1s.pk001.p14 wet1s Triticum aesti... 50 2e-004
gb|CA725914.1|CA725914 wet1s.pk001.f12 wet1s Triticum aesti... 50 2e-004
gb|CA725921.1|CA725921 wet1s.pk001.n14 wet1s Triticum aesti... 50 2e-004
gb|CA725923.1|CA725923 wet1s.pk001.j10 wet1s Triticum aesti... 50 2e-004
gb|CA725927.1|CA725927 wet1s.pk001.j18 wet1s Triticum aesti... 50 2e-004
gb|CA725930.1|CA725930 wet1s.pk001.j21 wet1s Triticum aesti... 50 2e-004
gb|CA725931.1|CA725931 wet1s.pk001.j2 wet1s Triticum aestiv... 50 2e-004
gb|CA725948.1|CA725948 wet1s.pk001.f23 wet1s Triticum aesti... 50 2e-004
gb|CA725950.1|CA725950 wet1s.pk001.j6 wet1s Triticum aestiv... 50 2e-004
gb|CA725953.1|CA725953 wet1s.pk001.j23 wet1s Triticum aesti... 50 2e-004
gb|CA725962.1|CA725962 wet1s.pk001.l8 wet1s Triticum aestiv... 50 2e-004
gb|CA725984.1|CA725984 wet1s.pk001.h2 wet1s Triticum aestiv... 50 2e-004
gb|CA725988.1|CA725988 wet1s.pk001.h8 wet1s Triticum aestiv... 50 2e-004
gb|CA726000.1|CA726000 wet1s.pk002.a15 wet1s Triticum aesti... 50 2e-004
gb|CA726004.1|CA726004 wet1s.pk002.c17 wet1s Triticum aesti... 50 2e-004
gb|CA726015.1|CA726015 wet1s.pk002.k13 wet1s Triticum aesti... 50 2e-004
gb|CA726035.1|CA726035 wet1s.pk002.m5 wet1s Triticum aestiv... 50 2e-004
gb|CA726040.1|CA726040 wet1s.pk002.g23 wet1s Triticum aesti... 50 2e-004
gb|CA726042.1|CA726042 wet1s.pk002.g5 wet1s Triticum aestiv... 50 2e-004
gb|CA726044.1|CA726044 wet1s.pk002.g9 wet1s Triticum aestiv... 50 2e-004
gb|CA726046.1|CA726046 wet1s.pk002.g1 wet1s Triticum aestiv... 50 2e-004
gb|CA726051.1|CA726051 wet1s.pk002.o9 wet1s Triticum aestiv... 50 2e-004
gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aesti... 50 2e-004
gb|CA726070.1|CA726070 wet1s.pk002.c23 wet1s Triticum aesti... 50 2e-004
gb|CA726075.1|CA726075 wet1s.pk002.e1 wet1s Triticum aestiv... 50 2e-004
gb|CA726082.1|CA726082 wet1s.pk002.a12 wet1s Triticum aesti... 50 2e-004
gb|CA726083.1|CA726083 wet1s.pk002.a14 wet1s Triticum aesti... 50 2e-004
gb|CA726086.1|CA726086 wet1s.pk002.c20 wet1s Triticum aesti... 50 2e-004
gb|CA726092.1|CA726092 wet1s.pk002.k18 wet1s Triticum aesti... 50 2e-004
gb|CA726107.1|CA726107 wet1s.pk002.g12 wet1s Triticum aesti... 50 2e-004
gb|CA726130.1|CA726130 wet1s.pk002.a4 wet1s Triticum aestiv... 50 2e-004
gb|CA726131.1|CA726131 wet1s.pk002.m20 wet1s Triticum aesti... 50 2e-004
gb|CA726154.1|CA726154 wet1s.pk002.i6 wet1s Triticum aestiv... 50 2e-004
gb|CA726156.1|CA726156 wet1s.pk002.c6 wet1s Triticum aestiv... 50 2e-004
gb|CA726162.1|CA726162 wet1s.pk002.b19 wet1s Triticum aesti... 50 2e-004
gb|CA726171.1|CA726171 wet1s.pk002.f9 wet1s Triticum aestiv... 50 2e-004
gb|CA726172.1|CA726172 wet1s.pk002.h11 wet1s Triticum aesti... 50 2e-004
gb|CA726174.1|CA726174 wet1s.pk002.h15 wet1s Triticum aesti... 50 2e-004
gb|CA726197.1|CA726197 wet1s.pk002.h9 wet1s Triticum aestiv... 50 2e-004
gb|CA726207.1|CA726207 wet1s.pk002.n19 wet1s Triticum aesti... 50 2e-004
gb|CA726218.1|CA726218 wet1s.pk002.d21 wet1s Triticum aesti... 50 2e-004
gb|CA726222.1|CA726222 wet1s.pk002.d7 wet1s Triticum aestiv... 50 2e-004
gb|CA726225.1|CA726225 wet1s.pk002.l17 wet1s Triticum aesti... 50 2e-004
gb|CA726227.1|CA726227 wet1s.pk002.l21 wet1s Triticum aesti... 50 2e-004
gb|CA726228.1|CA726228 wet1s.pk002.l23 wet1s Triticum aesti... 50 2e-004
gb|CA726234.1|CA726234 wet1s.pk002.b10 wet1s Triticum aesti... 50 2e-004
gb|CA726245.1|CA726245 wet1s.pk002.f8 wet1s Triticum aestiv... 50 2e-004
gb|CA726247.1|CA726247 wet1s.pk002.h18 wet1s Triticum aesti... 50 2e-004
gb|CA726253.1|CA726253 wet1s.pk002.h8 wet1s Triticum aestiv... 50 2e-004
gb|CA726256.1|CA726256 wet1s.pk002.h24 wet1s Triticum aesti... 50 2e-004
gb|CA726272.1|CA726272 wet1s.pk003.a12 wet1s Triticum aesti... 50 2e-004
gb|CA726278.1|CA726278 wet1s.pk002.n24 wet1s Triticum aesti... 50 2e-004
gb|CA726291.1|CA726291 wet1s.pk002.j2 wet1s Triticum aestiv... 50 2e-004
gb|CA726297.1|CA726297 wet1s.pk002.j24 wet1s Triticum aesti... 50 2e-004
gb|CA726306.1|CA726306 wet1s.pk002.d8 wet1s Triticum aestiv... 50 2e-004
gb|CA726308.1|CA726308 wet1s.pk002.l12 wet1s Triticum aesti... 50 2e-004
gb|CA726310.1|CA726310 wet1s.pk002.l16 wet1s Triticum aesti... 50 2e-004
gb|CA726311.1|CA726311 wet1s.pk002.l18 wet1s Triticum aesti... 50 2e-004
gb|CA726328.1|CA726328 wet1s.pk003.a8 wet1s Triticum aestiv... 50 2e-004
gb|CA726331.1|CA726331 wet1s.pk003.g20 wet1s Triticum aesti... 50 2e-004
gb|CA726340.1|CA726340 wet1s.pk003.a20 wet1s Triticum aesti... 50 2e-004
gb|CA726347.1|CA726347 wet1s.pk003.o10 wet1s Triticum aesti... 50 2e-004
gb|CA726350.1|CA726350 wet1s.pk003.k14 wet1s Triticum aesti... 50 2e-004
gb|CA726354.1|CA726354 wet1s.pk003.i24 wet1s Triticum aesti... 50 2e-004
gb|CA726357.1|CA726357 wet1s.pk003.i18 wet1s Triticum aesti... 50 2e-004
gb|CA726373.1|CA726373 wet1s.pk003.m22 wet1s Triticum aesti... 50 2e-004
gb|CA726374.1|CA726374 wet1s.pk003.m24 wet1s Triticum aesti... 50 2e-004
gb|CA726381.1|CA726381 wet1s.pk003.m14 wet1s Triticum aesti... 50 2e-004
gb|CA726398.1|CA726398 wet1s.pk003.f7 wet1s Triticum aestiv... 50 2e-004
gb|CA726401.1|CA726401 wet1s.pk003.b21 wet1s Triticum aesti... 50 2e-004
gb|CA726425.1|CA726425 wet1s.pk003.l21 wet1s Triticum aesti... 50 2e-004
gb|CA726426.1|CA726426 wet1s.pk003.p2 wet1s Triticum aestiv... 50 2e-004
gb|CA726433.1|CA726433 wet1s.pk003.p23 wet1s Triticum aesti... 50 2e-004
gb|CA726434.1|CA726434 wet1s.pk003.j1 wet1s Triticum aestiv... 50 2e-004
gb|CA726437.1|CA726437 wet1s.pk003.l11 wet1s Triticum aesti... 50 2e-004
gb|CA726452.1|CA726452 wet1s.pk003.l9 wet1s Triticum aestiv... 50 2e-004
gb|CA726459.1|CA726459 wet1s.pk003.j19 wet1s Triticum aesti... 50 2e-004
gb|CA726484.1|CA726484 wet1s.pk003.d13 wet1s Triticum aesti... 50 2e-004
gb|CA726490.1|CA726490 wet1s.pk003.d4 wet1s Triticum aestiv... 50 2e-004
gb|CA726499.1|CA726499 wet1s.pk003.e7 wet1s Triticum aestiv... 50 2e-004
gb|CA726515.1|CA726515 wet1s.pk003.g11 wet1s Triticum aesti... 50 2e-004
gb|CA726518.1|CA726518 wet1s.pk003.b20 wet1s Triticum aesti... 50 2e-004
gb|CA726519.1|CA726519 wet1s.pk003.b22 wet1s Triticum aesti... 50 2e-004
gb|CA726535.1|CA726535 wet1s.pk003.c19 wet1s Triticum aesti... 50 2e-004
gb|CA726536.1|CA726536 wet1s.pk003.c21 wet1s Triticum aesti... 50 2e-004
gb|CA726544.1|CA726544 wet1s.pk003.l18 wet1s Triticum aesti... 50 2e-004
gb|CA726562.1|CA726562 wet1s.pk003.i17 wet1s Triticum aesti... 50 2e-004
gb|CA726565.1|CA726565 wet1s.pk003.o15 wet1s Triticum aesti... 50 2e-004
gb|CA726573.1|CA726573 wet1s.pk003.l12 wet1s Triticum aesti... 50 2e-004
gb|CA726575.1|CA726575 wet1s.pk003.k7 wet1s Triticum aestiv... 50 2e-004
gb|CA726576.1|CA726576 wet1s.pk003.k21 wet1s Triticum aesti... 50 2e-004
gb|CA726600.1|CA726600 wet1s.pk003.g9 wet1s Triticum aestiv... 50 2e-004
gb|CA734778.1|CA734778 wpi1s.pk002.i3 wpi1s Triticum aestiv... 50 2e-004
gb|CA734858.1|CA734858 wpi1s.pk002.i4 wpi1s Triticum aestiv... 50 2e-004
gb|CA734862.1|CA734862 wpi1s.pk002.o14 wpi1s Triticum aesti... 50 2e-004
gb|CA734865.1|CA734865 wpi1s.pk002.e16 wpi1s Triticum aesti... 50 2e-004
gb|CA734866.1|CA734866 wpi1s.pk002.e18 wpi1s Triticum aesti... 50 2e-004
gb|CA734869.1|CA734869 wpi1s.pk002.g14 wpi1s Triticum aesti... 50 2e-004
gb|CA734873.1|CA734873 wpi1s.pk002.k16 wpi1s Triticum aesti... 50 2e-004
gb|CA734875.1|CA734875 wpi1s.pk002.k20 wpi1s Triticum aesti... 50 2e-004
gb|CA734876.1|CA734876 wpi1s.pk002.k22 wpi1s Triticum aesti... 50 2e-004
gb|CA734881.1|CA734881 wpi1s.pk002.m16 wpi1s Triticum aesti... 50 2e-004
gb|CA734883.1|CA734883 wpi1s.pk002.m18 wpi1s Triticum aesti... 50 2e-004
gb|CA734890.1|CA734890 wpi1s.pk002.g12 wpi1s Triticum aesti... 50 2e-004
gb|CA734893.1|CA734893 wpi1s.pk002.a8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734896.1|CA734896 wpi1s.pk002.g24 wpi1s Triticum aesti... 50 2e-004
gb|CA734899.1|CA734899 wpi1s.pk002.m8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734916.1|CA734916 wpi1s.pk002.e14 wpi1s Triticum aesti... 50 2e-004
gb|CA734917.1|CA734917 wpi1s.pk002.n10 wpi1s Triticum aesti... 50 2e-004
gb|CA734922.1|CA734922 wpi1s.pk002.h18 wpi1s Triticum aesti... 50 2e-004
gb|CA734926.1|CA734926 wpi1s.pk002.n6 wpi1s Triticum aestiv... 50 2e-004
gb|CA734930.1|CA734930 wpi1s.pk002.b16 wpi1s Triticum aesti... 50 2e-004
gb|CA734931.1|CA734931 wpi1s.pk002.p10 wpi1s Triticum aesti... 50 2e-004
gb|CA734932.1|CA734932 wpi1s.pk002.p12 wpi1s Triticum aesti... 50 2e-004
gb|CA734950.1|CA734950 wpi1s.pk002.n4 wpi1s Triticum aestiv... 50 2e-004
gb|CA734959.1|CA734959 wpi1s.pk003.h5 wpi1s Triticum aestiv... 50 2e-004
gb|CA734962.1|CA734962 wpi1s.pk003.h8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734967.1|CA734967 wpi1s.pk003.a13 wpi1s Triticum aesti... 50 2e-004
gb|CA734969.1|CA734969 wpi1s.pk003.a19 wpi1s Triticum aesti... 50 2e-004
gb|CA734975.1|CA734975 wpi1s.pk003.o3 wpi1s Triticum aestiv... 50 2e-004
gb|CA734980.1|CA734980 wpi1s.pk003.h15 wpi1s Triticum aesti... 50 2e-004
gb|CA734983.1|CA734983 wpi1s.pk002.p2 wpi1s Triticum aestiv... 50 2e-004
gb|CA734989.1|CA734989 wpi1s.pk002.f20 wpi1s Triticum aesti... 50 2e-004
gb|CA734990.1|CA734990 wpi1s.pk002.f24 wpi1s Triticum aesti... 50 2e-004
gb|CA734995.1|CA734995 wpi1s.pk002.p8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734998.1|CA734998 wpi1s.pk003.j10 wpi1s Triticum aesti... 50 2e-004
gb|CA734999.1|CA734999 wpi1s.pk003.j15 wpi1s Triticum aesti... 50 2e-004
gb|CA735001.1|CA735001 wpi1s.pk003.j17 wpi1s Triticum aesti... 50 2e-004
gb|CA735006.1|CA735006 wpi1s.pk003.j13 wpi1s Triticum aesti... 50 2e-004
gb|CA735012.1|CA735012 wpi1s.pk003.m5 wpi1s Triticum aestiv... 50 2e-004
gb|CA735015.1|CA735015 wpi1s.pk003.n1 wpi1s Triticum aestiv... 50 2e-004
gb|CA735019.1|CA735019 wpi1s.pk003.f11 wpi1s Triticum aesti... 50 2e-004
gb|CA735020.1|CA735020 wpi1s.pk003.f13 wpi1s Triticum aesti... 50 2e-004
gb|CA735021.1|CA735021 wpi1s.pk003.f15 wpi1s Triticum aesti... 50 2e-004
gb|CA735023.1|CA735023 wpi1s.pk003.e3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735024.1|CA735024 wpi1s.pk003.e23 wpi1s Triticum aesti... 50 2e-004
gb|CA735028.1|CA735028 wpi1s.pk003.e9 wpi1s Triticum aestiv... 50 2e-004
gb|CA735029.1|CA735029 wpi1s.pk003.a3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735031.1|CA735031 wpi1s.pk003.b13 wpi1s Triticum aesti... 50 2e-004
gb|CA735061.1|CA735061 wpi1s.pk003.l15 wpi1s Triticum aesti... 50 2e-004
gb|CA735085.1|CA735085 wpi1s.pk003.j9 wpi1s Triticum aestiv... 50 2e-004
gb|CA735093.1|CA735093 wpi1s.pk003.n9 wpi1s Triticum aestiv... 50 2e-004
gb|CA735097.1|CA735097 wpi1s.pk003.n5 wpi1s Triticum aestiv... 50 2e-004
gb|CA735098.1|CA735098 wpi1s.pk003.d8 wpi1s Triticum aestiv... 50 2e-004
gb|CA735101.1|CA735101 wpi1s.pk003.e11 wpi1s Triticum aesti... 50 2e-004
>gb|CD899405.1|CD899405 G174.112E14F010824 G174 Triticum aestivum cDNA clone G174112E14,
mRNA sequence
Length = 485
Score = 184 bits (93), Expect = 4e-045
Identities = 186/217 (85%)
Strand = Plus / Minus
Query: 197 ccggcgagctccctagtgatgccgcgttgagggtgttgccgatgtcgatgacgaagcggt 256
||||||||||||||||| | |||| |||||||||||||||| |||||||||||||||||
Sbjct: 296 ccggcgagctccctagtcaatccgccttgagggtgttgccgacgtcgatgacgaagcggt 237
Query: 257 acctgacctcgcccttggcgaggcgttccatggcctcattaacttcttcggtgccgatca 316
||||||| ||||||||||| ||||| ||||||||| | || || || ||| ||||||||
Sbjct: 236 acctgacgtcgcccttggccaggcgctccatggccgcgttcacctccccggcgccgatca 177
Query: 317 gttcgatgtccgctgtcaacccgtgcttggctgcgaagtccatcatctcctgcgtgtccc 376
|||| |||||| | || || |||| ||| |||||||| | |||||||||||| || |
Sbjct: 176 cctcgacgtccgccgccacgccatgctcggcggcgaagtctagcatctcctgcgtctcgc 117
Query: 377 tgatgctccccatgcagctcccggccagagtcttgcc 413
|||||||| |||||||||||||||| |||||||||||
Sbjct: 116 tgatgctcgccatgcagctcccggcaagagtcttgcc 80
>gb|CD927291.1|CD927291 GR45.101K24F010315 GR45 Triticum aestivum cDNA clone GR45101K24,
mRNA sequence
Length = 516
Score = 165 bits (83), Expect = 4e-039
Identities = 187/219 (85%), Gaps = 2/219 (0%)
Strand = Plus / Minus
Query: 197 ccggcgagctccctagtgatgccgcgttgagggtgttgccgatgtcgatgacgaagcggt 256
||||||||||||||||| | |||| |||||||||||||||| |||||||||||||||||
Sbjct: 280 ccggcgagctccctagtcaatccgccttgagggtgttgccgacgtcgatgacgaagcggt 221
Query: 257 acctgacctcgcccttggcgaggcgttccatggcctcattaacttcttcggtgccgatca 316
||||||| ||||||||||| ||||| ||||||||| | || || || ||| ||||||||
Sbjct: 220 acctgacgtcgcccttggccaggcgctccatggccgcgttcacctccccggcgccgatca 161
Query: 317 gttcgatgtccgctgtca-acccgtgctt-ggctgcgaagtccatcatctcctgcgtgtc 374
|||| |||||| | || || ||||| ||| |||||||| | |||||||||||| ||
Sbjct: 160 cctcgacgtccgccgccacgcctatgcttcggcggcgaagtctagcatctcctgcgtctc 101
Query: 375 cctgatgctccccatgcagctcccggccagagtcttgcc 413
||||||||| |||||||||||||||| |||||||||||
Sbjct: 100 gctgatgctcgccatgcagctcccggcaagagtcttgcc 62
>gb|CD933152.1|CD933152 GR45.120A11R010830 GR45 Triticum aestivum cDNA clone GR45120A11,
mRNA sequence
Length = 560
Score = 127 bits (64), Expect = 8e-028
Identities = 183/220 (83%), Gaps = 2/220 (0%)
Strand = Plus / Plus
Query: 182 gctacagagctgggaccggcgagctccctagtgatgccgcgttgagggtgttgccgatgt 241
|||||||||| | ||||||||||| | ||||| | |||| | |||||||||||||| ||
Sbjct: 181 gctacagagcagagaccggcgagcgctctagtcaatccgcct-gagggtgttgccgacgt 239
Query: 242 cgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatggcctcattaactt 301
|||||||||||||||||||||| | ||||| ||| ||||| ||||| ||| | || || |
Sbjct: 240 cgatgacgaagcggtacctgacgtagccct-ggccaggcgctccattgccgcgttcacct 298
Query: 302 cttcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggctgcgaagtccatca 361
| ||| |||||||| ||||| |||||| | || ||| ||| ||| |||||||| | ||
Sbjct: 299 ccccggcgccgatcacttcgacgtccgccgccacgccgggctcggcggcgaagtctagca 358
Query: 362 tctcctgcgtgtccctgatgctccccatgcagctcccggc 401
|||||||||| || ||||||||| ||||||||||||||||
Sbjct: 359 tctcctgcgtctcgctgatgctcgccatgcagctcccggc 398
>gb|CD454065.1|CD454065 WHE0966_H06_P12ZT CS wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0966_H06_P12, mRNA sequence
Length = 720
Score = 117 bits (59), Expect = 8e-025
Identities = 155/187 (82%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 176 gagggtgttgccgatgtcgatgacgaaccgatacctgacgtcggccttggcaaggcgctc 235
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | |||| |||||||| |||||||| || |||| || |||||
Sbjct: 236 catggccgtgttcacgtactcggcgccgatcacctcgatgtctgccgtcacaccatgctt 295
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
|| |||| ||||| ||||||||| |||||||| |||| || ||| |||||||||||||
Sbjct: 296 cgccgcgaggtccagcatctcctgggtgtccctcatgccgccgatgaagctcccggccag 355
Query: 405 agtcttg 411
||||||
Sbjct: 356 ggtcttg 362
>gb|CK213093.1|CK213093 FGAS024995 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1040
Score = 117 bits (59), Expect = 8e-025
Identities = 155/187 (82%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 349 gagggtgttgccgatgtcgatgacgaatcgatacctgacatcggccttggcaaggcgctc 408
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | |||| |||||||| ||||||||||| |||| ||||||
Sbjct: 409 catggccgtgttcacgtactcggcgccgatcacctcgatgtccgccgtcacgttgtgctt 468
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || ||| ||||||||||||
Sbjct: 469 ggccgcgaggtccagcatctcctgggtgtccctcatgcctccaatgaggctcccggccag 528
Query: 405 agtcttg 411
||||||
Sbjct: 529 ggtcttg 535
>gb|AL811162.1|AL811162 AL811162 d:37 Triticum aestivum cDNA clone G04_d37_plate_1, mRNA
sequence
Length = 564
Score = 111 bits (56), Expect = 5e-023
Identities = 154/187 (82%)
Strand = Plus / Minus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||| | |||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 456 gagggtgtnggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctc 397
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | || | |||||||| |||||||| || |||| ||||||||
Sbjct: 396 catggccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacgccgtgctt 337
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||| | ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 336 ggccgcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 277
Query: 405 agtcttg 411
||||||
Sbjct: 276 ggtcttg 270
>gb|CD933096.1|CD933096 GR45.119N23R010831 GR45 Triticum aestivum cDNA clone GR45119N23,
mRNA sequence
Length = 602
Score = 109 bits (55), Expect = 2e-022
Identities = 154/187 (82%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 232 gagggtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctc 291
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | || | |||||||| |||||||| || |||| ||||||||
Sbjct: 292 catggccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacgccgtgctt 351
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
|| |||| ||||| ||||||||| |||||||| |||| || ||||||||||| |||||
Sbjct: 352 cgccgcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctccccgccag 411
Query: 405 agtcttg 411
||||||
Sbjct: 412 ggtcttg 418
>gb|BT008979.1| Triticum aestivum clone wdk2c.pk005.k24:fis, full insert mRNA
sequence
Length = 1418
Score = 109 bits (55), Expect = 2e-022
Identities = 154/187 (82%)
Strand = Plus / Minus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 1189 gagggtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctc 1130
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | || | |||||||| |||||||| || |||| ||||||||
Sbjct: 1129 catggccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacgccgtgctt 1070
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
|| |||| ||||| ||||||||| |||||||| |||| || ||||||||||| |||||
Sbjct: 1069 cgccgcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctccccgccag 1010
Query: 405 agtcttg 411
||||||
Sbjct: 1009 ggtcttg 1003
>gb|BJ247961.1|BJ247961 BJ247961 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4g06 5', mRNA sequence
Length = 544
Score = 101 bits (51), Expect = 5e-020
Identities = 150/183 (81%)
Strand = Plus / Minus
Query: 229 gtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatg 288
|||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||||||
Sbjct: 536 gtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctccatg 477
Query: 289 gcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggct 348
||| || || | || | |||||||| |||||||| || |||| |||||||| ||
Sbjct: 476 gccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacaccgtgcttcgcc 417
Query: 349 gcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccagagtc 408
|||| ||| | ||||||||| |||||||| |||| || ||||||||||||||||| |||
Sbjct: 416 gcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccagggtc 357
Query: 409 ttg 411
|||
Sbjct: 356 ttg 354
>gb|BJ254093.1|BJ254093 BJ254093 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4g06 3', mRNA sequence
Length = 682
Score = 101 bits (51), Expect = 5e-020
Identities = 150/183 (81%)
Strand = Plus / Plus
Query: 229 gtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatg 288
|||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||||||
Sbjct: 141 gtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctccatg 200
Query: 289 gcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggct 348
||| || || | || | |||||||| |||||||| || |||| |||||||| ||
Sbjct: 201 gccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacaccgtgcttcgcc 260
Query: 349 gcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccagagtc 408
|||| ||| | ||||||||| |||||||| |||| || ||||||||||||||||| |||
Sbjct: 261 gcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccagggtc 320
Query: 409 ttg 411
|||
Sbjct: 321 ttg 323
>gb|BJ310496.1|BJ310496 BJ310496 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd7i10 3', mRNA sequence
Length = 645
Score = 101 bits (51), Expect = 5e-020
Identities = 150/183 (81%)
Strand = Plus / Plus
Query: 229 gtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatg 288
|||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||||||
Sbjct: 176 gtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctccatg 235
Query: 289 gcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggct 348
||| || || | || | |||||||| |||||||| || |||| |||||||| ||
Sbjct: 236 gccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacaccgtgcttcgcc 295
Query: 349 gcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccagagtc 408
|||| ||| | ||||||||| |||||||| |||| || ||||||||||||||||| |||
Sbjct: 296 gcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccagggtc 355
Query: 409 ttg 411
|||
Sbjct: 356 ttg 358
>gb|BQ620375.1|BQ620375 TaLr1166D05R TaLr1 Triticum aestivum cDNA clone TaLr1166D05R, mRNA
sequence
Length = 585
Score = 101 bits (51), Expect = 5e-020
Identities = 153/187 (81%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || ||||| || || ||||||| ||||| ||
Sbjct: 195 gagggtgttgccgatgtcgatgacgaatcgatacctcacgtcagccttggcaaggcgctc 254
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
|||||| || || | |||| ||| |||| ||| |||||||| |||| | |||||
Sbjct: 255 catggcggtgttcacgtactcggcgccaatcacttcaatgtccgccgtcacgtcatgctt 314
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 315 ggcggcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 374
Query: 405 agtcttg 411
||||||
Sbjct: 375 ggtcttg 381
>gb|BQ620530.1|BQ620530 TaLr1148C05R TaLr1 Triticum aestivum cDNA clone TaLr1148C05R, mRNA
sequence
Length = 585
Score = 101 bits (51), Expect = 5e-020
Identities = 153/187 (81%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || ||||| || || ||||||| ||||| ||
Sbjct: 195 gagggtgttgccgatgtcgatgacgaatcgatacctcacgtcagccttggcaaggcgctc 254
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
|||||| || || | |||| ||| |||| ||| |||||||| |||| | |||||
Sbjct: 255 catggcggtgttcacgtactcggcgccaatcacttcaatgtccgccgtcacgtcatgctt 314
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 315 ggcggcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 374
Query: 405 agtcttg 411
||||||
Sbjct: 375 ggtcttg 381
>gb|CK214851.1|CK214851 FGAS026792 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1116
Score = 101 bits (51), Expect = 5e-020
Identities = 153/187 (81%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || ||||| || || ||||||| ||||| ||
Sbjct: 205 gagggtgttgccgatgtcgatgacgaatcgatacctcacgtcagccttggcaaggcgctc 264
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
|||||| || || | |||| ||| |||| ||| |||||||| |||| | |||||
Sbjct: 265 catggcggtgttcacgtactcggcgccaatcacttcaatgtccgccgtcacgtcatgctt 324
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 325 ggcggcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 384
Query: 405 agtcttg 411
||||||
Sbjct: 385 ggtcttg 391
>gb|CK215277.1|CK215277 FGAS027232 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 742
Score = 101 bits (51), Expect = 5e-020
Identities = 153/187 (81%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || ||||| || || ||||||| ||||| ||
Sbjct: 206 gagggtgttgccgatgtcgatgacgaatcgatacctcacgtcagccttggcaaggcgctc 265
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
|||||| || || | |||| ||| |||| ||| |||||||| |||| | |||||
Sbjct: 266 catggcggtgttcacgtactcggcgccaatcacttcaatgtccgccgtcacgtcatgctt 325
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 326 ggcggcgaggtccagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 385
Query: 405 agtcttg 411
||||||
Sbjct: 386 ggtcttg 392
>gb|CD889394.1|CD889394 G118.111M14R010926 G118 Triticum aestivum cDNA clone G118111M14,
mRNA sequence
Length = 711
Score = 95.6 bits (48), Expect = 3e-018
Identities = 148/180 (82%), Gaps = 1/180 (0%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||| |||||||||||||||| || |||||||| ||| ||| ||| ||||| ||
Sbjct: 10 gagggtgttggcgatgtcgatgacgaatcgatacctgacgtcggcct-ggcaaggcgctc 68
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | || | |||||||| |||||||| || |||| ||||||||
Sbjct: 69 catggccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacgccgtgctt 128
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||| | ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 129 ggccgcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 188
>gb|CD889857.1|CD889857 G118.113E16R010925 G118 Triticum aestivum cDNA clone G118113E16,
mRNA sequence
Length = 694
Score = 93.7 bits (47), Expect = 1e-017
Identities = 153/187 (81%), Gaps = 1/187 (0%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||| |||||||||||||||| || |||||||| ||| ||| ||| ||||| ||
Sbjct: 10 gagggtgttggcgatgtcgatgacgaatcgatacctgacgtcggcct-ggcaaggcgctc 68
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
||||||| || || | || | ||||| || |||||||| || |||| ||||||||
Sbjct: 69 catggccgtgttcacgtactccgcgccgagcacctcgatgtctgccgtcacgccgtgctt 128
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||| | ||||||||| |||||||| |||| || |||||||||||||||||
Sbjct: 129 ggccgcgaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggccag 188
Query: 405 agtcttg 411
||||||
Sbjct: 189 ggtcttg 195
>gb|BE471117.1|BE471117 WHE0284_F09_K18ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0284_F09_K18, mRNA
sequence
Length = 547
Score = 85.7 bits (43), Expect = 3e-015
Identities = 136/167 (81%)
Strand = Plus / Minus
Query: 340 tgcttggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccg 399
|||| ||| |||||||| | |||||||||||| || ||||||||| ||||||||||||||
Sbjct: 509 tgctcggcggcgaagtctagcatctcctgcgtctcgctgatgctcgccatgcagctcccg 450
Query: 400 gccagagtcttgcccccagtaaccaaagagaaggcagagatctgcagaggcttctcaggc 459
|| ||||||||||| || | | || ||| || |||| ||||| ||||| || ||
Sbjct: 449 gcaagagtcttgccgccgccgatgagagcgaatgcggagacttgcaggggcttatcgggg 390
Query: 460 aggccaagcaggatcatcttgccctggggcttgaggagagcaaggta 506
| ||| ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 389 atgccgagcaggatcatcttgccgtggggtttgaggagcgccaggta 343
>gb|CA670433.1|CA670433 wlsu1.pk026.l7 wlsu1 Triticum aestivum cDNA clone wlsu1.pk026.l7 5'
end, mRNA sequence
Length = 450
Score = 83.8 bits (42), Expect = 1e-014
Identities = 93/110 (84%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||||||||||||||||| || || |||||||| || ||||||| ||||| ||
Sbjct: 232 gagggtgttgccgatgtcgatgacaaatcgatacctgacatcagccttggcaaggcgctc 291
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtca 334
||||||| || || | ||||||||||||| |||||||||||| ||||
Sbjct: 292 catggccgtgttcacgtactcggtgccgatcacttcgatgtccgccgtca 341
>gb|CD927552.1|CD927552 GR45.102H22F010316 GR45 Triticum aestivum cDNA clone GR45102H22,
mRNA sequence
Length = 277
Score = 83.8 bits (42), Expect = 1e-014
Identities = 63/70 (90%)
Strand = Plus / Minus
Query: 344 tggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggcca 403
|||| ||| |||||| |||||||||||| || ||||||||| |||||||||||||||| |
Sbjct: 79 tggcggcggagtccagcatctcctgcgtctcgctgatgctcgccatgcagctcccggcaa 20
Query: 404 gagtcttgcc 413
||||||||||
Sbjct: 19 gagtcttgcc 10
>gb|BQ903765.1|BQ903765 Ta03_14e09_R
Ta03_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta03_14e09, mRNA
sequence
Length = 276
Score = 77.8 bits (39), Expect = 7e-013
Identities = 60/67 (89%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||
Sbjct: 200 gagggtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctc 259
Query: 285 catggcc 291
|||||||
Sbjct: 260 catggcc 266
>gb|CD933681.1|CD933681 GR45.121K23R010831 GR45 Triticum aestivum cDNA clone GR45121K23,
mRNA sequence
Length = 481
Score = 77.8 bits (39), Expect = 7e-013
Identities = 140/174 (80%)
Strand = Plus / Plus
Query: 229 gtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatg 288
|||||| |||||||||||||||| || |||||||| ||| ||||||| ||| | ||||||
Sbjct: 308 gtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggggctccatg 367
Query: 289 gcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggct 348
||| || || | || | |||||||| |||||||| || |||| |||||||| ||
Sbjct: 368 gccgtgttcacgtactccgcgccgatcacctcgatgtctgccgtcacaccgtgcttcgcc 427
Query: 349 gcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggcc 402
| || ||| | ||||||||| |||||||| |||| || |||||||||||||||
Sbjct: 428 gngaggtctagcatctcctgggtgtccctcatgccgccgatgcagctcccggcc 481
>gb|CD934233.1|CD934233 GR45.123H21F010723 GR45 Triticum aestivum cDNA clone GR45123H21,
mRNA sequence
Length = 606
Score = 77.8 bits (39), Expect = 7e-013
Identities = 87/103 (84%)
Strand = Plus / Minus
Query: 309 gccgatcagttcgatgtccgctgtcaacccgtgcttggctgcgaagtccatcatctcctg 368
|||||||| |||||||| || |||| ||||||||||| |||| ||| | |||||||||
Sbjct: 559 gccgatcacctcgatgtctgccgtcacgccgtgcttggccgcgaggtctagcatctcctg 500
Query: 369 cgtgtccctgatgctccccatgcagctcccggccagagtcttg 411
|||||||| |||| || ||||||||||||||||| ||||||
Sbjct: 499 ggtgtccctcatgccgccgatgcagctcccggccagggtcttg 457
>gb|CA731743.1|CA731743 wlp1c.pk002.a15 wlp1c Triticum aestivum cDNA clone wlp1c.pk002.a15
5' end, mRNA sequence
Length = 505
Score = 75.8 bits (38), Expect = 3e-012
Identities = 149/187 (79%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||| |||| || || ||||| || || ||||||| ||||| ||
Sbjct: 182 gagggtgttgccgatgtcgntgacaaatcgatacctcacgtcagccttggcaaggcgctc 241
Query: 285 catggcctcattaacttcttcggtgccgatcagttcgatgtccgctgtcaacccgtgctt 344
|||||| || || | |||| ||| |||| ||| |||||||| |||| | |||||
Sbjct: 242 catggcggtgttcacgtactcggcgccaatcacttcaatgtccgccgtcacgtcatgctt 301
Query: 345 ggctgcgaagtccatcatctcctgcgtgtccctgatgctccccatgcagctcccggccag 404
||| |||| ||||| ||||||||| |||||||| |||| || |||| |||||||||||
Sbjct: 302 ggcggcgaggtccaacatctcctgggtgtccctcatgccgccgatgcnnctcccggccag 361
Query: 405 agtcttg 411
||||||
Sbjct: 362 ggtcttg 368
>gb|BJ310577.1|BJ310577 BJ310577 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd7o09 3', mRNA sequence
Length = 302
Score = 69.9 bits (35), Expect = 2e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 229 gtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttccatg 288
|||||| |||||||||||||||| || |||||||| ||| ||||||| ||||| ||||||
Sbjct: 157 gtgttggcgatgtcgatgacgaatcgatacctgacgtcggccttggcaaggcgctccatg 216
Query: 289 gcc 291
|||
Sbjct: 217 gcc 219
>gb|CA628424.1|CA628424 wle1n.pk0003.a4 wle1n Triticum aestivum cDNA clone wle1n.pk0003.a4
5' end, mRNA sequence
Length = 254
Score = 67.9 bits (34), Expect = 7e-010
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
||||||||||||||||||||||||||| || ||||| || || ||||||| ||||| ||
Sbjct: 75 gagggtgttgccgatgtcgatgacgaatcgatacctcacgtcagccttggcaaggcgctc 16
Query: 285 catggc 290
||||||
Sbjct: 15 catggc 10
>gb|BQ903810.1|BQ903810 Ta03_19c03_R
Ta03_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta03_19c03, mRNA
sequence
Length = 464
Score = 63.9 bits (32), Expect = 1e-008
Identities = 89/108 (82%)
Strand = Plus / Plus
Query: 304 tcggtgccgatcagttcgatgtccgctgtcaacccgtgcttggctgcgaagtccatcatc 363
|||| |||||||| |||||||| || |||| || ||||| || |||| ||||| ||||
Sbjct: 3 tcggcgccgatcacctcgatgtctgccgtcacaccatgcttcgccgcgaggtccagcatc 62
Query: 364 tcctgcgtgtccctgatgctccccatgcagctcccggccagagtcttg 411
||||| |||||||| |||| || ||| ||||||||||||| ||||||
Sbjct: 63 tcctgggtgtccctcatgccgccgatgaagctcccggccagggtcttg 110
>gb|CA690653.1|CA690653 wlm96.pk051.d14 wlm96 Triticum aestivum cDNA clone wlm96.pk051.d14
5' end, mRNA sequence
Length = 459
Score = 56.0 bits (28), Expect = 3e-006
Identities = 57/67 (85%)
Strand = Plus / Plus
Query: 225 gagggtgttgccgatgtcgatgacgaagcggtacctgacctcgcccttggcgaggcgttc 284
|||||||||||||||||||||||| || || ||||| || ||| |||||| ||||| ||
Sbjct: 182 gagggtgttgccgatgtcgatgacaaatcgatacctcacgtcggccttggnaaggcgctc 241
Query: 285 catggcc 291
|| ||||
Sbjct: 242 caaggcc 248
>gb|CA736526.1|CA736526 wpi1s.pk007.k10 wpi1s Triticum aestivum cDNA clone wpi1s.pk007.k10
5' end, mRNA sequence
Length = 298
Score = 56.0 bits (28), Expect = 3e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 507 agcgtacctgcccgggcggccgctcgaa 534
||||||||||||||||||||||||||||
Sbjct: 271 agcgtacctgcccgggcggccgctcgaa 298
>gb|CA739730.1|CA739730 wpi2s.pk010.i8 wpi2s Triticum aestivum cDNA clone wpi2s.pk010.i8 5'
end, mRNA sequence
Length = 234
Score = 56.0 bits (28), Expect = 3e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 507 agcgtacctgcccgggcggccgctcgaa 534
||||||||||||||||||||||||||||
Sbjct: 207 agcgtacctgcccgggcggccgctcgaa 234
>gb|CA744766.1|CA744766 wri1s.pk009.m21 wri1s Triticum aestivum cDNA clone wri1s.pk009.m21
5' end, mRNA sequence
Length = 177
Score = 56.0 bits (28), Expect = 3e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 507 agcgtacctgcccgggcggccgctcgaa 534
||||||||||||||||||||||||||||
Sbjct: 28 agcgtacctgcccgggcggccgctcgaa 1
>gb|DT948978.1|DT948978 14-1-22 SSH-cDNA Library of stripe rust infection in leaves of
stripe rust resistant material R175 compared with no
infection Triticum aestivum cDNA clone 14-1-22, mRNA
sequence
Length = 352
Score = 56.0 bits (28), Expect = 3e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 507 agcgtacctgcccgggcggccgctcgaa 534
||||||||||||||||||||||||||||
Sbjct: 295 agcgtacctgcccgggcggccgctcgaa 322
>gb|CA725691.1|CA725691 wet1s.pk001.k18 wet1s Triticum aestivum cDNA clone wet1s.pk001.k18
5' end, mRNA sequence
Length = 286
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 260 gcgtacctgcccgggcggccgctcgaa 286
>gb|CA725877.1|CA725877 wet1s.pk001.i17 wet1s Triticum aestivum cDNA clone wet1s.pk001.i17
5' end, mRNA sequence
Length = 385
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 359 gcgtacctgcccgggcggccgctcgaa 385
>gb|CA725929.1|CA725929 wet1s.pk001.j22 wet1s Triticum aestivum cDNA clone wet1s.pk001.j22
5' end, mRNA sequence
Length = 246
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 507 agcgtacctgcccgggcggccgctcga 533
|||||||||||||||||||||||||||
Sbjct: 220 agcgtacctgcccgggcggccgctcga 246
>gb|CA735122.1|CA735122 wpi1s.pk003.l21 wpi1s Triticum aestivum cDNA clone wpi1s.pk003.l21
5' end, mRNA sequence
Length = 437
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 411 gcgtacctgcccgggcggccgctcgaa 437
>gb|CA735235.1|CA735235 wpi1s.pk003.j8 wpi1s Triticum aestivum cDNA clone wpi1s.pk003.j8 5'
end, mRNA sequence
Length = 437
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 411 gcgtacctgcccgggcggccgctcgaa 437
>gb|CA735676.1|CA735676 wpi1s.pk004.p24 wpi1s Triticum aestivum cDNA clone wpi1s.pk004.p24
5' end, mRNA sequence
Length = 519
Score = 54.0 bits (27), Expect = 1e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 500 caaggtaagcgtacctgcccgggcggccgctcgaa 534
|||| |||| |||||||||||||||||||||||||
Sbjct: 485 caagttaagtgtacctgcccgggcggccgctcgaa 519
>gb|CA735748.1|CA735748 wpi1s.pk004.h4 wpi1s Triticum aestivum cDNA clone wpi1s.pk004.h4 5'
end, mRNA sequence
Length = 270
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 244 gcgtacctgcccgggcggccgctcgaa 270
>gb|CA735945.1|CA735945 wpi1s.pk005.p20 wpi1s Triticum aestivum cDNA clone wpi1s.pk005.p20
5' end, mRNA sequence
Length = 338
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 312 gcgtacctgcccgggcggccgctcgaa 338
>gb|CA736882.1|CA736882 wpi1s.pk008.j6 wpi1s Triticum aestivum cDNA clone wpi1s.pk008.j6 5'
end, mRNA sequence
Length = 228
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 202 gcgtacctgcccgggcggccgctcgaa 228
>gb|CA737088.1|CA737088 wpi1s.pk009.b17 wpi1s Triticum aestivum cDNA clone wpi1s.pk009.b17
5' end, mRNA sequence
Length = 241
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 215 gcgtacctgcccgggcggccgctcgaa 241
>gb|CA738291.1|CA738291 wpi2s.pk006.b5 wpi2s Triticum aestivum cDNA clone wpi2s.pk006.b5 5'
end, mRNA sequence
Length = 394
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 359 gcgtacctgcccgggcggccgctcgaa 385
>gb|CA738407.1|CA738407 wpi2s.pk006.p18 wpi2s Triticum aestivum cDNA clone wpi2s.pk006.p18
5' end, mRNA sequence
Length = 167
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 141 gcgtacctgcccgggcggccgctcgaa 167
>gb|CA738452.1|CA738452 wpi2s.pk006.j8 wpi2s Triticum aestivum cDNA clone wpi2s.pk006.j8 5'
end, mRNA sequence
Length = 241
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 212 gcgtacctgcccgggcggccgctcgaa 238
>gb|CA738871.1|CA738871 wpi2s.pk008.l4 wpi2s Triticum aestivum cDNA clone wpi2s.pk008.l4 5'
end, mRNA sequence
Length = 385
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 359 gcgtacctgcccgggcggccgctcgaa 385
>gb|CA739079.1|CA739079 wpi2s.pk009.n21 wpi2s Triticum aestivum cDNA clone wpi2s.pk009.n21
5' end, mRNA sequence
Length = 220
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 194 gcgtacctgcccgggcggccgctcgaa 220
>gb|CA739376.1|CA739376 wpi2s.pk007.e13 wpi2s Triticum aestivum cDNA clone wpi2s.pk007.e13
5' end, mRNA sequence
Length = 200
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 174 gcgtacctgcccgggcggccgctcgaa 200
>gb|CA739524.1|CA739524 wpi2s.pk007.b16 wpi2s Triticum aestivum cDNA clone wpi2s.pk007.b16
5' end, mRNA sequence
Length = 385
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 359 gcgtacctgcccgggcggccgctcgaa 385
>gb|CA739661.1|CA739661 wpi2s.pk010.e11 wpi2s Triticum aestivum cDNA clone wpi2s.pk010.e11
5' end, mRNA sequence
Length = 251
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 508 gcgtacctgcccgggcggccgctcgaa 534
|||||||||||||||||||||||||||
Sbjct: 225 gcgtacctgcccgggcggccgctcgaa 251
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 136,474
Number of Sequences: 636343
Number of extensions: 136474
Number of successful extensions: 57467
Number of sequences better than 0.5: 13967
Number of HSP's better than 0.5 without gapping: 13967
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42933
Number of HSP's gapped (non-prelim): 14530
length of query: 534
length of database: 367,240,239
effective HSP length: 19
effective length of query: 515
effective length of database: 355,149,722
effective search space: 182902106830
effective search space used: 182902106830
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)