BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067516.2.1
(605 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ300151.1|BJ300151 BJ300151 Y. Ogihara unpublished cDNA... 190 8e-047
gb|CZ889026.1|CZ889026 ftaa002d005b06t0 Bread wheat methyla... 105 3e-021
>gb|BJ300151.1|BJ300151 BJ300151 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
aestivum cDNA clone whsl17l22 3', mRNA sequence
Length = 694
Score = 190 bits (96), Expect = 8e-047
Identities = 286/349 (81%), Gaps = 9/349 (2%)
Strand = Plus / Plus
Query: 232 ttttccaagaattcttggcagcttctgcagatgaaccactagaatctccacctttatctt 291
||||||||||||||||||| ||||| || |||||| || ||||||| |||| || ||||
Sbjct: 297 ttttccaagaattcttggccgcttcagctgatgaattaccagaatctgcacccttgtctt 356
Query: 292 taggctt------cgagaagaatggatcccatttgtgaggtccaattgcctgctgtccat 345
| ||||| |||||||||||||||||| | |||||||||| || | ||||||| |
Sbjct: 357 tgggcttgggcttcgagaagaatggatcccactcatgaggtccaactgtccgctgtcctt 416
Query: 346 cgtctaacagactatacttccagctattctcttcgataaaatctttgtcttcttggcctg 405
| |||||| ||||||||||||||||||||| ||||||||||| ||||| ||| |
Sbjct: 417 c---taacagttcatacttccagctattctcttcaataaaatctttatcttcgctgccag 473
Query: 406 cgatgatatctcttctcaactttgtcactttgttaatgatcgcctctatggaaacatcaa 465
|||||||||||||||||| | |||||||||||| ||||| ||| | ||||||||||
Sbjct: 474 agatgatatctcttctcaattgtgtcactttgttgatgattgccgaaaccgaaacatcaa 533
Query: 466 atgcatctttcaatgtctccagtttcgatcttggatcggcatatatcacctttggtatca 525
| || || || | || ||||||||||| |||||||| |||||||||||||||||||| |
Sbjct: 534 acgcgtcctttagcgtttccagtttcgaccttggatcagcatatatcacctttggtatga 593
Query: 526 gattgatgacctcctctctcatttgcttgaccacatctgggtgaatact 574
|||| || ||||| |||||||| |||||||| || ||||| || |||||
Sbjct: 594 gatttataacctcttctctcatctgcttgacaacgtctggatggatact 642
>gb|CZ889026.1|CZ889026 ftaa002d005b06t0 Bread wheat methylation filtered library (LibID:
111) Triticum aestivum genomic, DNA sequence
Length = 531
Score = 105 bits (53), Expect = 3e-021
Identities = 197/245 (80%)
Strand = Plus / Minus
Query: 219 cctctctgttcacttttccaagaattcttggcagcttctgcagatgaaccactagaatct 278
||||| ||||| ||||||| || ||||||||||| | | ||||| | | ||| ||||
Sbjct: 246 cctctttgttcgtttttccaggagttcttggcagcattagtagatggattagtagcatct 187
Query: 279 ccacctttatctttaggcttcgagaagaatggatcccatttgtgaggtccaattgcctgc 338
||||| || || || ||||| |||||||| || ||||||| ||||| ||||||| | |
Sbjct: 186 ccacccttgtccttgggcttagagaagaacgggtcccattcatgaggcccaattgtcctc 127
Query: 339 tgtccatcgtctaacagactatacttccagctattctcttcgataaaatctttgtcttct 398
|| || || || |||||| ||||||||||||||||||||| | ||||||||| |||||
Sbjct: 126 tgcccttcttccaacagatcatacttccagctattctcttcaacaaaatctttatcttca 67
Query: 399 tggcctgcgatgatatctcttctcaactttgtcactttgttaatgatcgcctctatggaa 458
|| || ||||||||||||||||||||| || ||| |||||||| || |||||| |||
Sbjct: 66 tgatcttcgatgatatctcttctcaactgtgacaccttgttaattattacctctacagaa 7
Query: 459 acatc 463
|||||
Sbjct: 6 acatc 2
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 116,720
Number of Sequences: 636343
Number of extensions: 116720
Number of successful extensions: 35422
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35414
Number of HSP's gapped (non-prelim): 6
length of query: 605
length of database: 367,240,239
effective HSP length: 19
effective length of query: 586
effective length of database: 355,149,722
effective search space: 208117737092
effective search space used: 208117737092
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)