BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067450.2.1
(724 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CK205087.1|CK205087 FGAS013624 Triticum aestivum FGAS: L... 98 1e-018
gb|AL826125.1|AL826125 AL826125 p:436 Triticum aestivum cDN... 94 2e-017
gb|CK204735.1|CK204735 FGAS013271 Triticum aestivum FGAS: L... 94 2e-017
gb|BE404218.1|BE404218 WHE1203_F02_L03ZS Wheat etiolated se... 82 6e-014
gb|CA734489.1|CA734489 wpi1s.pk001.e17 wpi1s Triticum aesti... 68 9e-010
gb|BQ578376.1|BQ578376 WHE0302_B09_C18ZS Wheat unstressed s... 66 4e-009
gb|BE406468.1|BE406468 WHE0416_g08_n16zB Wheat etiolated se... 50 2e-004
gb|BQ801256.1|BQ801256 WHE2812_B08_D16ZS Triticum monococcu... 50 2e-004
gb|CD934893.1|CD934893 OV.002E03R010412 OV Triticum aestivu... 50 2e-004
gb|CD939689.1|CD939689 OV.114J05F010312 OV Triticum aestivu... 50 2e-004
gb|CB307508.1|CB307508 HFIG493 Hessian fly infested cDNA li... 48 8e-004
gb|BJ284733.1|BJ284733 BJ284733 Y. Ogihara unpublished cDNA... 46 0.003
gb|BU100113.1|BU100113 WHE3315_C12_F23ZS Chinese Spring whe... 46 0.003
gb|CA691512.1|CA691512 wlm96.pk053.j18 wlm96 Triticum aesti... 46 0.003
gb|CK162825.1|CK162825 FGAS015425 Triticum aestivum FGAS: L... 46 0.003
gb|CK206856.1|CK206856 FGAS018467 Triticum aestivum FGAS: L... 46 0.003
gb|BQ903121.1|BQ903121 Ta03_10a02_R Ta03_AAFC_ECORC_Fusariu... 44 0.013
gb|CA641387.1|CA641387 wre1n.pk0045.e8 wre1n Triticum aesti... 44 0.013
gb|BJ257333.1|BJ257333 BJ257333 Y. Ogihara unpublished cDNA... 42 0.052
gb|BJ262917.1|BJ262917 BJ262917 Y. Ogihara unpublished cDNA... 42 0.052
gb|CD866826.1|CD866826 AZO2.104I16R010327 AZO2 Triticum aes... 42 0.052
gb|CD880941.1|CD880941 F1.100G13F010315 F1 Triticum aestivu... 42 0.052
gb|CD893199.1|CD893199 G118.123C05R011115 G118 Triticum aes... 42 0.052
gb|CK205898.1|CK205898 FGAS017454 Triticum aestivum FGAS: L... 42 0.052
gb|CV769800.1|CV769800 FGAS064192 Triticum aestivum FGAS: L... 42 0.052
gb|BE606863.1|BE606863 WHE0902_A02_A04ZS Wheat 5-15 DAP spi... 40 0.21
gb|BG314252.1|BG314252 WHE2461_B07_D13ZS Triticum monococcu... 40 0.21
gb|BM138318.1|BM138318 WHE0491_B11_C21ZS Wheat Fusarium gra... 40 0.21
gb|BJ251254.1|BJ251254 BJ251254 Y. Ogihara unpublished cDNA... 40 0.21
gb|BJ259365.1|BJ259365 BJ259365 Y. Ogihara unpublished cDNA... 40 0.21
gb|BJ264253.1|BJ264253 BJ264253 Y. Ogihara unpublished cDNA... 40 0.21
gb|CA637894.1|CA637894 wre1n.pk0003.g8 wre1n Triticum aesti... 40 0.21
gb|CD896263.1|CD896263 G174.102E19R011120 G174 Triticum aes... 40 0.21
gb|CK210417.1|CK210417 FGAS022225 Triticum aestivum FGAS: L... 40 0.21
gb|CV763173.1|CV763173 FGAS057562 Triticum aestivum FGAS: L... 40 0.21
gb|CV769484.1|CV769484 FGAS063875 Triticum aestivum FGAS: L... 40 0.21
gb|CV777204.1|CV777204 FGAS071609 Triticum aestivum FGAS: L... 40 0.21
gb|CV781185.1|CV781185 FGAS075596 Triticum aestivum FGAS: L... 40 0.21
>gb|CK205087.1|CK205087 FGAS013624 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 865
Score = 97.6 bits (49), Expect = 1e-018
Identities = 73/81 (90%)
Strand = Plus / Minus
Query: 644 tgcccgccgccaacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctg 703
||||| ||| |||||||||||||||||| ||||||||| || ||||| || |||||||||
Sbjct: 805 tgccccccggcaacgtcgaccagggagcctatcccctggaagacgtccccacactccctg 746
Query: 704 acggcgatgtccatgaggaag 724
| |||||||||||||||||||
Sbjct: 745 atggcgatgtccatgaggaag 725
>gb|AL826125.1|AL826125 AL826125 p:436 Triticum aestivum cDNA clone G05_p436_plate_3, mRNA
sequence
Length = 501
Score = 93.7 bits (47), Expect = 2e-017
Identities = 92/107 (85%)
Strand = Plus / Minus
Query: 608 gggaacgccgcagagatggcctgcgccgccgcgccatgcccgccgccaacgtcgaccagg 667
||||||||| | |||||| | || ||||||||||| | || ||||| ||||||||||||
Sbjct: 107 gggaacgcctccgagatgacttgggccgccgcgccgaggccaccgcccacgtcgaccagg 48
Query: 668 gagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgtc 714
|||| ||||||| | || |||||||||| ||||||||||||||||||
Sbjct: 47 gagcttatcccccggaaaacgtcgccgctctccctgacggcgatgtc 1
>gb|CK204735.1|CK204735 FGAS013271 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 863
Score = 93.7 bits (47), Expect = 2e-017
Identities = 65/71 (91%)
Strand = Plus / Minus
Query: 654 caacgtcgaccagggagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgt 713
|||||||||||||||||| ||||||||| || ||||| || |||||||||| ||||||||
Sbjct: 799 caacgtcgaccagggagcctatcccctggaagacgtccccacactccctgatggcgatgt 740
Query: 714 ccatgaggaag 724
|||||||||||
Sbjct: 739 ccatgaggaag 729
>gb|BE404218.1|BE404218 WHE1203_F02_L03ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1203_F02_L03, mRNA
sequence
Length = 628
Score = 81.8 bits (41), Expect = 6e-014
Identities = 92/109 (84%)
Strand = Plus / Minus
Query: 608 gggaacgccgcagagatggcctgcgccgccgcgccatgcccgccgccaacgtcgaccagg 667
||||||||| | |||||| | || ||||||||||| | || || || |||||||||||
Sbjct: 195 gggaacgcctccgagatgacttgggccgccgcgccgaggccacccccgacgtcgaccagt 136
Query: 668 gagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgtcca 716
|||| ||||||| | || |||||||||| ||||||||||||||||||||
Sbjct: 135 gagcttatcccccggaaaacgtcgccgctctccctgacggcgatgtcca 87
>gb|CA734489.1|CA734489 wpi1s.pk001.e17 wpi1s Triticum aestivum cDNA clone wpi1s.pk001.e17
5' end, mRNA sequence
Length = 531
Score = 67.9 bits (34), Expect = 9e-010
Identities = 241/310 (77%)
Strand = Plus / Plus
Query: 180 ttcaggggtatagctcgatgattgatcgaacacctaaaactggtatgattatgtagtcac 239
|||| ||||| | ||| ||||| |||| ||||||| || ||| ||||| |||||||
Sbjct: 25 ttcatgggtaaacctcaatgatcgatctcacacctagaatgggtgtgattttgtagtcgt 84
Query: 240 tgaaaccagcttcaaagatgatgttcctccattcctgctcatctctctcaaggccgttga 299
|||| ||||| || ||||| || ||| |||| ||||||||||||| ||| | ||| ||||
Sbjct: 85 tgaatccagcctcgaagattatcttcttccactcctgctcatctcgctcgacgccattga 144
Query: 300 cgatcataaaaaagagatcagacatgacctgtgtctctttgttcttaaggtttggaggcc 359
|| ||| | || || ||| ||||||| ||||||||||||| ||| ||| | || |
Sbjct: 145 tgaacatgatgaaaaggtcaaacatgacttgtgtctctttgtgcttcgggtcctgcggtc 204
Query: 360 ctgcaccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatag 419
||||||||| ||| | || || ||||||||||| || ||||||||| ||| | || |
Sbjct: 205 ctgcaccaatcaccatgtcgacaattatcaccttccctcctgcatcttttggcgcgatgg 264
Query: 420 ctttcttgcagttctttagaatcgtgacacactcagagtcaccccagtcgtgcatgatcc 479
|||||||||| || ||||| ||| ||| || || ||||||||| || ||||||| ||
Sbjct: 265 ctttcttgcaattttttagtatcttgatgcagtcctcgtcaccccaatcatgcatgaccc 324
Query: 480 acttgaggaa 489
||||||||||
Sbjct: 325 acttgaggaa 334
>gb|BQ578376.1|BQ578376 WHE0302_B09_C18ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0302_B09_C18, mRNA
sequence
Length = 684
Score = 65.9 bits (33), Expect = 4e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 664 cagggagcgtatcccctgaaacacgtcgccgcactccctgacggcgatgtccatgaggaa 723
|||||||| ||||||||| || || |||||||||||||| | |||||||||||||| |||
Sbjct: 683 cagggagcctatcccctggaagacctcgccgcactccctcatggcgatgtccatgatgaa 624
Query: 724 g 724
|
Sbjct: 623 g 623
>gb|BE406468.1|BE406468 WHE0416_g08_n16zB Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0416_g08_n16, mRNA
sequence
Length = 363
Score = 50.1 bits (25), Expect = 2e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 410 ggaggtatagctttcttgcagttctttagaatcgtgacaca 450
||||| |||| |||||||||||||||||| ||| |||||||
Sbjct: 245 ggaggaatagatttcttgcagttctttagtatcttgacaca 205
>gb|BQ801256.1|BQ801256 WHE2812_B08_D16ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2812_B08_D16, mRNA
sequence
Length = 585
Score = 50.1 bits (25), Expect = 2e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| ||||||| ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 373 ccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttcc 314
Query: 425 ttgca 429
|||||
Sbjct: 313 ttgca 309
>gb|CD934893.1|CD934893 OV.002E03R010412 OV Triticum aestivum cDNA clone OV002E03, mRNA
sequence
Length = 498
Score = 50.1 bits (25), Expect = 2e-004
Identities = 55/65 (84%)
Strand = Plus / Plus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| ||||||| ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 335 ccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttcc 394
Query: 425 ttgca 429
|||||
Sbjct: 395 ttgca 399
>gb|CD939689.1|CD939689 OV.114J05F010312 OV Triticum aestivum cDNA clone OV114J05, mRNA
sequence
Length = 712
Score = 50.1 bits (25), Expect = 2e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| ||||||| ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 629 ccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttcc 570
Query: 425 ttgca 429
|||||
Sbjct: 569 ttgca 565
>gb|CB307508.1|CB307508 HFIG493 Hessian fly infested cDNA library Triticum aestivum cDNA,
mRNA sequence
Length = 646
Score = 48.1 bits (24), Expect = 8e-004
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 697 ctccctgacggcgatgtccatgaggaag 724
|||||||| |||||||||||||||||||
Sbjct: 646 ctccctgatggcgatgtccatgaggaag 619
>gb|BJ284733.1|BJ284733 BJ284733 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr4j04 3', mRNA sequence
Length = 400
Score = 46.1 bits (23), Expect = 0.003
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 231 tgtagtcactgaaaccagcttcaaaga 257
||||||||||||| |||||||||||||
Sbjct: 136 tgtagtcactgaacccagcttcaaaga 162
>gb|BU100113.1|BU100113 WHE3315_C12_F23ZS Chinese Spring wheat drought stressed root cDNA
library Triticum aestivum cDNA clone WHE3315_C12_F23,
mRNA sequence
Length = 695
Score = 46.1 bits (23), Expect = 0.003
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 231 tgtagtcactgaaaccagcttcaaaga 257
||||||||||||| |||||||||||||
Sbjct: 537 tgtagtcactgaacccagcttcaaaga 511
>gb|CA691512.1|CA691512 wlm96.pk053.j18 wlm96 Triticum aestivum cDNA clone wlm96.pk053.j18
5' end, mRNA sequence
Length = 488
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| |||| || ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 361 ccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttcc 302
Query: 425 ttgcagttctt 435
||||| |||||
Sbjct: 301 ttgcaattctt 291
>gb|CK162825.1|CK162825 FGAS015425 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1032
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| |||| || ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 463 ccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttcc 404
Query: 425 ttgcagttctt 435
||||| |||||
Sbjct: 403 ttgcaattctt 393
>gb|CK206856.1|CK206856 FGAS018467 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1017
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 365 ccaaccacggtatctactattatcaccttgccgcctgcatctcgtggaggtatagctttc 424
|||||||| |||| || ||||||||||| || || ||||||| ||||| ||||||| |
Sbjct: 508 ccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttcc 449
Query: 425 ttgcagttctt 435
||||| |||||
Sbjct: 448 ttgcaattctt 438
>gb|BQ903121.1|BQ903121 Ta03_10a02_R
Ta03_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta03_10a02, mRNA
sequence
Length = 395
Score = 44.1 bits (22), Expect = 0.013
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 231 tgtagtcactgaaaccagcttcaaagatgatgttcctccattcctgctcatctc 284
||||||| ||||| ||||||||||||| || |||||||| || ||||| ||||
Sbjct: 288 tgtagtcgctgaacccagcttcaaagaaaatcttcctccactcatgctcctctc 235
>gb|CA641387.1|CA641387 wre1n.pk0045.e8 wre1n Triticum aestivum cDNA clone wre1n.pk0045.e8
5' end, mRNA sequence
Length = 554
Score = 44.1 bits (22), Expect = 0.013
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 231 tgtagtcactgaaaccagcttcaaagatgatgttcctccattcctgctcatctc 284
||||||| ||||| ||||||||||||| || |||||||| || ||||| ||||
Sbjct: 118 tgtagtcgctgaacccagcttcaaagaaaatcttcctccactcatgctcctctc 65
>gb|BJ257333.1|BJ257333 BJ257333 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh20p24 5', mRNA sequence
Length = 700
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Minus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| |||||||||| |||||||||||
Sbjct: 206 cttgagcaggacagcatccgccggcggaatggattcaaacatgtc 162
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 101 aaggtccagcacggtgcact 82
>gb|BJ262917.1|BJ262917 BJ262917 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh20p24 3', mRNA sequence
Length = 661
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| |||||||||| |||||||||||
Sbjct: 498 cttgagcaggacagcatccgccggcggaatggattcaaacatgtc 542
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 603 aaggtccagcacggtgcact 622
>gb|CD866826.1|CD866826 AZO2.104I16R010327 AZO2 Triticum aestivum cDNA clone AZO2104I16,
mRNA sequence
Length = 675
Score = 42.1 bits (21), Expect = 0.052
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 410 ggaggtatagctttcttgcagttctttagaatcgtgacaca 450
||||| |||| ||||||||||||||| || ||| |||||||
Sbjct: 481 ggaggaatagatttcttgcagttcttcagtatcttgacaca 521
>gb|CD880941.1|CD880941 F1.100G13F010315 F1 Triticum aestivum cDNA clone F1100G13, mRNA
sequence
Length = 689
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Minus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| || ||||||| ||||||||||||
Sbjct: 229 cttgagcaggacagcatccgccggtggaatggactcaaacatgtc 185
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 124 aaggtccagcacggtgcact 105
>gb|CD893199.1|CD893199 G118.123C05R011115 G118 Triticum aestivum cDNA clone G118123C05,
mRNA sequence
Length = 661
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| |||||||||| |||||||||||
Sbjct: 549 cttgagcaggacagcatccgccggcggaatggattcaaacatgtc 593
>gb|CK205898.1|CK205898 FGAS017454 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1108
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| |||||||||| |||||||||||
Sbjct: 592 cttgagcaggacagcatccgccggcggaatggattcaaacatgtc 636
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 697 aaggtccagcacggtgcact 716
>gb|CV769800.1|CV769800 FGAS064192 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 893
Score = 42.1 bits (21), Expect = 0.052
Identities = 39/45 (86%)
Strand = Plus / Minus
Query: 481 cttgaggaagacagcattcgctggcggaatggcctcaaacatgtc 525
|||||| | |||||||| ||| |||||||||| |||||||||||
Sbjct: 487 cttgagcaggacagcatccgccggcggaatggattcaaacatgtc 443
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 382 aaggtccagcacggtgcact 363
>gb|BE606863.1|BE606863 WHE0902_A02_A04ZS Wheat 5-15 DAP spike cDNA library Triticum
aestivum cDNA clone WHE0902_A02_A04, mRNA sequence
Length = 295
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 581 aggtccagcacggtgcactgtatg 604
||||||||||||||||||| ||||
Sbjct: 118 aggtccagcacggtgcactttatg 95
>gb|BG314252.1|BG314252 WHE2461_B07_D13ZS Triticum monococcum early reproductive apex cDNA
library Triticum monococcum cDNA clone WHE2461_B07_D13,
mRNA sequence
Length = 449
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 147 aaggtccagcacggtgcact 128
>gb|BM138318.1|BM138318 WHE0491_B11_C21ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE0491_B11_C21,
mRNA sequence
Length = 561
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 581 aggtccagcacggtgcactgtatg 604
||||||||||||||||||| ||||
Sbjct: 433 aggtccagcacggtgcactttatg 410
>gb|BJ251254.1|BJ251254 BJ251254 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf19e17 3', mRNA sequence
Length = 720
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 581 aggtccagcacggtgcactgtatg 604
||||||||||||||||||| ||||
Sbjct: 410 aggtccagcacggtgcactttatg 433
>gb|BJ259365.1|BJ259365 BJ259365 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh12k03 5', mRNA sequence
Length = 666
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 581 aggtccagcacggtgcactgtatg 604
||||||||||||||||||| ||||
Sbjct: 207 aggtccagcacggtgcactttatg 184
>gb|BJ264253.1|BJ264253 BJ264253 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh12k03 3', mRNA sequence
Length = 695
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 581 aggtccagcacggtgcactgtatg 604
||||||||||||||||||| ||||
Sbjct: 544 aggtccagcacggtgcactttatg 567
>gb|CA637894.1|CA637894 wre1n.pk0003.g8 wre1n Triticum aestivum cDNA clone wre1n.pk0003.g8
5' end, mRNA sequence
Length = 550
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 210 aaggtccagcacggtgcact 191
>gb|CD896263.1|CD896263 G174.102E19R011120 G174 Triticum aestivum cDNA clone G174102E19,
mRNA sequence
Length = 757
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 665 aaggtccagcacggtgcact 684
>gb|CK210417.1|CK210417 FGAS022225 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1106
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 816 aaggtccagcacggtgcact 797
>gb|CV763173.1|CV763173 FGAS057562 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 820
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 693 aaggtccagcacggtgcact 674
>gb|CV769484.1|CV769484 FGAS063875 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 899
Score = 40.1 bits (20), Expect = 0.21
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 636 ccgcgccatgcccgccgccaacgtcgac 663
|||||||||||||||| || ||||||||
Sbjct: 807 ccgcgccatgcccgccacctacgtcgac 780
>gb|CV777204.1|CV777204 FGAS071609 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 856
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 826 aaggtccagcacggtgcact 807
>gb|CV781185.1|CV781185 FGAS075596 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 853
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 aaggtccagcacggtgcact 599
||||||||||||||||||||
Sbjct: 214 aaggtccagcacggtgcact 195
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 150,653
Number of Sequences: 636343
Number of extensions: 150653
Number of successful extensions: 46794
Number of sequences better than 0.5: 39
Number of HSP's better than 0.5 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46706
Number of HSP's gapped (non-prelim): 84
length of query: 724
length of database: 367,240,239
effective HSP length: 19
effective length of query: 705
effective length of database: 355,149,722
effective search space: 250380554010
effective search space used: 250380554010
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)