BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2921788.2.1
(606 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CK205923.1|CK205923 FGAS017484 Triticum aestivum FGAS: L... 137 1e-030
gb|CK217415.1|CK217415 FGAS029417 Triticum aestivum FGAS: L... 137 1e-030
gb|CA650869.1|CA650869 wre1n.pk160.d8 wre1n Triticum aestiv... 135 4e-030
gb|CA602684.1|CA602684 wr1.pk0009.g1 wr1 Triticum aestivum ... 117 9e-025
gb|CK213884.1|CK213884 FGAS025796 Triticum aestivum FGAS: L... 105 3e-021
gb|DR738786.1|DR738786 FGAS084003 Triticum aestivum FGAS: L... 105 3e-021
gb|CA728874.1|CA728874 wdi1c.pk005.m10 wdi1c Triticum aesti... 88 8e-016
gb|CA595563.1|CA595563 wpa1c.pk010.f17 wpa1c Triticum aesti... 68 8e-010
gb|CA631981.1|CA631981 wle1n.pk0050.b10 wle1n Triticum aest... 64 1e-008
gb|CA649717.1|CA649717 wre1n.pk0146.c4 wre1n Triticum aesti... 64 1e-008
gb|BI751226.1|BI751226 Ta01_17e09_R Ta01_AAFC_ECORC_Fusariu... 54 1e-005
gb|BI751765.1|BI751765 Ta01_12b04_R Ta01_AAFC_ECORC_Fusariu... 54 1e-005
gb|CA644863.1|CA644863 wre1n.pk0092.b5 wre1n Triticum aesti... 54 1e-005
gb|CD893505.1|CD893505 G118.123N04F010829 G118 Triticum aes... 40 0.17
>gb|CK205923.1|CK205923 FGAS017484 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1124
Score = 137 bits (69), Expect = 1e-030
Identities = 126/145 (86%)
Strand = Plus / Minus
Query: 178 tggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttac 237
|||||||||||||| |||||| |||| |||||||| |||||||| ||||||||||| |||
Sbjct: 539 tggtgcttcagcgacccggaggtgaagaggcggcgtcgggtggcgagctacaaggcgtac 480
Query: 238 tcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaag 297
|||| |||||| ||||||||||| || |||| | |||| |||||||||||||||| ||||
Sbjct: 479 tcggtggagggaaaagtcaaggcctccttccgccggggcttccgctggatcaaggacaag 420
Query: 298 tgctccgagctcatccatggctgaa 322
||| | | |||||||||||||||
Sbjct: 419 tgcacgggcttcatccatggctgaa 395
Score = 125 bits (63), Expect = 4e-027
Identities = 105/119 (88%), Gaps = 3/119 (2%)
Strand = Plus / Minus
Query: 1 tacgaccgcgcgcaccgcccctacgcggctcccgcccccgccggtgagtacgaccgcccc 60
|||||||||||| ||||||| |||||| ||| || |||||| || ||||||||||||
Sbjct: 728 tacgaccgcgcgtaccgcccntacgcg---ccctcctccgccgccgantacgaccgcccc 672
Query: 61 taccgcaacgaggtcgtgccctacggtgaccgccgcatcgacatcatcgtcaagccgcc 119
|||||||||||| ||||||||||||| ||||||||||||||| || |||||||||||||
Sbjct: 671 taccgcaacgagatcgtgccctacggcgaccgccgcatcgacctcgtcgtcaagccgcc 613
>gb|CK217415.1|CK217415 FGAS029417 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1056
Score = 137 bits (69), Expect = 1e-030
Identities = 126/145 (86%)
Strand = Plus / Plus
Query: 178 tggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttac 237
|||||||||||||| |||||| |||| |||||||| |||||||| ||||||||||| |||
Sbjct: 309 tggtgcttcagcgacccggaggtgaagaggcggcgtcgggtggcgagctacaaggcgtac 368
Query: 238 tcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaag 297
|||| |||||| ||||||||||| || |||| | |||| |||||||||||||||| ||||
Sbjct: 369 tcggtggagggaaaagtcaaggcctccttccgccggggcttccgctggatcaaggacaag 428
Query: 298 tgctccgagctcatccatggctgaa 322
||| | | |||||||||||||||
Sbjct: 429 tgcacgggcttcatccatggctgaa 453
Score = 129 bits (65), Expect = 2e-028
Identities = 106/119 (89%), Gaps = 3/119 (2%)
Strand = Plus / Plus
Query: 1 tacgaccgcgcgcaccgcccctacgcggctcccgcccccgccggtgagtacgaccgcccc 60
|||||||||||| |||||||||||||| ||| || |||||| || ||||||||||||
Sbjct: 120 tacgaccgcgcgtaccgcccctacgcg---ccctcctccgccgccgactacgaccgcccc 176
Query: 61 taccgcaacgaggtcgtgccctacggtgaccgccgcatcgacatcatcgtcaagccgcc 119
|||||||||||| ||||||||||||| ||||||||||||||| || |||||||||||||
Sbjct: 177 taccgcaacgagatcgtgccctacggcgaccgccgcatcgacctcgtcgtcaagccgcc 235
>gb|CA650869.1|CA650869 wre1n.pk160.d8 wre1n Triticum aestivum cDNA clone wre1n.pk160.d8 5'
end, mRNA sequence
Length = 443
Score = 135 bits (68), Expect = 4e-030
Identities = 125/144 (86%)
Strand = Plus / Plus
Query: 179 ggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttact 238
||||||||||||| |||||| |||| |||||||| |||||||| ||||||||||| ||||
Sbjct: 1 ggtgcttcagcgacccggaggtgaagaggcggcgtcgggtggcgagctacaaggcgtact 60
Query: 239 cggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaagt 298
||| |||||| ||||||||||| || |||| | |||| |||||||||||||||| |||||
Sbjct: 61 cggtggagggaaaagtcaaggcctccttccgccggggcttccgctggatcaaggacaagt 120
Query: 299 gctccgagctcatccatggctgaa 322
|| | | |||||||||||||||
Sbjct: 121 gcacgggcttcatccatggctgaa 144
>gb|CA602684.1|CA602684 wr1.pk0009.g1 wr1 Triticum aestivum cDNA clone wr1.pk0009.g1 5'
end, mRNA sequence
Length = 303
Score = 117 bits (59), Expect = 9e-025
Identities = 116/135 (85%)
Strand = Plus / Plus
Query: 188 gcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttactcggcggagg 247
|||| |||||| |||| |||||||| |||||||| ||||||||||| ||||||| |||||
Sbjct: 1 gcgacccggaggtgaagaggcggcgtcgggtggcgagctacaaggcgtactcggtggagg 60
Query: 248 gcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaagtgctccgagc 307
| ||||||||||| || |||| | |||| |||||||||||||||| ||||||| | |
Sbjct: 61 gaaaagtcaaggcctccttccgccggggcttccgctggatcaaggacaagtgcacgggct 120
Query: 308 tcatccatggctgaa 322
|||||||||||||||
Sbjct: 121 tcatccatggctgaa 135
>gb|CK213884.1|CK213884 FGAS025796 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1031
Score = 105 bits (53), Expect = 3e-021
Identities = 110/129 (85%)
Strand = Plus / Minus
Query: 177 gtggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggctta 236
||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||
Sbjct: 438 gtggtgcttcagcgacccggagatgaagcggcggcggcgggtggcgagctacaaggctta 379
Query: 237 ctcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaa 296
||| | ||| || ||||| ||| | ||| | | ||||| |||||||| |||||| |||
Sbjct: 378 ctcagtggaagggaaagtgaagtcctcgctgcggaggggcctccgctggttcaagggcaa 319
Query: 297 gtgctccga 305
|||||||||
Sbjct: 318 gtgctccga 310
>gb|DR738786.1|DR738786 FGAS084003 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1075
Score = 105 bits (53), Expect = 3e-021
Identities = 110/129 (85%)
Strand = Plus / Plus
Query: 177 gtggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggctta 236
||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||
Sbjct: 472 gtggtgcttcagcgacccggagatgaagcggcggcggcgggtggcgagctacaaggctta 531
Query: 237 ctcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaa 296
||| | ||| || ||||| ||| | ||| | | ||||| |||||||| |||||| |||
Sbjct: 532 ctcagtggaagggaaagtgaagtcctcgctgcggaggggcctccgctggttcaagggcaa 591
Query: 297 gtgctccga 305
|||||||||
Sbjct: 592 gtgctccga 600
>gb|CA728874.1|CA728874 wdi1c.pk005.m10 wdi1c Triticum aestivum cDNA clone wdi1c.pk005.m10
5' end, mRNA sequence
Length = 605
Score = 87.7 bits (44), Expect = 8e-016
Identities = 107/128 (83%)
Strand = Plus / Plus
Query: 178 tggtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttac 237
|||||||||||||| ||||||||||| |||||||||||||||| ||||||||||| |||
Sbjct: 365 tggtgcttcagcgacccggagatgaagcggcggcggcgggtggcgagctacaaggcctac 424
Query: 238 tcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggccaag 297
|| | ||| || ||||| ||| | ||| | | ||||| |||||||| |||| | ||||
Sbjct: 425 tcagtggaagggaaagtgaagtcctcgctgcggaggggcctccgctggttcaaaggcaag 484
Query: 298 tgctccga 305
||||||||
Sbjct: 485 tgctccga 492
>gb|CA595563.1|CA595563 wpa1c.pk010.f17 wpa1c Triticum aestivum cDNA clone wpa1c.pk010.f17
5' end, mRNA sequence
Length = 590
Score = 67.9 bits (34), Expect = 8e-010
Identities = 91/110 (82%)
Strand = Plus / Plus
Query: 194 cggagatgaaaaggcggcggcgggtggccagctacaaggcttactcggcggagggcaaag 253
|||||||||| ||||| || |||||||||||||||| || ||| | | ||||||||| |
Sbjct: 203 cggagatgaagcggcgggggagggtggccagctacaaagcctacgccgtggagggcaagg 262
Query: 254 tcaaggcatcgttccccaggggattccgctggatcaaggccaagtgctcc 303
| || || || ||| | |||| ||||||||||||||||||||||||||
Sbjct: 263 tgaaagcgtccctccgccggggcctccgctggatcaaggccaagtgctcc 312
>gb|CA631981.1|CA631981 wle1n.pk0050.b10 wle1n Triticum aestivum cDNA clone
wle1n.pk0050.b10 5' end, mRNA sequence
Length = 611
Score = 63.9 bits (32), Expect = 1e-008
Identities = 54/60 (90%), Gaps = 1/60 (1%)
Strand = Plus / Minus
Query: 180 gtgcttcagcgatccggagatgaaaaggcggcggcgggtggccagctacaaggcttactc 239
|||||||||||| ||||||||||| ||||||||||| |||| |||||| ||||||||||
Sbjct: 555 gtgcttcagcgacccggagatgaagcggcggcggcggttggcgagctac-aggcttactc 497
>gb|CA649717.1|CA649717 wre1n.pk0146.c4 wre1n Triticum aestivum cDNA clone wre1n.pk0146.c4
5' end, mRNA sequence
Length = 346
Score = 63.9 bits (32), Expect = 1e-008
Identities = 92/111 (82%), Gaps = 1/111 (0%)
Strand = Plus / Plus
Query: 194 cggagatgaaaaggcggcggcgggtggccagctacaaggcttactcggcggagggcaaag 253
|||||||||| ||||| || ||||||||||||||||||| ||| | | ||||||||| |
Sbjct: 13 cggagatgaagcggcgggggagggtggccagctacaaggcctacgccgtggagggcaagg 72
Query: 254 tcaaggcatcgttccccaggggattccgctgga-tcaaggccaagtgctcc 303
| ||||| || ||| | |||| ||||||||| | |||||||||||||||
Sbjct: 73 tgaaggcgtccctccgccggggcctccgctggattnaaggccaagtgctcc 123
>gb|BI751226.1|BI751226 Ta01_17e09_R
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta01_17e09, mRNA
sequence
Length = 352
Score = 54.0 bits (27), Expect = 1e-005
Identities = 72/87 (82%)
Strand = Plus / Minus
Query: 236 actcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggcca 295
|||||| ||| || ||||||||||| || |||| | |||| |||||||||||||||| ||
Sbjct: 352 actcggtggaaggaaaagtcaaggcytccttccgccggggcttccgctggatcaaggaca 293
Query: 296 agtgctccgagctcatccatggctgaa 322
||| | | | |||||||||||||||
Sbjct: 292 agtmcacgggcttcatccatggctgaa 266
>gb|BI751765.1|BI751765 Ta01_12b04_R
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta01_12b04, mRNA
sequence
Length = 443
Score = 54.0 bits (27), Expect = 1e-005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 236 actcggcggagggcaaagtcaaggcatcgttccccaggggattccgctggatcaaggcca 295
|||||| ||| || ||||||||||| || |||| | |||| |||||||||||||| | ||
Sbjct: 443 actcggtggaaggaaaagtcaaggcctccttccgccggggcttccgctggatcaargaca 384
Query: 296 agtgctccgagctcatccatggctgaa 322
||| | | | |||||||||||||||
Sbjct: 383 agtrcacgggcttcatccatggctgaa 357
>gb|CA644863.1|CA644863 wre1n.pk0092.b5 wre1n Triticum aestivum cDNA clone wre1n.pk0092.b5
5' end, mRNA sequence
Length = 381
Score = 54.0 bits (27), Expect = 1e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 250 aaagtcaaggcatcgttccccaggggattccgctggatcaaggccaagtgc 300
||||||||||| || |||| | |||| |||||||||||||||| |||||||
Sbjct: 4 aaagtcaaggcctccttccgccggggcttccgctggatcaaggacaagtgc 54
>gb|CD893505.1|CD893505 G118.123N04F010829 G118 Triticum aestivum cDNA clone G118123N04,
mRNA sequence
Length = 687
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 545 aattctgttcaaaaaatgtt 564
||||||||||||||||||||
Sbjct: 611 aattctgttcaaaaaatgtt 592
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 210,427
Number of Sequences: 636343
Number of extensions: 210427
Number of successful extensions: 54303
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54265
Number of HSP's gapped (non-prelim): 26
length of query: 606
length of database: 367,240,239
effective HSP length: 19
effective length of query: 587
effective length of database: 355,149,722
effective search space: 208472886814
effective search space used: 208472886814
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)