BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2621801.2.1
(679 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD924368.1|CD924368 G750.112L05F010711 G750 Triticum aes... 416 e-115
gb|CD926398.1|CD926398 G750.121P16F010711 G750 Triticum aes... 270 1e-070
gb|CD903878.1|CD903878 G356.111L17F010919 G356 Triticum aes... 176 1e-042
gb|CA648979.1|CA648979 wre1n.pk0136.d5 wre1n Triticum aesti... 168 3e-040
gb|CA483821.1|CA483821 WHE3205_G02_M03ZS Wheat meiotic anth... 135 4e-030
gb|BE427048.1|BE427048 PSR6344 ITEC PSR Wheat Endosperm Lib... 98 1e-018
gb|BE517898.1|BE517898 WHE0804_E10_J20ZS Wheat vernalized c... 98 1e-018
gb|CK162267.1|CK162267 FGAS014856 Triticum aestivum FGAS: L... 98 1e-018
gb|CV767923.1|CV767923 FGAS062314 Triticum aestivum FGAS: L... 98 1e-018
gb|CK208092.1|CK208092 FGAS019773 Triticum aestivum FGAS: L... 90 2e-016
gb|BQ236021.1|BQ236021 TaE05039E01F TaE05 Triticum aestivum... 88 9e-016
gb|CA500108.1|CA500108 WHE4015_E02_J03ZT Wheat meiotic anth... 88 9e-016
gb|CA601721.1|CA601721 wr1.pk0005.d6 wr1 Triticum aestivum ... 88 9e-016
gb|CA691011.1|CA691011 wlm96.pk053.k5 wlm96 Triticum aestiv... 88 9e-016
gb|CA708398.1|CA708398 wdk2c.pk009.e12 wdk2c Triticum aesti... 88 9e-016
gb|CD881507.1|CD881507 F1.103H07F010329 F1 Triticum aestivu... 88 9e-016
gb|CD884204.1|CD884204 F1.115O08F010507 F1 Triticum aestivu... 88 9e-016
gb|CD891228.1|CD891228 G118.116K03F010723 G118 Triticum aes... 88 9e-016
gb|CD891229.1|CD891229 G118.116K03R010926 G118 Triticum aes... 88 9e-016
gb|BJ261855.1|BJ261855 BJ261855 Y. Ogihara unpublished cDNA... 84 1e-014
gb|CN008984.1|CN008984 WHE2647_D12_H23ZE Wheat Fusarium gra... 84 1e-014
gb|BE637823.1|BE637823 WHE1755-1758_B13_B13ZS Wheat pre-ant... 82 6e-014
gb|BJ248567.1|BJ248567 BJ248567 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ252639.1|BJ252639 BJ252639 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ254780.1|BJ254780 BJ254780 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ265969.1|BJ265969 BJ265969 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ276946.1|BJ276946 BJ276946 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ286162.1|BJ286162 BJ286162 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ317994.1|BJ317994 BJ317994 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BJ320254.1|BJ320254 BJ320254 Y. Ogihara unpublished cDNA... 82 6e-014
gb|BQ246038.1|BQ246038 TaE15016H06R TaE15 Triticum aestivum... 82 6e-014
gb|AL819641.1|AL819641 AL819641 n:129 Triticum aestivum cDN... 82 6e-014
gb|CD890050.1|CD890050 G118.113M02F010716 G118 Triticum aes... 82 6e-014
gb|CD891244.1|CD891244 G118.116K12R010926 G118 Triticum aes... 82 6e-014
gb|AL809175.1|AL809175 AL809175 a:11 Triticum aestivum cDNA... 78 9e-013
gb|BJ246690.1|BJ246690 BJ246690 Y. Ogihara unpublished cDNA... 76 4e-012
gb|BE430423.1|BE430423 SUN002.H01R991208 ITEC SUN Wheat cDN... 72 5e-011
gb|CA722685.1|CA722685 wds1c.pk004.e6.f wds1c Triticum mono... 72 5e-011
gb|CA681784.1|CA681784 wlm24.pk0023.g2 wlm24 Triticum aesti... 70 2e-010
gb|CA599969.1|CA599969 waw1c.pk004.l6 waw1c Triticum aestiv... 64 1e-008
gb|CA670728.1|CA670728 wlsu1.pk027.j3 wlsu1 Triticum aestiv... 64 1e-008
gb|CA697243.1|CA697243 wlk4.pk0018.g5 wlk4 Triticum aestivu... 62 5e-008
gb|CD373577.1|CD373577 WHE0425_B12_C23ZT CS wheat etiolated... 60 2e-007
gb|CD883176.1|CD883176 F1.112H18R010627 F1 Triticum aestivu... 58 8e-007
gb|BE406481.1|BE406481 WHE0416_h10_p20zB Wheat etiolated se... 56 3e-006
gb|CA499319.1|CA499319 WHE4006_A08_A16ZT Wheat meiotic anth... 56 3e-006
gb|CA739097.1|CA739097 wpi2s.pk009.d1 wpi2s Triticum aestiv... 56 3e-006
gb|BQ238330.1|BQ238330 TaE05005E05F TaE05 Triticum aestivum... 50 2e-004
gb|CA600060.1|CA600060 waw1c.pk004.c22 waw1c Triticum aesti... 50 2e-004
gb|CD454866.1|CD454866 WHE955_F06_K11ZT CS wheat pre-anthes... 50 2e-004
gb|CD887437.1|CD887437 G118.105D08R010924 G118 Triticum aes... 50 2e-004
gb|CD890199.1|CD890199 G118.114B06R010926 G118 Triticum aes... 50 2e-004
gb|CK168444.1|CK168444 FGAS042961 Triticum aestivum FGAS: T... 50 2e-004
gb|CK168450.1|CK168450 FGAS042971 Triticum aestivum FGAS: T... 50 2e-004
gb|CK168588.1|CK168588 FGAS043159 Triticum aestivum FGAS: T... 50 2e-004
gb|CK168696.1|CK168696 FGAS043285 Triticum aestivum FGAS: T... 50 2e-004
gb|CK168704.1|CK168704 FGAS043293 Triticum aestivum FGAS: T... 50 2e-004
gb|CK168882.1|CK168882 FGAS043477 Triticum aestivum FGAS: T... 50 2e-004
gb|CK169444.1|CK169444 FGAS044074 Triticum aestivum FGAS: T... 50 2e-004
gb|CK169832.1|CK169832 FGAS044484 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170121.1|CK170121 FGAS044887 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170134.1|CK170134 FGAS044905 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170273.1|CK170273 FGAS045107 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170287.1|CK170287 FGAS045125 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170498.1|CK170498 FGAS045418 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170512.1|CK170512 FGAS045436 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170526.1|CK170526 FGAS045456 Triticum aestivum FGAS: T... 50 2e-004
gb|CK170713.1|CK170713 FGAS045697 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171133.1|CK171133 FGAS046270 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171286.1|CK171286 FGAS046474 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171312.1|CK171312 FGAS046514 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171508.1|CK171508 FGAS046795 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171601.1|CK171601 FGAS046929 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171667.1|CK171667 FGAS047024 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171737.1|CK171737 FGAS047136 Triticum aestivum FGAS: T... 50 2e-004
gb|CK171975.1|CK171975 FGAS047466 Triticum aestivum FGAS: T... 50 2e-004
gb|AL809231.1|AL809231 AL809231 a:11 Triticum aestivum cDNA... 50 2e-004
gb|CA601497.1|CA601497 wr1.pk0004.e4 wr1 Triticum aestivum ... 48 8e-004
gb|CA735519.1|CA735519 wpi1s.pk002.d19 wpi1s Triticum aesti... 48 8e-004
gb|CA485323.1|CA485323 WHE4317_C07_E13ZS Wheat meiotic anth... 46 0.003
gb|CA609554.1|CA609554 wr1.pk0107.g10 wr1 Triticum aestivum... 46 0.003
gb|CA639876.1|CA639876 wre1n.pk0028.b8 wre1n Triticum aesti... 46 0.003
gb|CA723402.1|CA723402 wdr1f.pk003.k21 wdr1f Triticum aesti... 46 0.003
gb|CA723509.1|CA723509 wdr1f.pk003.m15 wdr1f Triticum aesti... 46 0.003
gb|CA744160.1|CA744160 wri1s.pk006.f12 wri1s Triticum aesti... 46 0.003
gb|CD938836.1|CD938836 OV.111D06R010412 OV Triticum aestivu... 46 0.003
gb|CA502345.1|CA502345 WHE4046_C05_E10ZT Wheat meiotic anth... 44 0.012
gb|CA626798.1|CA626798 wl1n.pk0149.c9 wl1n Triticum aestivu... 44 0.012
gb|CA721925.1|CA721925 wds1c.pk001.f21.f wds1c Triticum mon... 44 0.012
gb|BG906778.1|BG906778 TaLr1152E11F TaLr1 Triticum aestivum... 42 0.049
gb|BJ215438.1|BJ215438 BJ215438 Y. Ogihara unpublished cDNA... 42 0.049
gb|BQ243940.1|BQ243940 TaE15007A09F TaE15 Triticum aestivum... 42 0.049
gb|BQ246682.1|BQ246682 TaE15007A09R TaE15 Triticum aestivum... 42 0.049
gb|CD916411.1|CD916411 G608.001K20F010615 G608 Triticum aes... 42 0.049
gb|CK170062.1|CK170062 FGAS044800 Triticum aestivum FGAS: T... 42 0.049
gb|CV759309.1|CV759309 FGAS053692 Triticum aestivum FGAS: L... 42 0.049
gb|BE405431.1|BE405431 WHE1216_C09_F18ZS Wheat etiolated se... 40 0.19
gb|BE405885.1|BE405885 WHE0401_d03_d03zB Wheat etiolated se... 40 0.19
gb|BE425229.1|BE425229 WHE0312_F11_F11ZS Wheat unstressed s... 40 0.19
gb|BE442708.1|BE442708 WHE1105_B08_C15ZS Wheat etiolated se... 40 0.19
gb|BE498071.1|BE498071 WHE0953_G11_N21ZS Wheat pre-anthesis... 40 0.19
gb|BJ282678.1|BJ282678 BJ282678 Y. Ogihara unpublished cDNA... 40 0.19
gb|BJ284571.1|BJ284571 BJ284571 Y. Ogihara unpublished cDNA... 40 0.19
gb|BJ296336.1|BJ296336 BJ296336 Y. Ogihara unpublished cDNA... 40 0.19
gb|AL827224.1|AL827224 AL827224 p:638 Triticum aestivum cDN... 40 0.19
gb|CA648090.1|CA648090 wre1n.pk0125.h5 wre1n Triticum aesti... 40 0.19
gb|CD864575.1|CD864575 AZO2.001E18F000630 AZO2 Triticum aes... 40 0.19
gb|CD864769.1|CD864769 AZO2.001K08R000629 AZO2 Triticum aes... 40 0.19
gb|CD871843.1|CD871843 AZO2.119C24R010521 AZO2 Triticum aes... 40 0.19
gb|CD878499.1|CD878499 AZO4.102O12R011126 AZO4 Triticum aes... 40 0.19
gb|CD883150.1|CD883150 F1.112G18F010515 F1 Triticum aestivu... 40 0.19
gb|CD911189.1|CD911189 G550.110G10F010521 G550 Triticum aes... 40 0.19
gb|CD913687.1|CD913687 G550.118M19F010713 G550 Triticum aes... 40 0.19
gb|CD915559.1|CD915559 G550.126K16R010921 G550 Triticum aes... 40 0.19
gb|CF133262.1|CF133262 WHE4355_H07_O13ZT Wheat meiotic flor... 40 0.19
gb|CK200505.1|CK200505 FGAS009020 Triticum aestivum FGAS: L... 40 0.19
>gb|CD924368.1|CD924368 G750.112L05F010711 G750 Triticum aestivum cDNA clone G750112L05,
mRNA sequence
Length = 573
Score = 416 bits (210), Expect = e-115
Identities = 442/518 (85%), Gaps = 1/518 (0%)
Strand = Plus / Minus
Query: 134 cggcctttgtctggaggtagttgcggagggcgtagatgcccttctcccgcccgacgccgc 193
||||||| |||||||||||||||| |||| |||| ||||||||||||||| ||||||
Sbjct: 541 cggccttggtctggaggtagttgccgaggctgtaggcgcccttctcccgccccacgccgg 482
Query: 194 tcatcttgtagccgccgaacgggatggtggcgtcgaacacgtcgtagcagttcacccaca 253
|||||||||| |||||||| ||||||| |||||| |||||||||||||||| |||||||
Sbjct: 481 tcatcttgtacccgccgaaggggatggccgcgtcgtacacgtcgtagcagttgacccaca 422
Query: 254 cggtgcccgcccgcagcgcccgcgacagggtgttggccgcgtccaggctccgcgtgaaca 313
| || ||||||| ||||||||||| | | ||| |||| ||||||||||| ||||||||
Sbjct: 421 ccgtccccgccctcagcgcccgcgctaccgcgttcgccgtgtccaggctcctcgtgaaca 362
Query: 314 cccccgccgccagcccgtagggcgtcgcgttcgcgcgccggatcacctcctccacgccgc 373
|||||||||||||||||||| ||||||||||||| | || | ||||||| |||| | |
Sbjct: 361 cccccgccgccagcccgtagtgcgtcgcgttcgccctcctcaccacctcccccacctccc 302
Query: 374 tgaacttgagaatggtttgcaccggcccgaatatctcctcccgagcgatcttcatttcgt 433
|||||||||| |||| || | |||||||||||||||||| ||||||||||||| ||||
Sbjct: 301 tgaacttgaggatggactggatgggcccgaatatctcctcctgagcgatcttcatctcgt 242
Query: 434 ccttggcgtcggcaaacaccgtcggctgtatgtagaagcccctttcgcctaccctgtcgc 493
||| | |||| ||||| ||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 241 cctcgacgtctgcaaagaccgtcggctggatgtagaagcccctgctgcctaccctgtcgc 182
Query: 494 cgccggcgacgagggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgt 553
|||||| |||||||||||| |||||||||||||| |||| ||||| | || ||||| |
Sbjct: 181 cgccggtgacgagggtggcgccgctgtcgacgcccgacttgacgtagcccagaatcttct 122
Query: 554 tgaattgctcgccgtcgatctgaggcccctgttcgaccccgtccctgaaggggtcgccga 613
|||| |||| ||| ||||||||||| ||||| ||||| || | | |||||||||||||||
Sbjct: 121 tgaactgctggccatcgatctgaggtccctgctcgacacctttcttgaaggggtcgccga 62
Query: 614 cgacgcg-cttagggcgcgggccttggacttctccacg 650
| ||||| || | ||||| ||||||||||||||||||
Sbjct: 61 ccacgcgcctctgagcgcgagccttggacttctccacg 24
>gb|CD926398.1|CD926398 G750.121P16F010711 G750 Triticum aestivum cDNA clone G750121P16,
mRNA sequence
Length = 677
Score = 270 bits (136), Expect = 1e-070
Identities = 248/284 (87%), Gaps = 1/284 (0%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcatttcgtccttggcgtcggcaaacaccgtc 456
|||||||||||||||||| ||||||||||||| ||||||| | |||| ||||| ||||||
Sbjct: 632 ggcccgaatatctcctcctgagcgatcttcatctcgtcctcgacgtctgcaaagaccgtc 573
Query: 457 ggctgtatgtagaagcccctttcgcctaccctgtcgccgccggcgacgagggtggcaccg 516
||||| |||||||||||||| |||||||||||||||||||| |||||||||||| |||
Sbjct: 572 ggctggatgtagaagcccctgctgcctaccctgtcgccgccggtgacgagggtggcgccg 513
Query: 517 ctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcgccgtcgatctga 576
||||||||||| |||| ||||| | || ||||| ||||| |||| ||| |||||||||
Sbjct: 512 ctgtcgacgcccgacttgacgtagcccagaatcttcttgaactgctggccatcgatctga 453
Query: 577 ggcccctgttcgaccccgtccctgaaggggtcgccgacgacgcg-cttagggcgcgggcc 635
|| ||||| ||||| || | | |||||||||||||||| ||||| || | ||||| |||
Sbjct: 452 ggtccctgctcgacacctttcttgaaggggtcgccgaccacgcgcctctgagcgcgagcc 393
Query: 636 ttggacttctccacgaactcgtcgtacacgcgctcgtgcacgaa 679
||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 392 ttggacttctccacgaactcgtcgtacacgctctcgtgcacgaa 349
>gb|CD903878.1|CD903878 G356.111L17F010919 G356 Triticum aestivum cDNA clone G356111L17,
mRNA sequence
Length = 404
Score = 176 bits (89), Expect = 1e-042
Identities = 174/201 (86%), Gaps = 1/201 (0%)
Strand = Plus / Minus
Query: 480 gcctaccctgtcgccgccggcgacgagggtggcaccgctgtcgacgccggactgaacgta 539
|||||||||||||||||||| || |||||||| |||||||||||||| |||| |||||
Sbjct: 264 gcctaccctgtcgccgccggtcaccagggtggcgccgctgtcgacgcccgacttgacgta 205
Query: 540 ccgcaagatcttgttgaattgctcgccgtcgatctgaggcccctgttcgaccccgtccct 599
| || |||||| ||||| |||| ||| ||||||||||| ||||| || || || | | |
Sbjct: 204 gcccaggatcttcttgaactgctggccatcgatctgaggtccctgctcaacacctttctt 145
Query: 600 gaaggggtcgccgacgacgcg-cttagggcgcgggccttggacttctccacgaactcgtc 658
|||||||||||||||||| || || ||||||| ||||||||||||||||||||||||||
Sbjct: 144 gaaggggtcgccgacgacacgcctctgggcgcgagccttggacttctccacgaactcgtc 85
Query: 659 gtacacgcgctcgtgcacgaa 679
|||||||| ||||||||||||
Sbjct: 84 gtacacgctctcgtgcacgaa 64
>gb|CA648979.1|CA648979 wre1n.pk0136.d5 wre1n Triticum aestivum cDNA clone wre1n.pk0136.d5
5' end, mRNA sequence
Length = 317
Score = 168 bits (85), Expect = 3e-040
Identities = 133/149 (89%)
Strand = Plus / Minus
Query: 129 gacgacggcctttgtctggaggtagttgcggagggcgtagatgcccttctcccgcccgac 188
|||||||||||| |||||||||||||||| |||| |||| ||||||||||||||| ||
Sbjct: 161 gacgacggccttggtctggaggtagttgccgaggctgtaggcgcccttctcccgccccac 102
Query: 189 gccgctcatcttgtagccgccgaacgggatggtggcgtcgaacacgtcgtagcagttcac 248
||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||| ||
Sbjct: 101 gccgctcatcttgtacccgccgaaggggatggccgcgtcgaacacgtcgtagcagttgac 42
Query: 249 ccacacggtgcccgcccgcagcgcccgcg 277
|||||| || ||| ||| |||||||||||
Sbjct: 41 ccacaccgtccccaccctcagcgcccgcg 13
>gb|CA483821.1|CA483821 WHE3205_G02_M03ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE3205_G02_M03, mRNA sequence
Length = 447
Score = 135 bits (68), Expect = 4e-030
Identities = 159/188 (84%), Gaps = 1/188 (0%)
Strand = Plus / Minus
Query: 493 ccgccggcgacgagggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttg 552
||||||| ||||||||||| |||||||||||||| |||| ||||| | || ||||||
Sbjct: 447 ccgccggtcacgagggtggcgccgctgtcgacgcccgacttgacgtagcccaggatcttc 388
Query: 553 ttgaattgctcgccgtcgatctgaggcccctgttcgaccccgtccctgaaggggtcgccg 612
||||| |||| ||| ||||||||||| ||||| || || || | | ||||||||||||||
Sbjct: 387 ttgaactgctggccatcgatctgaggtccctgctcaacacctttcttgaaggggtcgccg 328
Query: 613 acgacgcg-cttagggcgcgggccttggacttctccacgaactcgtcgtacacgcgctcg 671
|| || || || ||||||| ||||||||||||||||||||||||||||| |||| ||||
Sbjct: 327 accacacgcctctgggcgcgagccttggacttctccacgaactcgtcgtagacgctctcg 268
Query: 672 tgcacgaa 679
|| |||||
Sbjct: 267 tggacgaa 260
>gb|BE427048.1|BE427048 PSR6344 ITEC PSR Wheat Endosperm Library Triticum aestivum cDNA
clone PSR6344, mRNA sequence
Length = 640
Score = 97.6 bits (49), Expect = 1e-018
Identities = 112/133 (84%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 236 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcgtc 177
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 176 aaagatgtcgaagcagttcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 117
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 116 ggccgtgtccagg 104
>gb|BE517898.1|BE517898 WHE0804_E10_J20ZS Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0804_E10_J20, mRNA sequence
Length = 510
Score = 97.6 bits (49), Expect = 1e-018
Identities = 112/133 (84%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 149 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcgtc 90
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 89 aaagatgtcgaagcagttcacccagaccgtgccagccctgagggcacgcgtcaaggtgtt 30
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 29 ggccgtgtccagg 17
>gb|CK162267.1|CK162267 FGAS014856 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1093
Score = 97.6 bits (49), Expect = 1e-018
Identities = 112/133 (84%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 708 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcgtc 649
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 648 aaagatgtcgaagcagttcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 589
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 588 ggccgtgtccagg 576
>gb|CV767923.1|CV767923 FGAS062314 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 780
Score = 97.6 bits (49), Expect = 1e-018
Identities = 112/133 (84%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 345 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcgtc 286
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 285 aaagatgtcgaagcagttcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 226
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 225 ggccgtgtccagg 213
>gb|CK208092.1|CK208092 FGAS019773 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1145
Score = 89.7 bits (45), Expect = 2e-016
Identities = 111/133 (83%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | || |||
Sbjct: 401 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggtgtc 342
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 341 aaagatgtcgaagcagttcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 282
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 281 ggccgtgtccagg 269
>gb|BQ236021.1|BQ236021 TaE05039E01F TaE05 Triticum aestivum cDNA clone TaE05039E01F, mRNA
sequence
Length = 641
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 429 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 488
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 489 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 548
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 549 gccgtgtccagg 560
>gb|CA500108.1|CA500108 WHE4015_E02_J03ZT Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4015_E02_J03, mRNA sequence
Length = 518
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 495 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 436
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 435 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 376
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 375 gccgtgtccagg 364
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| ||||||||||||
Sbjct: 159 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttgaattgctcg 100
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 99 tcatcaatctgaggaccctg 80
>gb|CA601721.1|CA601721 wr1.pk0005.d6 wr1 Triticum aestivum cDNA clone wr1.pk0005.d6 5'
end, mRNA sequence
Length = 477
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 146 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 87
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 86 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 27
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 26 gccgtgtccagg 15
>gb|CA691011.1|CA691011 wlm96.pk053.k5 wlm96 Triticum aestivum cDNA clone wlm96.pk053.k5 5'
end, mRNA sequence
Length = 508
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 346 atgcccttctccctaccgatgccgctcatcttgtaaccgccgaaggggatcgccgcgtcg 287
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 286 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 227
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 226 gccgtgtccagg 215
>gb|CA708398.1|CA708398 wdk2c.pk009.e12 wdk2c Triticum aestivum cDNA clone wdk2c.pk009.e12
5' end, mRNA sequence
Length = 515
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 206 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 147
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 146 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 87
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 86 gccgtgtccagg 75
>gb|CD881507.1|CD881507 F1.103H07F010329 F1 Triticum aestivum cDNA clone F1103H07, mRNA
sequence
Length = 494
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 174 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 115
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 114 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 55
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 54 gccgtgtccagg 43
>gb|CD884204.1|CD884204 F1.115O08F010507 F1 Triticum aestivum cDNA clone F1115O08, mRNA
sequence
Length = 544
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 376 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 317
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 316 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 257
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 256 gccgtgtccagg 245
>gb|CD891228.1|CD891228 G118.116K03F010723 G118 Triticum aestivum cDNA clone G118116K03,
mRNA sequence
Length = 678
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 630 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 571
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 570 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 511
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 510 gccgtgtccagg 499
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| ||||||||||||
Sbjct: 294 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttgaattgctcg 235
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 234 tcatcaatctgaggaccctg 215
>gb|CD891229.1|CD891229 G118.116K03R010926 G118 Triticum aestivum cDNA clone G118116K03,
mRNA sequence
Length = 549
Score = 87.7 bits (44), Expect = 9e-016
Identities = 110/132 (83%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 303 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 362
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 363 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 422
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 423 gccgggtccagg 434
>gb|BJ261855.1|BJ261855 BJ261855 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh4n18 3', mRNA sequence
Length = 655
Score = 83.8 bits (42), Expect = 1e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 307 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 366
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 367 gaanatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 426
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 427 ggccgtgtccagg 439
>gb|CN008984.1|CN008984 WHE2647_D12_H23ZE Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2647_D12_H23,
mRNA sequence
Length = 450
Score = 83.8 bits (42), Expect = 1e-014
Identities = 84/98 (85%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 122 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcgtc 63
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgccc 265
|| | |||| ||||||||||||| || ||||| ||||
Sbjct: 62 aaagatgtcgaagcagttcacccagaccgtgccggccc 25
>gb|BE637823.1|BE637823 WHE1755-1758_B13_B13ZS Wheat pre-anthesis spike cDNA library
Triticum aestivum cDNA clone WHE1755-1758_B13_B13, mRNA
sequence
Length = 516
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 378 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 319
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 318 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 259
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 258 ggccgtgtccagg 246
>gb|BJ248567.1|BJ248567 BJ248567 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf7a01 5', mRNA sequence
Length = 427
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 185 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 126
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 125 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 66
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 65 ggccgtgtccagg 53
>gb|BJ252639.1|BJ252639 BJ252639 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf25e15 3', mRNA sequence
Length = 640
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 415 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 474
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 475 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 534
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 535 ggccgtgtccagg 547
>gb|BJ254780.1|BJ254780 BJ254780 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf7a01 3', mRNA sequence
Length = 518
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 374 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 433
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 434 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 493
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 494 ggccgtgtccagg 506
>gb|BJ265969.1|BJ265969 BJ265969 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh24e03 3', mRNA sequence
Length = 632
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 178 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 237
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 238 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 297
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 298 ggccgtgtccagg 310
Score = 40.1 bits (20), Expect = 0.19
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 541 cgcaagatcttgttgaattgctcgccgtcgatctgaggcccctg 584
||||||||||| ||||||||||| | || |||||||| |||||
Sbjct: 551 cgcaagatcttcttgaattgctcatcatcaatctgaggaccctg 594
>gb|BJ276946.1|BJ276946 BJ276946 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh27d20 3', mRNA sequence
Length = 741
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 291 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 350
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 351 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 410
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 411 ggccgtgtccagg 423
Score = 40.1 bits (20), Expect = 0.19
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 541 cgcaagatcttgttgaattgctcgccgtcgatctgaggcccctg 584
||||||||||| ||||||||||| | || |||||||| |||||
Sbjct: 664 cgcaagatcttcttgaattgctcatcatcaatctgaggaccctg 707
>gb|BJ286162.1|BJ286162 BJ286162 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr19i17 3', mRNA sequence
Length = 535
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 277 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 336
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 337 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 396
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 397 ggccgtgtccagg 409
>gb|BJ317994.1|BJ317994 BJ317994 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf6h06 3', mRNA sequence
Length = 660
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 289 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 348
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 349 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 408
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 409 ggccgtgtccagg 421
>gb|BJ320254.1|BJ320254 BJ320254 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf14d24 3', mRNA sequence
Length = 645
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 291 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 350
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 351 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 410
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 411 ggccgtgtccagg 423
>gb|BQ246038.1|BQ246038 TaE15016H06R TaE15 Triticum aestivum cDNA clone TaE15016H06R, mRNA
sequence
Length = 607
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 585 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 526
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 525 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 466
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 465 ggccgtgtccagg 453
Score = 40.1 bits (20), Expect = 0.19
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 541 cgcaagatcttgttgaattgctcgccgtcgatctgaggcccctg 584
||||||||||| ||||||||||| | || |||||||| |||||
Sbjct: 212 cgcaagatcttcttgaattgctcatcatcaatctgaggaccctg 169
>gb|AL819641.1|AL819641 AL819641 n:129 Triticum aestivum cDNA clone C07_n129_plate_2, mRNA
sequence
Length = 456
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 238 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 179
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 178 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 119
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 118 ggccgtgtccagg 106
>gb|CD890050.1|CD890050 G118.113M02F010716 G118 Triticum aestivum cDNA clone G118113M02,
mRNA sequence
Length = 562
Score = 81.8 bits (41), Expect = 6e-014
Identities = 111/133 (83%), Gaps = 1/133 (0%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| ||||| || ||||| | ||||||
Sbjct: 288 gatgcccttctccctaccgatgccgctcatcttgtacccgcc-aaggggatcgcggcgtc 230
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
|| | |||| ||||||||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 229 aaagatgtcgaagcagttcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 170
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 169 ggccgtgtccagg 157
>gb|CD891244.1|CD891244 G118.116K12R010926 G118 Triticum aestivum cDNA clone G118116K12,
mRNA sequence
Length = 724
Score = 81.8 bits (41), Expect = 6e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 330 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 389
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 390 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 449
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 450 ggccgtgtccagg 462
>gb|AL809175.1|AL809175 AL809175 a:11 Triticum aestivum cDNA clone E12_a11_plate_13, mRNA
sequence
Length = 530
Score = 77.8 bits (39), Expect = 9e-013
Identities = 72/83 (86%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||||||
Sbjct: 266 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggatcgccgcgtcg 207
Query: 229 aacacgtcgtagcagttcaccca 251
|| | |||| |||||||||||||
Sbjct: 206 aagatgtcgaagcagttcaccca 184
>gb|BJ246690.1|BJ246690 BJ246690 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf25e15 5', mRNA sequence
Length = 409
Score = 75.8 bits (38), Expect = 4e-012
Identities = 109/133 (81%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| || | ||||||||||||||| |||||||| ||||| | |||||
Sbjct: 200 gatgcccttctccctaccnatgccgctcatcttgtacccgccgaaggggatcgccgcgtc 141
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| |||| |||||||| || ||||| |||| || || |||| || ||||||
Sbjct: 140 gaagatgtcaaagcaattcacccagaccgtgccggccctgagggcacgcgtcaaggtgtt 81
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 80 ggccgtgtccagg 68
>gb|BE430423.1|BE430423 SUN002.H01R991208 ITEC SUN Wheat cDNA Library Triticum aestivum
cDNA clone SUN002.H01, mRNA sequence
Length = 628
Score = 71.9 bits (36), Expect = 5e-011
Identities = 109/132 (82%), Gaps = 1/132 (0%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| ||||||||||| ||| |||||||| ||||| | ||||||
Sbjct: 306 atgcccttctccctaccgatgccgctcatct-gtatccgccgaaggggatcgccgcgtcg 364
Query: 229 aacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttg 288
|| | |||| ||||||||||||| || || || |||| || || |||| || |||||||
Sbjct: 365 aagatgtcgaagcagttcacccagacagtcccggccctgagggcacgcgtcaaggtgttg 424
Query: 289 gccgcgtccagg 300
|||| |||||||
Sbjct: 425 gccgtgtccagg 436
>gb|CA722685.1|CA722685 wds1c.pk004.e6.f wds1c Triticum monococcum cDNA clone
wds1c.pk004.e6.f 3' end, mRNA sequence
Length = 510
Score = 71.9 bits (36), Expect = 5e-011
Identities = 71/83 (85%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcg 228
||||||||||||| |||| |||||| |||||||| |||||||| ||||| | ||||||
Sbjct: 386 atgcccttctccctaccgatgccgctnatcttgtatccgccgaaggggatcgccgcgtcg 445
Query: 229 aacacgtcgtagcagttcaccca 251
|| | |||| |||||||||||||
Sbjct: 446 aagatgtcgaagcagttcaccca 468
>gb|CA681784.1|CA681784 wlm24.pk0023.g2 wlm24 Triticum aestivum cDNA clone wlm24.pk0023.g2
5' end, mRNA sequence
Length = 503
Score = 69.9 bits (35), Expect = 2e-010
Identities = 92/111 (82%)
Strand = Plus / Minus
Query: 190 ccgctcatcttgtagccgccgaacgggatggtggcgtcgaacacgtcgtagcagttcacc 249
|||||||||||||| |||||||| ||||| | |||||||| | |||| |||||||||||
Sbjct: 164 ccgctcatcttgtatccgccgaaggggatcgccgcgtcgaagatgtcgaagcagttcacc 105
Query: 250 cacacggtgcccgcccgcagcgcccgcgacagggtgttggccgcgtccagg 300
|| || || || |||| || || |||| || ||||||||||| |||||||
Sbjct: 104 cagacagtcccggccctgagggcacgcgtcaaggtgttggccgtgtccagg 54
>gb|CA599969.1|CA599969 waw1c.pk004.l6 waw1c Triticum aestivum cDNA clone waw1c.pk004.l6 5'
end, mRNA sequence
Length = 650
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| ||||||||||||
Sbjct: 485 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttgaattgctcg 426
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 425 tcatcaatctgaggaccctg 406
>gb|CA670728.1|CA670728 wlsu1.pk027.j3 wlsu1 Triticum aestivum cDNA clone wlsu1.pk027.j3 5'
end, mRNA sequence
Length = 437
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| ||||||||||||
Sbjct: 246 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttgaattgctcg 187
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 186 tcatcaatctgaggaccctg 167
>gb|CA697243.1|CA697243 wlk4.pk0018.g5 wlk4 Triticum aestivum cDNA clone wlk4.pk0018.g5 5'
end, mRNA sequence
Length = 628
Score = 61.9 bits (31), Expect = 5e-008
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggat 218
|||||||||||||| |||| ||||||||||||||| |||||||| |||||
Sbjct: 314 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggat 364
>gb|CD373577.1|CD373577 WHE0425_B12_C23ZT CS wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0425_B12_C23, mRNA
sequence
Length = 509
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggat 218
||||||||||||| |||| ||||||||||||||| |||||||| |||||
Sbjct: 455 atgcccttctccctaccgatgccgctcatcttgtatccgccgaaggggat 504
>gb|CD883176.1|CD883176 F1.112H18R010627 F1 Triticum aestivum cDNA clone F1112H18, mRNA
sequence
Length = 501
Score = 58.0 bits (29), Expect = 8e-007
Identities = 77/93 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||| ||| |||||||| ||||| | |||||
Sbjct: 407 gatgcccttctccctaccgatgccgctcatctggtacccgccgaaggggatcgccgcgtc 466
Query: 228 gaacacgtcgtagcagttcacccacacggtgcc 260
||| | ||| |||| |||||||| || |||||
Sbjct: 467 gaagatgtcaaagcaattcacccagaccgtgcc 499
>gb|BE406481.1|BE406481 WHE0416_h10_p20zB Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0416_h10_p20, mRNA
sequence
Length = 386
Score = 56.0 bits (28), Expect = 3e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| || |||||||||
Sbjct: 96 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttaaattgctcg 37
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 36 tcatcaatctgagggccctg 17
Score = 46.1 bits (23), Expect = 0.003
Identities = 56/67 (83%)
Strand = Plus / Minus
Query: 234 gtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttggccgc 293
|||| ||||||||||||| || ||||| |||| || || |||| || |||||||||||
Sbjct: 367 gtcgaagcagttcacccagaccgtgccagccctgagggcacgcgtcaaggtgttggccgt 308
Query: 294 gtccagg 300
|||||||
Sbjct: 307 gtccagg 301
>gb|CA499319.1|CA499319 WHE4006_A08_A16ZT Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4006_A08_A16, mRNA sequence
Length = 594
Score = 56.0 bits (28), Expect = 3e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || ||||| || || |||| || ||||||||||||||| || |||||||||
Sbjct: 551 agggtggctccactgtccacacccgacttaatgtaccgcaagatcttcttaaattgctcg 492
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 491 tcatcaatctgagggccctg 472
>gb|CA739097.1|CA739097 wpi2s.pk009.d1 wpi2s Triticum aestivum cDNA clone wpi2s.pk009.d1 5'
end, mRNA sequence
Length = 173
Score = 56.0 bits (28), Expect = 3e-006
Identities = 79/96 (82%)
Strand = Plus / Minus
Query: 205 ccgccgaacgggatggtggcgtcgaacacgtcgtagcagttcacccacacggtgcccgcc 264
|||||||| ||||| | |||||| || | |||| ||||||||||||| || ||||| |||
Sbjct: 148 ccgccgaaggggatcgcggcgtcaaagatgtcgaagcagttcacccagaccgtgccggcc 89
Query: 265 cgcagcgcccgcgacagggtgttggccgcgtccagg 300
| || || |||| || ||||||||||| |||||||
Sbjct: 88 ctgagggcacgcgtcaaggtgttggccgtgtccagg 53
>gb|BQ238330.1|BQ238330 TaE05005E05F TaE05 Triticum aestivum cDNA clone TaE05005E05F, mRNA
sequence
Length = 621
Score = 50.1 bits (25), Expect = 2e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 366 ccgaagccgctcatcttgcagccgccgaacggg 398
>gb|CA600060.1|CA600060 waw1c.pk004.c22 waw1c Triticum aestivum cDNA clone waw1c.pk004.c22
5' end, mRNA sequence
Length = 666
Score = 50.1 bits (25), Expect = 2e-004
Identities = 93/117 (79%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcgaacacgtcgtagcag 243
|||| ||||||||||||||| |||||||| ||||| | |||||||| | ||| ||||
Sbjct: 663 ccgatgccgctcatcttgtacccgccgaaggggatcgccgcgtcgaagatgtcaaagcaa 604
Query: 244 ttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttggccgcgtccagg 300
|||||||| || ||||| | || || |||| || ||||||||||| |||||||
Sbjct: 603 ttcacccagaccgtgccggnnnngagggcacgcgtcaaggtgttggccgtgtccagg 547
Score = 40.1 bits (20), Expect = 0.19
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 541 cgcaagatcttgttgaattgctcgccgtcgatctgaggcccctg 584
||||||||||| ||||||||||| | || |||||||| |||||
Sbjct: 306 cgcaagatcttcttgaattgctcatcatcaatctgaggaccctg 263
>gb|CD454866.1|CD454866 WHE955_F06_K11ZT CS wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE955_F06_K11, mRNA sequence
Length = 699
Score = 50.1 bits (25), Expect = 2e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 240 ccgaagccgctcatcttgcagccgccgaacggg 272
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 216,049
Number of Sequences: 636343
Number of extensions: 216049
Number of successful extensions: 59155
Number of sequences better than 0.5: 117
Number of HSP's better than 0.5 without gapping: 117
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58868
Number of HSP's gapped (non-prelim): 279
length of query: 679
length of database: 367,240,239
effective HSP length: 19
effective length of query: 660
effective length of database: 355,149,722
effective search space: 234398816520
effective search space used: 234398816520
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)