BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2448720.2.1
         (510 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CA497356.1|CA497356  WHE3226_E01_I02ZT Wheat meiotic anth...    98   7e-019
gb|CD898343.1|CD898343  G174.108N06F010821 G174 Triticum aes...    98   7e-019
gb|CD898344.1|CD898344  G174.108N06R011121 G174 Triticum aes...    98   7e-019
gb|AL829970.1|AL829970  AL829970 q:343 Triticum aestivum cDN...    68   6e-010

>gb|CA497356.1|CA497356 WHE3226_E01_I02ZT Wheat meiotic anther cDNA library Triticum
           aestivum cDNA clone WHE3226_E01_I02, mRNA sequence
          Length = 487

 Score = 97.6 bits (49), Expect = 7e-019
 Identities = 124/149 (83%)
 Strand = Plus / Plus

                                                                       
Query: 12  tcgctcgacaacgttggtgtctggaatctgcgcgccgaaaggctggatgactggtacaga 71
           |||||||||||||| ||  |||||||| | || ||||||| ||||||  | |||||||  
Sbjct: 88  tcgctcgacaacgtaggcatctggaatatacgtgccgaaaagctggacaattggtacaat 147

                                                                       
Query: 72  gggcaggaggtctatgtgaaggttgccgatccactgggctacaacatcaccgagatggtc 131
           ||||| ||||| |||||||| ||||| |||||||||||||||||| ||||||| ||| ||
Sbjct: 148 gggcaagaggtttatgtgaaagttgctgatccactgggctacaacgtcaccgaaatgatc 207

                                        
Query: 132 gtcccggacaatgccctctactgtggtct 160
           |  || |||||  | ||||||||||||||
Sbjct: 208 gctccagacaacactctctactgtggtct 236



>gb|CD898343.1|CD898343 G174.108N06F010821 G174 Triticum aestivum cDNA clone G174108N06,
           mRNA sequence
          Length = 697

 Score = 97.6 bits (49), Expect = 7e-019
 Identities = 124/149 (83%)
 Strand = Plus / Plus

                                                                       
Query: 12  tcgctcgacaacgttggtgtctggaatctgcgcgccgaaaggctggatgactggtacaga 71
           |||||||||||||| ||  |||||||| | || ||||||| ||||||  | |||||||  
Sbjct: 434 tcgctcgacaacgtaggcatctggaatatacgtgccgaaaagctggacaattggtacaat 493

                                                                       
Query: 72  gggcaggaggtctatgtgaaggttgccgatccactgggctacaacatcaccgagatggtc 131
           ||||| ||||| |||||||| ||||| |||||||||||||||||| ||||||| ||| ||
Sbjct: 494 gggcaagaggtttatgtgaaagttgctgatccactgggctacaacgtcaccgaaatgatc 553

                                        
Query: 132 gtcccggacaatgccctctactgtggtct 160
           |  || |||||  | ||||||||||||||
Sbjct: 554 gctccagacaacactctctactgtggtct 582



>gb|CD898344.1|CD898344 G174.108N06R011121 G174 Triticum aestivum cDNA clone G174108N06,
           mRNA sequence
          Length = 592

 Score = 97.6 bits (49), Expect = 7e-019
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 12  tcgctcgacaacgttggtgtctggaatctgcgcgccgaaaggctggatgactggtacaga 71
           |||||||||||||| ||  |||||||| | || ||||||| ||||||  | |||||||  
Sbjct: 421 tcgctcgacaacgtaggcatctggaatatacgtgccgaaaagctggacaattggtacaat 362

                                                                       
Query: 72  gggcaggaggtctatgtgaaggttgccgatccactgggctacaacatcaccgagatggtc 131
           ||||| ||||| |||||||| ||||| |||||||||||||||||| ||||||| ||| ||
Sbjct: 361 gggcaagaggtttatgtgaaagttgctgatccactgggctacaacgtcaccgaaatgatc 302

                                        
Query: 132 gtcccggacaatgccctctactgtggtct 160
           |  || |||||  | ||||||||||||||
Sbjct: 301 gctccagacaacactctctactgtggtct 273



>gb|AL829970.1|AL829970 AL829970 q:343 Triticum aestivum cDNA clone A11_q343_plate_11, mRNA
           sequence
          Length = 420

 Score = 67.9 bits (34), Expect = 6e-010
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 63  tggtacagagggcaggaggtctatgtgaaggttgccgatccactgggctacaacatcacc 122
           |||||||  ||||| ||||| |||||||| ||||| |||||||||||||||||| |||||
Sbjct: 42  tggtacaatgggcaagaggtttatgtgaaagttgctgatccactgggctacaacgtcacc 101

                                                 
Query: 123 gagatggtcgtcccggacaatgccctctactgtggtct 160
           || ||| |||  ||  ||||  | ||||||||||||||
Sbjct: 102 gaaatgatcgctccaaacaacactctctactgtggtct 139



  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 88,187
Number of Sequences: 636343
Number of extensions: 88187
Number of successful extensions: 22091
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22082
Number of HSP's gapped (non-prelim): 9
length of query: 510
length of database: 367,240,239
effective HSP length: 19
effective length of query: 491
effective length of database: 355,149,722
effective search space: 174378513502
effective search space used: 174378513502
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)