BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2430769.2.1
(617 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA619594.1|CA619594 wl1n.pk0048.h7 wl1n Triticum aestivu... 676 0.0
gb|CA620233.1|CA620233 wl1n.pk0053.b8 wl1n Triticum aestivu... 176 1e-042
gb|BF474477.1|BF474477 WHE0844_E05_J10ZS Wheat vernalized c... 143 2e-032
gb|BQ247189.1|BQ247189 TaE15028C03R TaE15 Triticum aestivum... 143 2e-032
gb|AL820289.1|AL820289 AL820289 N:130 Triticum aestivum cDN... 143 2e-032
gb|CD877326.1|CD877326 AZO4.100B06R011121 AZO4 Triticum aes... 143 2e-032
gb|CK197926.1|CK197926 FGAS006406 Triticum aestivum FGAS: L... 143 2e-032
gb|CK201781.1|CK201781 FGAS010301 Triticum aestivum FGAS: L... 143 2e-032
gb|CK201455.1|CK201455 FGAS009975 Triticum aestivum FGAS: L... 137 1e-030
gb|CD865655.1|CD865655 AZO2.101G20F010111 AZO2 Triticum aes... 135 4e-030
gb|CD873067.1|CD873067 AZO2.122E17R010522 AZO2 Triticum aes... 135 4e-030
gb|BQ752940.1|BQ752940 WHE4120_H12_P24ZS Wheat salt-stresse... 129 2e-028
gb|CA623700.1|CA623700 wl1n.pk0112.a12 wl1n Triticum aestiv... 125 4e-027
gb|BQ752785.1|BQ752785 WHE4119_B03_D05ZS Wheat salt-stresse... 123 2e-026
gb|CK163799.1|CK163799 FGAS016434 Triticum aestivum FGAS: L... 109 2e-022
gb|BE515791.1|BE515791 WHE0603_F12_L23ZA Wheat ABA-treated ... 105 4e-021
gb|AL828304.1|AL828304 AL828304 p:436 Triticum aestivum cDN... 105 4e-021
gb|CA605944.1|CA605944 wr1.pk0059.c8 wr1 Triticum aestivum ... 105 4e-021
gb|CA614966.1|CA614966 wr1.pk149.h5 wr1 Triticum aestivum c... 105 4e-021
gb|CA631337.1|CA631337 wle1n.pk0044.a4 wle1n Triticum aesti... 105 4e-021
gb|CA633904.1|CA633904 wle1n.pk0080.b11 wle1n Triticum aest... 105 4e-021
gb|CA641009.1|CA641009 wre1n.pk0042.g4 wre1n Triticum aesti... 105 4e-021
gb|CA661371.1|CA661371 wlmk1.pk0002.b1 wlmk1 Triticum aesti... 105 4e-021
gb|CA685905.1|CA685905 wlm96.pk031.c6 wlm96 Triticum aestiv... 105 4e-021
gb|CA694892.1|CA694892 wlmk4.pk0021.b9 wlmk4 Triticum aesti... 105 4e-021
gb|CD869949.1|CD869949 AZO2.113A21R010522 AZO2 Triticum aes... 105 4e-021
gb|CD934107.1|CD934107 GR45.123A08R010830 GR45 Triticum aes... 105 4e-021
gb|CK161647.1|CK161647 FGAS014218 Triticum aestivum FGAS: L... 105 4e-021
gb|CK195040.1|CK195040 FGAS003478 Triticum aestivum FGAS: L... 105 4e-021
gb|CK196910.1|CK196910 FGAS005379 Triticum aestivum FGAS: L... 105 4e-021
gb|CK200887.1|CK200887 FGAS009404 Triticum aestivum FGAS: L... 105 4e-021
gb|CK201231.1|CK201231 FGAS009750 Triticum aestivum FGAS: L... 105 4e-021
gb|CD883740.1|CD883740 F1.114E16F010504 F1 Triticum aestivu... 101 6e-020
gb|CA609627.1|CA609627 wr1.pk0108.g9 wr1 Triticum aestivum ... 100 2e-019
gb|CD883741.1|CD883741 F1.114E16R010702 F1 Triticum aestivu... 100 2e-019
gb|CK195652.1|CK195652 FGAS004094 Triticum aestivum FGAS: L... 100 2e-019
gb|CK195971.1|CK195971 FGAS004417 Triticum aestivum FGAS: L... 100 2e-019
gb|AJ614420.1|AJ614420 AJ614420 Triticum turgidum subsp. du... 100 2e-019
gb|BE405628.1|BE405628 WHE1209_E08_I15ZS Wheat etiolated se... 98 9e-019
gb|BE415413.1|BE415413 MWL030.B02000309 ITEC MWL Wheat Root... 98 9e-019
gb|CA635573.1|CA635573 wle1n.pk0094.b2 wle1n Triticum aesti... 98 9e-019
gb|CA641947.1|CA641947 wre1n.pk0051.d3 wre1n Triticum aesti... 98 9e-019
gb|CA644868.1|CA644868 wre1n.pk0092.h5 wre1n Triticum aesti... 98 9e-019
gb|CA682723.1|CA682723 wlm96.pk0004.g12 wlm96 Triticum aest... 98 9e-019
gb|CA685706.1|CA685706 wlm96.pk030.i1 wlm96 Triticum aestiv... 98 9e-019
gb|CA694712.1|CA694712 wlmk4.pk0024.c11 wlmk4 Triticum aest... 98 9e-019
gb|CA697734.1|CA697734 wlk4.pk0010.d12 wlk4 Triticum aestiv... 98 9e-019
gb|CD867866.1|CD867866 AZO2.107G06F001110 AZO2 Triticum aes... 98 9e-019
gb|CD879592.1|CD879592 AZO4.105M02R011123 AZO4 Triticum aes... 98 9e-019
gb|CD895488.1|CD895488 G174.001P13R011120 G174 Triticum aes... 98 9e-019
gb|CD930762.1|CD930762 GR45.112E24R010612 GR45 Triticum aes... 98 9e-019
gb|CD939543.1|CD939543 OV.113O24R010410 OV Triticum aestivu... 98 9e-019
gb|CV764457.1|CV764457 FGAS058842 Triticum aestivum FGAS: L... 98 9e-019
gb|CV774181.1|CV774181 FGAS068578 Triticum aestivum FGAS: L... 98 9e-019
gb|DR739329.1|DR739329 FGAS084546 Triticum aestivum FGAS: L... 98 9e-019
gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis,... 98 9e-019
gb|CA649402.1|CA649402 wre1n.pk0142.e3 wre1n Triticum aesti... 94 1e-017
gb|CD866963.1|CD866963 AZO2.104O24F001123 AZO2 Triticum aes... 94 1e-017
gb|CD869948.1|CD869948 AZO2.113A21F010115 AZO2 Triticum aes... 92 5e-017
gb|CK162427.1|CK162427 FGAS015021 Triticum aestivum FGAS: L... 92 5e-017
gb|CK162943.1|CK162943 FGAS015551 Triticum aestivum FGAS: L... 92 5e-017
gb|CK193235.1|CK193235 FGAS001649 Triticum aestivum FGAS: L... 92 5e-017
gb|CK193277.1|CK193277 FGAS001691 Triticum aestivum FGAS: L... 92 5e-017
gb|CK195388.1|CK195388 FGAS003827 Triticum aestivum FGAS: L... 92 5e-017
gb|CN009676.1|CN009676 WHE3861_E01_J01ZS Wheat Fusarium gra... 92 5e-017
gb|CV764357.1|CV764357 FGAS058742 Triticum aestivum FGAS: L... 92 5e-017
gb|CV771145.1|CV771145 FGAS065538 Triticum aestivum FGAS: L... 92 5e-017
gb|AL827928.1|AL827928 AL827928 p:739 Triticum aestivum cDN... 90 2e-016
gb|CA602858.1|CA602858 wr1.pk0007.a3 wr1 Triticum aestivum ... 90 2e-016
gb|CD937203.1|CD937203 OV.106E20R010430 OV Triticum aestivu... 90 2e-016
gb|CK212315.1|CK212315 FGAS024186 Triticum aestivum FGAS: L... 90 2e-016
gb|CK215844.1|CK215844 FGAS027816 Triticum aestivum FGAS: L... 90 2e-016
gb|BE415414.1|BE415414 MWL030.B03000309 ITEC MWL Wheat Root... 88 8e-016
gb|CK200366.1|CK200366 FGAS008879 Triticum aestivum FGAS: L... 88 8e-016
gb|CD864630.1|CD864630 AZO2.001G09F000711 AZO2 Triticum aes... 86 3e-015
gb|CD873066.1|CD873066 AZO2.122E17F010208 AZO2 Triticum aes... 86 3e-015
gb|CK197247.1|CK197247 FGAS005718 Triticum aestivum FGAS: L... 86 3e-015
gb|CK213384.1|CK213384 FGAS025293 Triticum aestivum FGAS: L... 86 3e-015
gb|AJ612197.1|AJ612197 AJ612197 Triticum turgidum subsp. du... 86 3e-015
gb|CN010817.1|CN010817 WHE3876_E12_I24ZS Wheat Fusarium gra... 86 3e-015
gb|CV764273.1|CV764273 FGAS058658 Triticum aestivum FGAS: L... 86 3e-015
gb|CV765249.1|CV765249 FGAS059634 Triticum aestivum FGAS: L... 86 3e-015
gb|DR738077.1|DR738077 FGAS083294 Triticum aestivum FGAS: L... 86 3e-015
gb|BE405650.1|BE405650 WHE1209_G06_M11ZS Wheat etiolated se... 84 1e-014
gb|BQ752659.1|BQ752659 WHE4117_F07_K13ZS Wheat salt-stresse... 84 1e-014
gb|CA605016.1|CA605016 wr1.pk0050.c7 wr1 Triticum aestivum ... 84 1e-014
gb|CA635313.1|CA635313 wle1n.pk0097.a10 wle1n Triticum aest... 84 1e-014
gb|CA646451.1|CA646451 wre1n.pk0095.h11 wre1n Triticum aest... 84 1e-014
gb|CD864631.1|CD864631 AZO2.001G10F000627 AZO2 Triticum aes... 84 1e-014
gb|CV774693.1|CV774693 FGAS069093 Triticum aestivum FGAS: L... 84 1e-014
gb|CV781637.1|CV781637 FGAS076049 Triticum aestivum FGAS: L... 84 1e-014
gb|DR735704.1|DR735704 FGAS081338 Triticum aestivum FGAS: L... 84 1e-014
gb|CK200172.1|CK200172 FGAS008679 Triticum aestivum FGAS: L... 82 5e-014
gb|CD930335.1|CD930335 GR45.110P22F010418 GR45 Triticum aes... 78 8e-013
gb|CK216386.1|CK216386 FGAS028375 Triticum aestivum FGAS: L... 78 8e-013
gb|AJ615461.1|AJ615461 AJ615461 Triticum turgidum subsp. du... 78 8e-013
gb|CV762818.1|CV762818 FGAS057207 Triticum aestivum FGAS: L... 78 8e-013
gb|CV781850.1|CV781850 FGAS076263 Triticum aestivum FGAS: L... 78 8e-013
gb|BF474987.1|BF474987 WHE2104_D09_H18ZS Wheat salt-stresse... 76 3e-012
gb|BQ752791.1|BQ752791 WHE4119_B10_D19ZS Wheat salt-stresse... 76 3e-012
gb|BQ788936.1|BQ788936 WHE4155_E05_I09ZS Wheat CS whole pla... 76 3e-012
gb|BQ838311.1|BQ838311 WHE2909_A01_A01ZS Wheat aluminum-str... 76 3e-012
gb|CA613164.1|CA613164 wr1.pk0147.e6 wr1 Triticum aestivum ... 76 3e-012
gb|CA622785.1|CA622785 wl1n.pk0099.g2 wl1n Triticum aestivu... 76 3e-012
gb|CA630115.1|CA630115 wle1n.pk0014.d12 wle1n Triticum aest... 76 3e-012
gb|CA640114.1|CA640114 wre1n.pk0031.h7 wre1n Triticum aesti... 76 3e-012
gb|CD878426.1|CD878426 AZO4.102L12F010930 AZO4 Triticum aes... 76 3e-012
gb|CD885596.1|CD885596 G118.001O10F010305 G118 Triticum aes... 76 3e-012
gb|CD885623.1|CD885623 G118.001P09F010305 G118 Triticum aes... 76 3e-012
gb|CD937240.1|CD937240 OV.106G10F010205 OV Triticum aestivu... 76 3e-012
gb|CD939542.1|CD939542 OV.113O24F010312 OV Triticum aestivu... 76 3e-012
gb|CK195394.1|CK195394 FGAS003833 Triticum aestivum FGAS: L... 76 3e-012
gb|CK199240.1|CK199240 FGAS007734 Triticum aestivum FGAS: L... 76 3e-012
gb|CK200458.1|CK200458 FGAS008972 Triticum aestivum FGAS: L... 76 3e-012
gb|CK210051.1|CK210051 FGAS021842 Triticum aestivum FGAS: L... 76 3e-012
gb|CK213716.1|CK213716 FGAS025626 Triticum aestivum FGAS: L... 76 3e-012
gb|CK213734.1|CK213734 FGAS025645 Triticum aestivum FGAS: L... 76 3e-012
gb|CN009001.1|CN009001 WHE2647_F08_L15ZE Wheat Fusarium gra... 76 3e-012
gb|CN010185.1|CN010185 WHE3867_G01_M01ZS Wheat Fusarium gra... 76 3e-012
gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, ... 76 3e-012
gb|BE404145.1|BE404145 WHE1201_G04_M07ZS Wheat etiolated se... 74 1e-011
gb|BE413688.1|BE413688 SCU002.A03.R990714 ITEC SCU Wheat En... 74 1e-011
gb|BE423372.1|BE423372 WHE0065_D03_H05ZS Wheat endosperm cD... 74 1e-011
gb|BQ606397.1|BQ606397 BRY_2256 wheat EST endosperm library... 74 1e-011
gb|CA497305.1|CA497305 WHE3225_F04_K07ZT Wheat meiotic anth... 74 1e-011
gb|BQ167390.1|BQ167390 WHE0065_D03_H05ZK Cheyenne wheat end... 74 1e-011
gb|CD868552.1|CD868552 AZO2.109E03F001114 AZO2 Triticum aes... 74 1e-011
gb|CD868553.1|CD868553 AZO2.109E03R010329 AZO2 Triticum aes... 74 1e-011
gb|CD898674.1|CD898674 G174.109L21R011122 G174 Triticum aes... 74 1e-011
gb|CD904272.1|CD904272 G356.112P22F010920 G356 Triticum aes... 74 1e-011
gb|CD904273.1|CD904273 G356.112P22R011029 G356 Triticum aes... 74 1e-011
gb|AJ613139.1|AJ613139 AJ613139 Triticum turgidum subsp. du... 74 1e-011
gb|CV766070.1|CV766070 FGAS060457 Triticum aestivum FGAS: L... 74 1e-011
gb|BU099585.1|BU099585 WHE3309_B09_C17ZS Chinese Spring whe... 72 5e-011
gb|CA628480.1|CA628480 wle1n.pk0003.e8 wle1n Triticum aesti... 72 5e-011
gb|CN011226.1|CN011226 WHE3881_F01_L01ZS Wheat Fusarium gra... 72 5e-011
gb|BQ838107.1|BQ838107 WHE2906_F04_K08ZS Wheat aluminum-str... 70 2e-010
gb|CA615505.1|CA615505 wr1.pk172.b11 wr1 Triticum aestivum ... 70 2e-010
gb|BE403578.1|BE403578 WHE0434_C06_E12ZS Wheat etiolated se... 68 8e-010
gb|BE423595.1|BE423595 WHE0071_A02_A03ZS Wheat endosperm cD... 68 8e-010
gb|BF473218.1|BF473218 WHE0922_H12_O24ZS Wheat 5-15 DAP spi... 68 8e-010
gb|BF484161.1|BF484161 WHE2309_A06_A11ZS Wheat pre-anthesis... 68 8e-010
gb|BQ806305.1|BQ806305 WHE3577_C04_F07ZS Wheat developing g... 68 8e-010
gb|BQ838231.1|BQ838231 WHE2908_A08_B16ZS Wheat aluminum-str... 68 8e-010
gb|BQ838318.1|BQ838318 WHE2909_A11_A21ZS Wheat aluminum-str... 68 8e-010
gb|CA632050.1|CA632050 wle1n.pk0058.d9 wle1n Triticum aesti... 68 8e-010
gb|CA693615.1|CA693615 wlmk4.pk0005.a9 wlmk4 Triticum aesti... 68 8e-010
gb|CD879761.1|CD879761 AZO4.106E16F011012 AZO4 Triticum aes... 68 8e-010
gb|CD930761.1|CD930761 GR45.112E24F010419 GR45 Triticum aes... 68 8e-010
gb|CK162127.1|CK162127 FGAS014712 Triticum aestivum FGAS: L... 68 8e-010
gb|AJ615423.1|AJ615423 AJ615423 Triticum turgidum subsp. du... 68 8e-010
gb|BF473981.1|BF473981 WHE0839_F01_L01ZS Wheat vernalized c... 66 3e-009
gb|BF484400.1|BF484400 WHE2323_A03_B05ZS Wheat pre-anthesis... 66 3e-009
gb|BJ247474.1|BJ247474 BJ247474 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BJ252414.1|BJ252414 BJ252414 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BJ253542.1|BJ253542 BJ253542 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BJ259369.1|BJ259369 BJ259369 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BJ259370.1|BJ259370 BJ259370 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BJ264257.1|BJ264257 BJ264257 Y. Ogihara unpublished cDNA... 66 3e-009
gb|BQ744417.1|BQ744417 WHE4115_D02_H03ZS Wheat salt-stresse... 66 3e-009
gb|CD898525.1|CD898525 G174.109E24R011122 G174 Triticum aes... 66 3e-009
gb|CD899632.1|CD899632 G174.113A24F010828 G174 Triticum aes... 66 3e-009
gb|CD899633.1|CD899633 G174.113A24R011120 G174 Triticum aes... 66 3e-009
gb|CD909627.1|CD909627 G468.113C02R010929 G468 Triticum aes... 66 3e-009
gb|CD911360.1|CD911360 G550.110P03F010521 G550 Triticum aes... 66 3e-009
gb|CD911361.1|CD911361 G550.110P03R010830 G550 Triticum aes... 66 3e-009
gb|CD933865.1|CD933865 GR45.122E06R010831 GR45 Triticum aes... 66 3e-009
gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis,... 66 3e-009
dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative ... 66 3e-009
gb|BE445791.1|BE445791 WHE1453_H01_P01ZS Wheat etiolated se... 64 1e-008
gb|BM068669.1|BM068669 WHE3461_D04_H07ZS Wheat pre-anthesis... 64 1e-008
gb|BM136098.1|BM136098 WHE2602_F07_K14ZS Wheat Fusarium gra... 64 1e-008
gb|AL819807.1|AL819807 AL819807 n:129 Triticum aestivum cDN... 64 1e-008
gb|AL822798.1|AL822798 AL822798 p:335 Triticum aestivum cDN... 64 1e-008
gb|BQ743179.1|BQ743179 WHE4101_C02_E03ZS Wheat salt-stresse... 64 1e-008
gb|BQ743388.1|BQ743388 WHE4103_D08_H15ZS Wheat salt-stresse... 64 1e-008
gb|BQ744183.1|BQ744183 WHE4112_F05_L10ZS Wheat salt-stresse... 64 1e-008
gb|BQ753204.1|BQ753204 WHE4124_C08_F16ZS Wheat salt-stresse... 64 1e-008
gb|BQ788665.1|BQ788665 WHE4152_E01_I02ZS Wheat CS whole pla... 64 1e-008
gb|BQ789135.1|BQ789135 WHE4158_A03_B06ZS Wheat CS whole pla... 64 1e-008
gb|BQ838009.1|BQ838009 WHE2905_E06_I11ZS Wheat aluminum-str... 64 1e-008
gb|CA733178.1|CA733178 wlp1c.pk007.n18 wlp1c Triticum aesti... 64 1e-008
gb|CD895487.1|CD895487 G174.001P13F010514 G174 Triticum aes... 64 1e-008
gb|CK193862.1|CK193862 FGAS002281 Triticum aestivum FGAS: L... 64 1e-008
gb|CK194117.1|CK194117 FGAS002536 Triticum aestivum FGAS: L... 64 1e-008
gb|CK200685.1|CK200685 FGAS009201 Triticum aestivum FGAS: L... 64 1e-008
gb|CK201094.1|CK201094 FGAS009613 Triticum aestivum FGAS: L... 64 1e-008
gb|CK202172.1|CK202172 FGAS010694 Triticum aestivum FGAS: L... 64 1e-008
gb|CK202356.1|CK202356 FGAS010880 Triticum aestivum FGAS: L... 64 1e-008
gb|CN012727.1|CN012727 WHE3952_B10_C20ZS Wheat Fusarium gra... 64 1e-008
gb|CN013071.1|CN013071 WHE3956_D10_G20ZS Wheat Fusarium gra... 64 1e-008
gb|BE493244.1|BE493244 WHE0569_D02_H03ZE Triticum monococcu... 62 5e-008
gb|BF482312.1|BF482312 WHE1797_C04_F07ZS Wheat pre-anthesis... 62 5e-008
gb|BF484304.1|BF484304 WHE2321_F12_K23ZS Wheat pre-anthesis... 62 5e-008
gb|BG314500.1|BG314500 WHE2495_E11_I21ZS Triticum monococcu... 62 5e-008
gb|BJ246116.1|BJ246116 BJ246116 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ249577.1|BJ249577 BJ249577 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ252030.1|BJ252030 BJ252030 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ257751.1|BJ257751 BJ257751 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ261281.1|BJ261281 BJ261281 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ263171.1|BJ263171 BJ263171 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ265176.1|BJ265176 BJ265176 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BJ273796.1|BJ273796 BJ273796 Y. Ogihara unpublished cDNA... 62 5e-008
gb|BQ752825.1|BQ752825 WHE4119_E12_J23ZS Wheat salt-stresse... 62 5e-008
gb|CA614624.1|CA614624 wr1.pk163.e10 wr1 Triticum aestivum ... 62 5e-008
gb|CA615217.1|CA615217 wr1.pk162.e10 wr1 Triticum aestivum ... 62 5e-008
gb|CA626570.1|CA626570 wl1n.pk0148.g2 wl1n Triticum aestivu... 62 5e-008
gb|CA634328.1|CA634328 wle1n.pk0087.f3 wle1n Triticum aesti... 62 5e-008
gb|CA637672.1|CA637672 wre1n.pk0001.e9 wre1n Triticum aesti... 62 5e-008
gb|CA640093.1|CA640093 wre1n.pk0031.g11 wre1n Triticum aest... 62 5e-008
gb|CA653777.1|CA653777 wre1n.pk188.f10 wre1n Triticum aesti... 62 5e-008
gb|CA711733.1|CA711733 wdk2c.pk014.p15 wdk2c Triticum aesti... 62 5e-008
gb|CA729876.1|CA729876 wip1c.pk002.l9 wip1c Triticum aestiv... 62 5e-008
gb|CD454107.1|CD454107 WHE0972_E11_I22ZT CS wheat pre-anthe... 62 5e-008
gb|CD864258.1|CD864258 AZO1.109I13F000808 AZO1 Triticum aes... 62 5e-008
gb|CD878345.1|CD878345 AZO4.102I10R011126 AZO4 Triticum aes... 62 5e-008
gb|CD884472.1|CD884472 F1.116L20R010702 F1 Triticum aestivu... 62 5e-008
gb|CD918291.1|CD918291 G608.108M13F010906 G608 Triticum aes... 62 5e-008
gb|CD928744.1|CD928744 GR45.105N07F010319 GR45 Triticum aes... 62 5e-008
gb|CD932185.1|CD932185 GR45.117C11R010830 GR45 Triticum aes... 62 5e-008
gb|CD938268.1|CD938268 OV.109I23F010309 OV Triticum aestivu... 62 5e-008
gb|CD938289.1|CD938289 OV.109K04F010309 OV Triticum aestivu... 62 5e-008
gb|CK163513.1|CK163513 FGAS016142 Triticum aestivum FGAS: L... 62 5e-008
gb|CK193594.1|CK193594 FGAS002008 Triticum aestivum FGAS: L... 62 5e-008
gb|CK211108.1|CK211108 FGAS022942 Triticum aestivum FGAS: L... 62 5e-008
gb|CK215205.1|CK215205 FGAS027158 Triticum aestivum FGAS: L... 62 5e-008
gb|AJ611537.1|AJ611537 AJ611537 Triticum turgidum subsp. du... 62 5e-008
emb|AX660732.1| Sequence 1089 from Patent WO03000906 62 5e-008
gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, ... 62 5e-008
gb|BE406401.1|BE406401 WHE0414_f05_k10zB Wheat etiolated se... 60 2e-007
gb|BE490625.1|BE490625 WHE0370_D01_H02ZS Wheat cold-stresse... 60 2e-007
gb|BF483204.1|BF483204 WHE1787_B03_C05ZS Wheat pre-anthesis... 60 2e-007
gb|BG262486.1|BG262486 WHE0936_E12_J24ZS Wheat 5-15 DAP spi... 60 2e-007
gb|BG905724.1|BG905724 TaLr1141H12R TaLr1 Triticum aestivum... 60 2e-007
gb|BJ259464.1|BJ259464 BJ259464 Y. Ogihara unpublished cDNA... 60 2e-007
gb|AL821924.1|AL821924 AL821924 N:130 Triticum aestivum cDN... 60 2e-007
gb|AL828595.1|AL828595 AL828595 p:739 Triticum aestivum cDN... 60 2e-007
gb|BQ752847.1|BQ752847 WHE4119_G12_N23ZS Wheat salt-stresse... 60 2e-007
gb|CA642958.1|CA642958 wre1n.pk0062.h9 wre1n Triticum aesti... 60 2e-007
gb|CA647599.1|CA647599 wre1n.pk0112.d4 wre1n Triticum aesti... 60 2e-007
gb|CA664851.1|CA664851 wlk1.pk0006.b2 wlk1 Triticum aestivu... 60 2e-007
gb|CD878344.1|CD878344 AZO4.102I10F010930 AZO4 Triticum aes... 60 2e-007
gb|CK163121.1|CK163121 FGAS015739 Triticum aestivum FGAS: L... 60 2e-007
gb|CK210321.1|CK210321 FGAS022126 Triticum aestivum FGAS: L... 60 2e-007
gb|CN008321.1|CN008321 WHE2639_H02_P03ZE Wheat Fusarium gra... 60 2e-007
gb|CN010871.1|CN010871 WHE3877_C02_F03ZS Wheat Fusarium gra... 60 2e-007
gb|CV760491.1|CV760491 FGAS054875 Triticum aestivum FGAS: L... 60 2e-007
gb|CV760720.1|CV760720 FGAS055106 Triticum aestivum FGAS: L... 60 2e-007
gb|CV761206.1|CV761206 FGAS055594 Triticum aestivum FGAS: L... 60 2e-007
gb|DR739035.1|DR739035 FGAS084252 Triticum aestivum FGAS: L... 60 2e-007
gb|BQ161073.1|BQ161073 WHE0368_H12_O24ZT Wheat cold-stresse... 58 7e-007
gb|CA707988.1|CA707988 wdk2c.pk007.i24 wdk2c Triticum aesti... 58 7e-007
gb|CD909626.1|CD909626 G468.113C02F010820 G468 Triticum aes... 58 7e-007
gb|CD918343.1|CD918343 G608.109A16F010907 G608 Triticum aes... 58 7e-007
gb|CK193533.1|CK193533 FGAS001947 Triticum aestivum FGAS: L... 58 7e-007
gb|CV773368.1|CV773368 FGAS067764 Triticum aestivum FGAS: L... 58 7e-007
gb|CV779786.1|CV779786 FGAS074195 Triticum aestivum FGAS: L... 58 7e-007
gb|BJ240524.1|BJ240524 BJ240524 Y. Ogihara unpublished cDNA... 56 3e-006
gb|AL808354.1|AL808354 AL808354 a:22 Triticum aestivum cDNA... 56 3e-006
gb|DR735642.1|DR735642 FGAS081289 Triticum aestivum FGAS: L... 56 3e-006
gb|BJ246344.1|BJ246344 BJ246344 Y. Ogihara unpublished cDNA... 54 1e-005
gb|BJ258259.1|BJ258259 BJ258259 Y. Ogihara unpublished cDNA... 54 1e-005
gb|AL827353.1|AL827353 AL827353 p:638 Triticum aestivum cDN... 54 1e-005
gb|CA634731.1|CA634731 wle1n.pk0083.e5 wle1n Triticum aesti... 54 1e-005
gb|CA640851.1|CA640851 wre1n.pk0036.d4 wre1n Triticum aesti... 54 1e-005
gb|CD898673.1|CD898673 G174.109L21F010824 G174 Triticum aes... 54 1e-005
gb|CD933864.1|CD933864 GR45.122E06F010720 GR45 Triticum aes... 54 1e-005
gb|CK193931.1|CK193931 FGAS002350 Triticum aestivum FGAS: L... 54 1e-005
gb|CK201722.1|CK201722 FGAS010242 Triticum aestivum FGAS: L... 54 1e-005
gb|BQ804819.1|BQ804819 WHE3559_C12_E23ZS Wheat developing g... 52 5e-005
gb|CA686379.1|CA686379 wlm96.pk033.j2 wlm96 Triticum aestiv... 52 5e-005
gb|CK217545.1|CK217545 FGAS029547 Triticum aestivum FGAS: L... 52 5e-005
gb|CN012179.1|CN012179 WHE3893_E07_J13ZS Wheat Fusarium gra... 52 5e-005
gb|CA624184.1|CA624184 wl1n.pk0115.h10 wl1n Triticum aestiv... 48 7e-004
gb|CK196097.1|CK196097 FGAS004544 Triticum aestivum FGAS: L... 48 7e-004
gb|CK204382.1|CK204382 FGAS012918 Triticum aestivum FGAS: L... 48 7e-004
gb|CN008580.1|CN008580 WHE2642_G09_M18ZE Wheat Fusarium gra... 48 7e-004
gb|CV775190.1|CV775190 FGAS069592 Triticum aestivum FGAS: L... 48 7e-004
gb|BF293046.1|BF293046 WHE2159_G10_M19ZS Triticum turgidum ... 46 0.003
gb|BM137457.1|BM137457 WHE0475_D01_G01ZS Wheat Fusarium gra... 46 0.003
gb|CD936749.1|CD936749 OV.105A20F010209 OV Triticum aestivu... 46 0.003
gb|BQ743293.1|BQ743293 WHE4102_D01_G02ZS Wheat salt-stresse... 44 0.011
gb|CK204040.1|CK204040 FGAS012575 Triticum aestivum FGAS: L... 44 0.011
gb|BE490745.1|BE490745 WHE0368_H12_O24ZS Wheat cold-stresse... 42 0.044
gb|CA610369.1|CA610369 wr1.pk0120.a8 wr1 Triticum aestivum ... 42 0.044
gb|CA635549.1|CA635549 wle1n.pk0094.h2 wle1n Triticum aesti... 42 0.044
gb|CA650976.1|CA650976 wre1n.pk184.c9 wre1n Triticum aestiv... 42 0.044
gb|CA682011.1|CA682011 wlm24.pk0026.e10 wlm24 Triticum aest... 42 0.044
gb|CA699726.1|CA699726 wlk8.pk0015.a2 wlk8 Triticum aestivu... 42 0.044
gb|CD885920.1|CD885920 G118.100N17F010507 G118 Triticum aes... 42 0.044
gb|CV780215.1|CV780215 FGAS074624 Triticum aestivum FGAS: L... 42 0.044
gb|BJ252635.1|BJ252635 BJ252635 Y. Ogihara unpublished cDNA... 40 0.18
gb|CA618914.1|CA618914 wl1n.pk0045.f1 wl1n Triticum aestivu... 40 0.18
gb|CA632072.1|CA632072 wle1n.pk0058.e9 wle1n Triticum aesti... 40 0.18
gb|CD888511.1|CD888511 G118.108E04R010925 G118 Triticum aes... 40 0.18
gb|CK210651.1|CK210651 FGAS022475 Triticum aestivum FGAS: L... 40 0.18
gb|CK212136.1|CK212136 FGAS024004 Triticum aestivum FGAS: L... 40 0.18
gb|CV758921.1|CV758921 FGAS053303 Triticum aestivum FGAS: L... 40 0.18
>gb|CA619594.1|CA619594 wl1n.pk0048.h7 wl1n Triticum aestivum cDNA clone wl1n.pk0048.h7 5'
end, mRNA sequence
Length = 478
Score = 676 bits (341), Expect = 0.0
Identities = 365/369 (98%), Gaps = 3/369 (0%)
Strand = Plus / Minus
Query: 132 accatgcattattaattgacgacggcagcggacagcggcgggcaggcagttgaaagatga 191
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 accatgcattattaattgacgacggcagcggacagcggcgggcaggcagttgaaagatga 309
Query: 192 cagagacgacg-agcg-aatgatatatgatcttggtcgtcggatcatcatcacatcagac 249
||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 308 cagagacgacggagcggaatgatatatg-tcttggtcgtcggatcatcatcacatcagac 250
Query: 250 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcgggg 309
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcgggg 190
Query: 310 atcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcgaggtc 369
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 189 atcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcgaggtc 130
Query: 370 gctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgtacac 429
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 129 gctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgtacac 70
Query: 430 gacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagttagg 489
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 69 gacggtacccccgacgcgcaccaggcggagcagctgctcgtggtaccggacgtagttagg 10
Query: 490 cttgtcggc 498
|||||||||
Sbjct: 9 cttgtcggc 1
>gb|CA620233.1|CA620233 wl1n.pk0053.b8 wl1n Triticum aestivum cDNA clone wl1n.pk0053.b8 5'
end, mRNA sequence
Length = 613
Score = 176 bits (89), Expect = 1e-042
Identities = 128/141 (90%)
Strand = Plus / Minus
Query: 408 cccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccaggcggagcagttgct 467
|||| ||||||||||||||||||| ||| || ||||||||||||||||||||||| ||||
Sbjct: 189 cccagagcgtgttgtcgtacacgatggtgccgccgacgcgcaccaggcggagcagctgct 130
Query: 468 cgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcgaagtcgaaggcgccgg 527
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 129 cgtggtaattgacgtagttgggcttgtcggcgtcgacgaaggcgaagtcgaaggcgccga 70
Query: 528 ggttggccgggtcggcaagga 548
|||||||| |||||| ||||
Sbjct: 69 ggttggcctcgtcggcgagga 49
Score = 67.9 bits (34), Expect = 8e-010
Identities = 50/54 (92%), Gaps = 1/54 (1%)
Strand = Plus / Minus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcg 306
||||||||| ||| ||||||||||||||||||||||||| |||||||| |||||
Sbjct: 344 gcggcggcaaatg-tgacgccgtcggcgatggcgagctgacagacctcaacgcg 292
>gb|BF474477.1|BF474477 WHE0844_E05_J10ZS Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0844_E05_J10, mRNA sequence
Length = 414
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 364 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 305
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 304 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 245
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 244 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 185
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 184 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 125
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 124 tgggcttgtccgcgtccacgaacgcgaagtcg 93
>gb|BQ247189.1|BQ247189 TaE15028C03R TaE15 Triticum aestivum cDNA clone TaE15028C03R, mRNA
sequence
Length = 496
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 491 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 432
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 431 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 372
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 371 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 312
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 311 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 252
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 251 tgggcttgtccgcgtccacgaacgcgaagtcg 220
>gb|AL820289.1|AL820289 AL820289 N:130 Triticum aestivum cDNA clone G12_N130_plate_39, mRNA
sequence
Length = 664
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 508 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 449
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 448 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 389
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 388 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 329
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 328 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 269
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 268 tgggcttgtccgcgtccacgaacgcgaagtcg 237
>gb|CD877326.1|CD877326 AZO4.100B06R011121 AZO4 Triticum aestivum cDNA clone AZO4100B06,
mRNA sequence
Length = 601
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 248 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 307
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 308 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 367
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 368 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 427
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 428 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 487
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 488 tgggcttgtccgcgtccacgaacgcgaagtcg 519
>gb|CK197926.1|CK197926 FGAS006406 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 817
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 662 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 603
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 602 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 543
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 542 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 483
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 482 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 423
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 422 tgggcttgtccgcgtccacgaacgcgaagtcg 391
>gb|CK201781.1|CK201781 FGAS010301 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 831
Score = 143 bits (72), Expect = 2e-032
Identities = 222/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 615 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 556
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 555 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 496
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 495 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 436
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 435 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 376
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 375 tgggcttgtccgcgtccacgaacgcgaagtcg 344
>gb|CK201455.1|CK201455 FGAS009975 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 851
Score = 137 bits (69), Expect = 1e-030
Identities = 221/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||
Sbjct: 616 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctgncagacctcgatgc 557
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 556 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 497
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || |||||||| || ||| ||||||||||||||||||
Sbjct: 496 ggtcggacatgggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgt 437
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 436 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 377
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 376 tgggcttgtccgcgtccacgaacgcgaagtcg 345
>gb|CD865655.1|CD865655 AZO2.101G20F010111 AZO2 Triticum aestivum cDNA clone AZO2101G20,
mRNA sequence
Length = 682
Score = 135 bits (68), Expect = 4e-030
Identities = 221/272 (81%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 416 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 357
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 356 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 297
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || || ||||| || ||| ||||||||||||||||||
Sbjct: 296 ggtcggacatgggcgtgcccgccggcagggccaccgtgccgccccacagcgtgttgtcgt 237
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 236 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 177
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 176 tgggcttgtccgcgtccacgaacgcgaagtcg 145
>gb|CD873067.1|CD873067 AZO2.122E17R010522 AZO2 Triticum aestivum cDNA clone AZO2122E17,
mRNA sequence
Length = 516
Score = 135 bits (68), Expect = 4e-030
Identities = 221/272 (81%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 305
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 189 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 248
Query: 306 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 365
| || || | ||| | ||||||| ||||||| |||||||||||| | | |||||
Sbjct: 249 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 308
Query: 366 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 425
||||| | |||| | | | || || ||||| || ||| ||||||||||||||||||
Sbjct: 309 ggtcggacatgggcgtgcccgccggcagggccaccgtgccgccccacagcgtgttgtcgt 368
Query: 426 acacgacggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagt 485
| | || ||| || |||||||| ||||| ||||| ||||||||||| || |||||||
Sbjct: 369 agatgatggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagt 428
Query: 486 taggcttgtcggcgtcgacgaaggcgaagtcg 517
| |||||||| ||||| ||||| |||||||||
Sbjct: 429 tgggcttgtccgcgtccacgaacgcgaagtcg 460
>gb|BQ752940.1|BQ752940 WHE4120_H12_P24ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4120_H12_P24, mRNA sequence
Length = 780
Score = 129 bits (65), Expect = 2e-028
Identities = 215/265 (81%)
Strand = Plus / Minus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcggggatc 312
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||
Sbjct: 778 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 719
Query: 313 ctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcgaggtcgct 372
| ||| | ||||||| ||||||| |||||||||||| | | ||||||||||
Sbjct: 718 ggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgaggtcgga 659
Query: 373 gagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgtacacgac 432
| |||| | | | || || ||||| || ||| ||||||||||||||||||| | ||
Sbjct: 658 catgggcgtgcccgccggcagggccaccgtgccgccccacagcgtgttgtcgtagatgat 599
Query: 433 ggtacccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagttaggctt 492
||| || |||||||| ||||| ||||| ||||||||||| || |||||||| |||||
Sbjct: 598 ggtgccgccgacgcggaccagcttcagcagctgctcgtggtagcgcacgtagttgggctt 539
Query: 493 gtcggcgtcgacgaaggcgaagtcg 517
||| ||||| ||||| |||||||||
Sbjct: 538 gtccgcgtccacgaacgcgaagtcg 514
>gb|CA623700.1|CA623700 wl1n.pk0112.a12 wl1n Triticum aestivum cDNA clone wl1n.pk0112.a12
5' end, mRNA sequence
Length = 444
Score = 125 bits (63), Expect = 4e-027
Identities = 90/99 (90%)
Strand = Plus / Minus
Query: 450 ccaggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaagg 509
||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||
Sbjct: 147 ccaggcggagcagctgctcgtggtaattgacgtagttgggcttgtcggcgtcgacgaagg 88
Query: 510 cgaagtcgaaggcgccggggttggccgggtcggcaagga 548
||||||||||||||||| |||||||| |||||| ||||
Sbjct: 87 cgaagtcgaaggcgccgaggttggcctcgtcggcgagga 49
>gb|BQ752785.1|BQ752785 WHE4119_B03_D05ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4119_B03_D05, mRNA sequence
Length = 673
Score = 123 bits (62), Expect = 2e-026
Identities = 212/262 (80%)
Strand = Plus / Minus
Query: 256 gcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcggggatcctg 315
||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||
Sbjct: 673 gcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcggc 614
Query: 316 agaaagccggacgttgagttccctgatggcggcggagaacctgcggtcgaggtcgctgag 375
| ||| | ||||||| ||||||| |||||||||||| | | |||||||||| |
Sbjct: 613 ggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgaggtcggacat 554
Query: 376 cggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgtacacgacggt 435
|||| | | | || |||||||| || ||| ||||||||||||||||||| | || |||
Sbjct: 553 gggcgtgcccgccggcagcgccaccgtgccgccccacagcgtgttgtcgtagatgatggt 494
Query: 436 acccccgacgcgcaccaggcggagcagttgctcgtggtaccggacgtagttaggcttgtc 495
|| |||||||| ||||| ||||| | ||||||||| || |||||||| ||||||||
Sbjct: 493 gccgccgacgcggaccagcttcagcagctactcgtggtagcgcacgtagttgggcttgtc 434
Query: 496 ggcgtcgacgaaggcgaagtcg 517
||||| ||||| |||||||||
Sbjct: 433 cgcgtccacgaacgcgaagtcg 412
>gb|CK163799.1|CK163799 FGAS016434 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1049
Score = 109 bits (55), Expect = 2e-022
Identities = 205/255 (80%)
Strand = Plus / Plus
Query: 263 atggtgacgccgtcggcgatggcgagctggcagacctcgacgcggggatcctgagaaagc 322
|||||||||||| ||||||||||||||||||||||||||| ||| || || | |||
Sbjct: 301 atggtgacgccgccggcgatggcgagctggcagacctcgatgcgcgggtcggcggcgagc 360
Query: 323 cggacgttgagttccctgatggcggcggagaacctgcggtcgaggtcgctgagcggcgcg 382
| ||||||| ||||||| |||||||||||| | | |||||||||| | |||| |
Sbjct: 361 ttggcgttgaggtccctgagggcggcggagaagcgggtgtcgaggtcggacatgggcgtg 420
Query: 383 tcggggggaagcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccg 442
| | || |||||||| || ||| ||||||||||||||||||| | || ||| || |||
Sbjct: 421 cccgccggcagcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccg 480
Query: 443 acgcgcaccaggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcg 502
||||| ||||| ||||| ||||||||||| || |||||||| |||||||| |||||
Sbjct: 481 acgcggaccagcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtcc 540
Query: 503 acgaaggcgaagtcg 517
||||| |||||||||
Sbjct: 541 acgaacgcgaagtcg 555
>gb|BE515791.1|BE515791 WHE0603_F12_L23ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0603_F12_L23, mRNA sequence
Length = 485
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 281 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 337
Score = 40.1 bits (20), Expect = 0.18
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 408 cccacagcgtgttgtcgtacacgacggtacccccgacgcg 447
||||||||||||||||||| | || ||| || ||||||||
Sbjct: 442 cccacagcgtgttgtcgtaaatgatggtgccgccgacgcg 481
>gb|AL828304.1|AL828304 AL828304 p:436 Triticum aestivum cDNA clone H04_p436_plate_15, mRNA
sequence
Length = 459
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 158
Score = 46.1 bits (23), Expect = 0.003
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 395 gccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccag 453
||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||||
Sbjct: 65 gccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggaccag 7
>gb|CA605944.1|CA605944 wr1.pk0059.c8 wr1 Triticum aestivum cDNA clone wr1.pk0059.c8 5'
end, mRNA sequence
Length = 400
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 159 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 103
>gb|CA614966.1|CA614966 wr1.pk149.h5 wr1 Triticum aestivum cDNA clone wr1.pk149.h5 5' end,
mRNA sequence
Length = 399
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 174
Score = 48.1 bits (24), Expect = 7e-004
Identities = 66/80 (82%)
Strand = Plus / Minus
Query: 395 gccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccagg 454
||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||||
Sbjct: 81 gccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggaccagc 22
Query: 455 cggagcagttgctcgtggta 474
||||| |||||||||||
Sbjct: 21 ttcagcagctgctcgtggta 2
>gb|CA631337.1|CA631337 wle1n.pk0044.a4 wle1n Triticum aestivum cDNA clone wle1n.pk0044.a4
5' end, mRNA sequence
Length = 486
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 168
Score = 52.0 bits (26), Expect = 5e-005
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||
Sbjct: 78 agcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggacc 19
Query: 452 ag 453
||
Sbjct: 18 ag 17
>gb|CA633904.1|CA633904 wle1n.pk0080.b11 wle1n Triticum aestivum cDNA clone
wle1n.pk0080.b11 5' end, mRNA sequence
Length = 473
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 151 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 95
>gb|CA641009.1|CA641009 wre1n.pk0042.g4 wre1n Triticum aestivum cDNA clone wre1n.pk0042.g4
5' end, mRNA sequence
Length = 557
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 271
>gb|CA661371.1|CA661371 wlmk1.pk0002.b1 wlmk1 Triticum aestivum cDNA clone wlmk1.pk0002.b1
5' end, mRNA sequence
Length = 576
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 321
>gb|CA685905.1|CA685905 wlm96.pk031.c6 wlm96 Triticum aestivum cDNA clone wlm96.pk031.c6 5'
end, mRNA sequence
Length = 538
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 377
>gb|CA694892.1|CA694892 wlmk4.pk0021.b9 wlmk4 Triticum aestivum cDNA clone wlmk4.pk0021.b9
5' end, mRNA sequence
Length = 456
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 113
>gb|CD869949.1|CD869949 AZO2.113A21R010522 AZO2 Triticum aestivum cDNA clone AZO2113A21,
mRNA sequence
Length = 501
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 330
Score = 50.1 bits (25), Expect = 2e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 389 ggaagcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgc 448
||||||||||| || ||| |||||||||||| |||||| | || ||| || ||||||||
Sbjct: 417 ggaagcgccaccgtgccgccccacagcgtgtagtcgtagatgatggtgccgccgacgcgg 476
Query: 449 accaggcggagcagttgctcgtggt 473
||||| ||||| ||||||||||
Sbjct: 477 accagcttcagcagctgctcgtggt 501
>gb|CD934107.1|CD934107 GR45.123A08R010830 GR45 Triticum aestivum cDNA clone GR45123A08,
mRNA sequence
Length = 427
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 248 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 304
>gb|CK161647.1|CK161647 FGAS014218 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1100
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 746
Score = 91.7 bits (46), Expect = 5e-017
Identities = 106/126 (84%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||
Sbjct: 656 agcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggacc 597
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 596 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 537
Query: 512 aagtcg 517
||||||
Sbjct: 536 aagtcg 531
>gb|CK195040.1|CK195040 FGAS003478 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 918
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 agacgaggcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 407
Score = 71.9 bits (36), Expect = 5e-011
Identities = 87/104 (83%)
Strand = Plus / Plus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||
Sbjct: 497 agcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggacc 556
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtc 495
|| ||||| ||||||||||| || |||||||| ||||||||
Sbjct: 557 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtc 600
>gb|CK196910.1|CK196910 FGAS005379 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 850
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 406 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 462
Score = 52.0 bits (26), Expect = 5e-005
Identities = 73/89 (82%)
Strand = Plus / Plus
Query: 395 gccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccagg 454
||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||||
Sbjct: 555 gccaccgtgccgccccacagcgtgttgtcgtanatgatggtgccgccgacgcggaccagc 614
Query: 455 cggagcagttgctcgtggtaccggacgta 483
||||| ||||||||||| || |||||
Sbjct: 615 ttcagcagctgctcgtggtagcgcacgta 643
>gb|CK200887.1|CK200887 FGAS009404 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 852
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 454
>gb|CK201231.1|CK201231 FGAS009750 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 814
Score = 105 bits (53), Expect = 4e-021
Identities = 56/57 (98%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 196 agacgatgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 140
>gb|CD883740.1|CD883740 F1.114E16F010504 F1 Triticum aestivum cDNA clone F1114E16, mRNA
sequence
Length = 715
Score = 101 bits (51), Expect = 6e-020
Identities = 105/123 (85%)
Strand = Plus / Minus
Query: 395 gccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccagg 454
||||| || ||| ||||||||||||||||||| | || ||| || |||| ||||||||||
Sbjct: 645 gccaccgtgccgccccacagcgtgttgtcgtagatgatggtcccgccgatgcgcaccagg 586
Query: 455 cggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcgaag 514
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||| | ||||||
Sbjct: 585 cgcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacggaagcgaag 526
Query: 515 tcg 517
|||
Sbjct: 525 tcg 523
>gb|CA609627.1|CA609627 wr1.pk0108.g9 wr1 Triticum aestivum cDNA clone wr1.pk0108.g9 5'
end, mRNA sequence
Length = 604
Score = 99.6 bits (50), Expect = 2e-019
Identities = 50/50 (100%)
Strand = Plus / Minus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 203 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 154
Score = 52.0 bits (26), Expect = 5e-005
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||
Sbjct: 64 agcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggacc 5
Query: 452 ag 453
||
Sbjct: 4 ag 3
>gb|CD883741.1|CD883741 F1.114E16R010702 F1 Triticum aestivum cDNA clone F1114E16, mRNA
sequence
Length = 361
Score = 99.6 bits (50), Expect = 2e-019
Identities = 50/50 (100%)
Strand = Plus / Plus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 228 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 277
>gb|CK195652.1|CK195652 FGAS004094 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 846
Score = 99.6 bits (50), Expect = 2e-019
Identities = 50/50 (100%)
Strand = Plus / Plus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 468
Score = 69.9 bits (35), Expect = 2e-010
Identities = 103/126 (81%)
Strand = Plus / Plus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | | ||| || |||||||| |
Sbjct: 558 agcgccaccgtgccgccccacagcgtgttgtcgtanataatggtgccgccgacgcgggac 617
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 618 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 677
Query: 512 aagtcg 517
||||||
Sbjct: 678 aagtcg 683
>gb|CK195971.1|CK195971 FGAS004417 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 864
Score = 99.6 bits (50), Expect = 2e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 727 agacgagncggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 671
Score = 91.7 bits (46), Expect = 5e-017
Identities = 106/126 (84%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||
Sbjct: 581 agcgccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggacc 522
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 521 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 462
Query: 512 aagtcg 517
||||||
Sbjct: 461 aagtcg 456
>gb|AJ614420.1|AJ614420 AJ614420 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 10189R, mRNA
sequence
Length = 747
Score = 99.6 bits (50), Expect = 2e-019
Identities = 50/50 (100%)
Strand = Plus / Minus
Query: 253 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 744 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 695
Score = 85.7 bits (43), Expect = 3e-015
Identities = 103/123 (83%)
Strand = Plus / Minus
Query: 395 gccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcaccagg 454
||||| || ||| ||||||||||||||||||| | || ||| || |||||||| |||||
Sbjct: 600 gccaccgtgccgccccacagcgtgttgtcgtagatgatggtgccgccgacgcggaccagc 541
Query: 455 cggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcgaag 514
||||| ||||||||||| || |||||||| |||||||| ||||| ||||| ||||||
Sbjct: 540 ttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcgaag 481
Query: 515 tcg 517
|||
Sbjct: 480 tcg 478
Score = 40.1 bits (20), Expect = 0.18
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 327 cgttgagttccctgatggcggcggagaa 354
||||||| ||||||| ||||||||||||
Sbjct: 669 cgttgaggtccctgagggcggcggagaa 642
>gb|BE405628.1|BE405628 WHE1209_E08_I15ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1209_E08_I15, mRNA
sequence
Length = 575
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 412 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 356
Score = 75.8 bits (38), Expect = 3e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| |||| |||||||||||||| | || || || |||||||| |||
Sbjct: 266 agcgccaccgtgccgccccagagcgtgttgtcgtagatgatagtgccgccgacgcggacc 207
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 206 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 147
Query: 512 aagtcg 517
||||||
Sbjct: 146 aagtcg 141
>gb|BE415413.1|BE415413 MWL030.B02000309 ITEC MWL Wheat Root Library Triticum aestivum cDNA
clone MWL030.B02, mRNA sequence
Length = 349
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 298 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 242
Score = 54.0 bits (27), Expect = 1e-005
Identities = 99/124 (79%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| |||| |||||||||||||| | || || || |||||||| |||
Sbjct: 153 agcgccaccgtgccgccccagagcgtgttgtcgtagatgatagtgccgccgacgcggacc 94
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||| || |||||||| ||||| ||| | |||
Sbjct: 93 agcttcagcagctgctcgtggtagcgcacgtnnttgggcttgtccgcgtccacgnacgcg 34
Query: 512 aagt 515
||||
Sbjct: 33 aagt 30
>gb|CA635573.1|CA635573 wle1n.pk0094.b2 wle1n Triticum aestivum cDNA clone wle1n.pk0094.b2
5' end, mRNA sequence
Length = 352
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 159 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 103
>gb|CA641947.1|CA641947 wre1n.pk0051.d3 wre1n Triticum aestivum cDNA clone wre1n.pk0051.d3
5' end, mRNA sequence
Length = 330
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 126 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 70
>gb|CA644868.1|CA644868 wre1n.pk0092.h5 wre1n Triticum aestivum cDNA clone wre1n.pk0092.h5
5' end, mRNA sequence
Length = 302
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 93 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 37
>gb|CA682723.1|CA682723 wlm96.pk0004.g12 wlm96 Triticum aestivum cDNA clone
wlm96.pk0004.g12 5' end, mRNA sequence
Length = 407
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 216 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 160
>gb|CA685706.1|CA685706 wlm96.pk030.i1 wlm96 Triticum aestivum cDNA clone wlm96.pk030.i1 5'
end, mRNA sequence
Length = 478
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 159 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 103
>gb|CA694712.1|CA694712 wlmk4.pk0024.c11 wlmk4 Triticum aestivum cDNA clone
wlmk4.pk0024.c11 5' end, mRNA sequence
Length = 482
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 205 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 261
>gb|CA697734.1|CA697734 wlk4.pk0010.d12 wlk4 Triticum aestivum cDNA clone wlk4.pk0010.d12
5' end, mRNA sequence
Length = 632
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 221 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 277
>gb|CD867866.1|CD867866 AZO2.107G06F001110 AZO2 Triticum aestivum cDNA clone AZO2107G06,
mRNA sequence
Length = 564
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 437 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 381
Score = 75.8 bits (38), Expect = 3e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| |||| |||||||||||||| | || || || |||||||| |||
Sbjct: 291 agcgccaccgtgccgccccagagcgtgttgtcgtagatgatagtgccgccgacgcggacc 232
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 231 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 172
Query: 512 aagtcg 517
||||||
Sbjct: 171 aagtcg 166
>gb|CD879592.1|CD879592 AZO4.105M02R011123 AZO4 Triticum aestivum cDNA clone AZO4105M02,
mRNA sequence
Length = 759
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 198 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 254
Score = 75.8 bits (38), Expect = 3e-012
Identities = 104/126 (82%)
Strand = Plus / Plus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| |||| |||||||||||||| | || || || |||||||| |||
Sbjct: 344 agcgccaccgtgccgccccagagcgtgttgtcgtagatgatagtgccgccgacgcggacc 403
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 404 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 463
Query: 512 aagtcg 517
||||||
Sbjct: 464 aagtcg 469
>gb|CD895488.1|CD895488 G174.001P13R011120 G174 Triticum aestivum cDNA clone G174001P13,
mRNA sequence
Length = 627
Score = 97.6 bits (49), Expect = 9e-019
Identities = 55/57 (96%)
Strand = Plus / Plus
Query: 246 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 198 agacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcagacctcga 254
Score = 75.8 bits (38), Expect = 3e-012
Identities = 104/126 (82%)
Strand = Plus / Plus
Query: 392 agcgccacagtaccggcccacagcgtgttgtcgtacacgacggtacccccgacgcgcacc 451
|||||||| || ||| |||| |||||||||||||| | || || || |||||||| |||
Sbjct: 344 agcgccaccgtgccgccccagagcgtgttgtcgtagatgatagtgccgccgacgcggacc 403
Query: 452 aggcggagcagttgctcgtggtaccggacgtagttaggcttgtcggcgtcgacgaaggcg 511
|| ||||| ||||||||||| || |||||||| |||||||| ||||| ||||| |||
Sbjct: 404 agcttcagcagctgctcgtggtagcgcacgtagttgggcttgtccgcgtccacgaacgcg 463
Query: 512 aagtcg 517
||||||
Sbjct: 464 aagtcg 469
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 170,950
Number of Sequences: 636343
Number of extensions: 170950
Number of successful extensions: 49718
Number of sequences better than 0.5: 298
Number of HSP's better than 0.5 without gapping: 296
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 48983
Number of HSP's gapped (non-prelim): 588
length of query: 617
length of database: 367,240,239
effective HSP length: 19
effective length of query: 598
effective length of database: 355,149,722
effective search space: 212379533756
effective search space used: 212379533756
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)