BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2404800.2.1
(1228 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA734489.1|CA734489 wpi1s.pk001.e17 wpi1s Triticum aesti... 129 5e-028
gb|AL826125.1|AL826125 AL826125 p:436 Triticum aestivum cDN... 121 1e-025
gb|CB307508.1|CB307508 HFIG493 Hessian fly infested cDNA li... 115 7e-024
gb|CK204735.1|CK204735 FGAS013271 Triticum aestivum FGAS: L... 115 7e-024
gb|CK205087.1|CK205087 FGAS013624 Triticum aestivum FGAS: L... 115 7e-024
gb|BE404218.1|BE404218 WHE1203_F02_L03ZS Wheat etiolated se... 111 1e-022
gb|BJ279395.1|BJ279395 BJ279395 Y. Ogihara unpublished cDNA... 109 5e-022
gb|BQ839184.1|BQ839184 WHE4163_C09_E17ZS Wheat CS whole pla... 109 5e-022
gb|BE490233.1|BE490233 WHE0366_H10_P20ZS Wheat cold-stresse... 101 1e-019
gb|BQ578376.1|BQ578376 WHE0302_B09_C18ZS Wheat unstressed s... 101 1e-019
gb|BE414993.1|BE414993 MWL010.A06F990625 ITEC MWL Wheat Roo... 96 7e-018
gb|AL822821.1|AL822821 AL822821 p:335 Triticum aestivum cDN... 96 7e-018
gb|CA691512.1|CA691512 wlm96.pk053.j18 wlm96 Triticum aesti... 80 4e-013
gb|CK206856.1|CK206856 FGAS018467 Triticum aestivum FGAS: L... 80 4e-013
gb|CD866826.1|CD866826 AZO2.104I16R010327 AZO2 Triticum aes... 78 2e-012
gb|CK162825.1|CK162825 FGAS015425 Triticum aestivum FGAS: L... 78 2e-012
gb|BQ801256.1|BQ801256 WHE2812_B08_D16ZS Triticum monococcu... 76 6e-012
gb|CD934893.1|CD934893 OV.002E03R010412 OV Triticum aestivu... 76 6e-012
gb|CD939689.1|CD939689 OV.114J05F010312 OV Triticum aestivu... 76 6e-012
gb|BE406468.1|BE406468 WHE0416_g08_n16zB Wheat etiolated se... 74 3e-011
gb|CA688703.1|CA688703 wlm96.pk041.h24 wlm96 Triticum aesti... 66 6e-009
gb|CA682352.1|CA682352 wlm24.pk0028.a11 wlm24 Triticum aest... 64 2e-008
gb|BQ487518.1|BQ487518 WHE2164_C01_E02ZY Triticum turgidum ... 62 1e-007
gb|BJ284394.1|BJ284394 BJ284394 Y. Ogihara unpublished cDNA... 58 2e-006
gb|AL826309.1|AL826309 AL826309 p:436 Triticum aestivum cDN... 58 2e-006
gb|CA611655.1|CA611655 wr1.pk0128.c8 wr1 Triticum aestivum ... 58 2e-006
gb|CA642361.1|CA642361 wre1n.pk0054.d1 wre1n Triticum aesti... 58 2e-006
gb|CA711702.1|CA711702 wdk2c.pk014.h15 wdk2c Triticum aesti... 56 6e-006
gb|CA691251.1|CA691251 wlm96.pk050.k6 wlm96 Triticum aestiv... 54 2e-005
gb|BQ162433.1|BQ162433 WHE0416_g08_n16zT Wheat etiolated se... 50 4e-004
gb|BU100649.1|BU100649 WHE3355_H09_O17ZS Chinese Spring alu... 50 4e-004
gb|CA612183.1|CA612183 wr1.pk0141.f9 wr1 Triticum aestivum ... 48 0.001
gb|CA689381.1|CA689381 wlm96.pk046.i8 wlm96 Triticum aestiv... 48 0.001
gb|CA628512.1|CA628512 wle1n.pk0001.g1 wle1n Triticum aesti... 46 0.006
gb|BJ256875.1|BJ256875 BJ256875 Y. Ogihara unpublished cDNA... 44 0.023
gb|BJ262440.1|BJ262440 BJ262440 Y. Ogihara unpublished cDNA... 44 0.023
gb|CA612125.1|CA612125 wr1.pk0140.f12 wr1 Triticum aestivum... 44 0.023
gb|CA645644.1|CA645644 wre1n.pk0099.f10 wre1n Triticum aest... 44 0.023
gb|CD880941.1|CD880941 F1.100G13F010315 F1 Triticum aestivu... 44 0.023
gb|CA621418.1|CA621418 wl1n.pk0065.h7 wl1n Triticum aestivu... 42 0.089
gb|CA622415.1|CA622415 wl1n.pk0095.e2 wl1n Triticum aestivu... 42 0.089
gb|CA624529.1|CA624529 wl1n.pk0120.b5 wl1n Triticum aestivu... 42 0.089
gb|CK199043.1|CK199043 FGAS007533 Triticum aestivum FGAS: L... 42 0.089
gb|CK200736.1|CK200736 FGAS009253 Triticum aestivum FGAS: L... 42 0.089
gb|BE406921.1|BE406921 WHE0433_g09_m17zS Wheat etiolated se... 40 0.35
gb|BE425724.1|BE425724 WHE0303_C01_C01ZS Wheat unstressed s... 40 0.35
gb|BE427290.1|BE427290 PSR6211 ITEC PSR Wheat Pericarp/Test... 40 0.35
gb|BE427303.1|BE427303 PSR6225 ITEC PSR Wheat Pericarp/Test... 40 0.35
gb|BI479715.1|BI479715 WHE3451_C03_E05ZS Wheat pre-anthesis... 40 0.35
gb|BJ228284.1|BJ228284 BJ228284 Y. Ogihara unpublished cDNA... 40 0.35
gb|BJ231051.1|BJ231051 BJ231051 Y. Ogihara unpublished cDNA... 40 0.35
gb|AL825266.1|AL825266 AL825266 p:335 Triticum aestivum cDN... 40 0.35
gb|CA628180.1|CA628180 wle1.pk0005.h7 wle1 Triticum aestivu... 40 0.35
gb|CA630955.1|CA630955 wle1n.pk0040.h2 wle1n Triticum aesti... 40 0.35
gb|CA633562.1|CA633562 wle1n.pk0075.c8 wle1n Triticum aesti... 40 0.35
gb|CA633671.1|CA633671 wle1n.pk0076.g1 wle1n Triticum aesti... 40 0.35
gb|CA633930.1|CA633930 wle1n.pk0080.e11 wle1n Triticum aest... 40 0.35
gb|CA676479.1|CA676479 wrsu1.pk0005.e11 wrsu1 Triticum aest... 40 0.35
gb|CA729791.1|CA729791 wip1c.pk001.d3 wip1c Triticum aestiv... 40 0.35
gb|CA730699.1|CA730699 wip1c.pk005.l16 wip1c Triticum aesti... 40 0.35
gb|CD929323.1|CD929323 GR45.107L23F010320 GR45 Triticum aes... 40 0.35
gb|CK154440.1|CK154440 FGAS033142 Triticum aestivum FGAS: T... 40 0.35
gb|AJ613559.1|AJ613559 AJ613559 Triticum turgidum subsp. du... 40 0.35
gb|CV763360.1|CV763360 FGAS057749 Triticum aestivum FGAS: L... 40 0.35
gb|CV770362.1|CV770362 FGAS064755 Triticum aestivum FGAS: L... 40 0.35
gb|CV775463.1|CV775463 FGAS069867 Triticum aestivum FGAS: L... 40 0.35
gb|CV779885.1|CV779885 FGAS074294 Triticum aestivum FGAS: L... 40 0.35
gb|DR739443.1|DR739443 FGAS084660 Triticum aestivum FGAS: L... 40 0.35
>gb|CA734489.1|CA734489 wpi1s.pk001.e17 wpi1s Triticum aestivum cDNA clone wpi1s.pk001.e17
5' end, mRNA sequence
Length = 531
Score = 129 bits (65), Expect = 5e-028
Identities = 140/165 (84%)
Strand = Plus / Plus
Query: 176 tcatgggtagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgct 235
||||||||| ||||| ||||| |||| |||||||||| |||| |||||||||||||| |
Sbjct: 26 tcatgggtaaacctcaatgatcgatctcacacctagaatgggtgtgattttgtagtcgtt 85
Query: 236 aaatccagcttcggaaattatctttttccactcatgttcgtctcgctcggcgccattgat 295
|||||||| ||| | |||||||| |||||||| || || ||||||||| ||||||||||
Sbjct: 86 gaatccagcctcgaagattatcttcttccactcctgctcatctcgctcgacgccattgat 145
Query: 296 cgtcatgatgaagagatcaaacaagacctgagtctctttgtgctt 340
||||||||| || ||||||| ||| || ||||||||||||||
Sbjct: 146 gaacatgatgaaaaggtcaaacatgacttgtgtctctttgtgctt 190
>gb|AL826125.1|AL826125 AL826125 p:436 Triticum aestivum cDNA clone G05_p436_plate_3, mRNA
sequence
Length = 501
Score = 121 bits (61), Expect = 1e-025
Identities = 205/253 (81%)
Strand = Plus / Minus
Query: 457 cccagtcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaaca 516
|||||||||| | |||| |||| ||||||||||||||||||||||||| |||||| ||||
Sbjct: 253 cccagtcatgaagaaccgacttgaggaagacggcgtctgccggtggaacgctctcgaaca 194
Query: 517 tgtcgccagcaatatacttgacactggtgttagcgggagcattggcggcgacatgcggga 576
||||||| |||| |||||||| | |||| ||||| || ||| | |||| ||| ||
Sbjct: 193 tgtcgccggcaacgtacttgacgcaggtgccggcgggcgccttgctgacgacgtgctcga 134
Query: 577 gatccaggacactgcactggacatgcgggaacgcggtcgagatagccagggccgccgcgc 636
| ||||| || |||||||| | ||||||||||| |||||| | ||||||||||||
Sbjct: 133 gctccagcacgctgcactgcaggtgcgggaacgcctccgagatgacttgggccgccgcgc 74
Query: 637 caagccctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactcct 696
| || || ||| | |||||||| |||||||| | |||||||| |||||||||| ||||
Sbjct: 73 cgaggccaccgcccacgtcgaccagggagcttatcccccggaaaacgtcgccgctctccc 14
Query: 697 tgacgacgatgtc 709
||||| |||||||
Sbjct: 13 tgacggcgatgtc 1
>gb|CB307508.1|CB307508 HFIG493 Hessian fly infested cDNA library Triticum aestivum cDNA,
mRNA sequence
Length = 646
Score = 115 bits (58), Expect = 7e-024
Identities = 130/154 (84%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctg 1082
|||||||| ||||||||||| |||||||||| |||||||||||||||||||| |||| ||
Sbjct: 312 gtgagcacacgcatgaggcggcgcaggcaggagatcttggacgggtggagcgtggccgtg 253
Query: 1083 gaaactatctggggcagggtggcgttgccaccgtggctgtggatggcgtcggctatacca 1142
| | ||||||| ||||||||| ||| || |||| ||||||||||||||| || ||
Sbjct: 252 gcggcaatctgggagagggtggcggcgccgccttggcggtggatggcgtcggcgatgccg 193
Query: 1143 aggtccactgcagacttgagagccatggacttga 1176
|| |||| || |||||||| |||||||||||||
Sbjct: 192 agttccagggcggacttgagcgccatggacttga 159
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 703 cgatgtccatgacgaagctgctgtcgcagaccat 736
|||||||||||| ||||||||||||| |||||||
Sbjct: 635 cgatgtccatgaggaagctgctgtcggagaccat 602
>gb|CK204735.1|CK204735 FGAS013271 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 863
Score = 115 bits (58), Expect = 7e-024
Identities = 130/154 (84%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctg 1082
|||||||| ||||||||||| |||||||||| |||||||||||||||||||| |||| ||
Sbjct: 416 gtgagcacacgcatgaggcggcgcaggcaggagatcttggacgggtggagcgtggccgtg 357
Query: 1083 gaaactatctggggcagggtggcgttgccaccgtggctgtggatggcgtcggctatacca 1142
| | ||||||| ||||||||| ||| || |||| ||||||||||||||| || ||
Sbjct: 356 gcggcaatctgggagagggtggcggcgccgccttggcggtggatggcgtcggcgatgccg 297
Query: 1143 aggtccactgcagacttgagagccatggacttga 1176
|| |||| || |||||||| |||||||||||||
Sbjct: 296 agttccagggcggacttgagcgccatggacttga 263
Score = 67.9 bits (34), Expect = 2e-009
Identities = 73/86 (84%)
Strand = Plus / Minus
Query: 651 acgtcgacaagggagctcagaccccggaagacgtcgccgcactccttgacgacgatgtcc 710
|||||||| ||||||| | ||| |||||||||| || |||||| ||| | ||||||||
Sbjct: 797 acgtcgaccagggagcctatcccctggaagacgtccccacactccctgatggcgatgtcc 738
Query: 711 atgacgaagctgctgtcgcagaccat 736
|||| ||||||||||||| |||||||
Sbjct: 737 atgaggaagctgctgtcggagaccat 712
>gb|CK205087.1|CK205087 FGAS013624 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 865
Score = 115 bits (58), Expect = 7e-024
Identities = 130/154 (84%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctg 1082
|||||||| ||||||||||| |||||||||| |||||||||||||||||||| |||| ||
Sbjct: 418 gtgagcacacgcatgaggcggcgcaggcaggagatcttggacgggtggagcgtggccgtg 359
Query: 1083 gaaactatctggggcagggtggcgttgccaccgtggctgtggatggcgtcggctatacca 1142
| | ||||||| ||||||||| ||| || |||| ||||||||||||||| || ||
Sbjct: 358 gcggcaatctgggagagggtggcggcgccgccttggcggtggatggcgtcggcgatgccg 299
Query: 1143 aggtccactgcagacttgagagccatggacttga 1176
|| |||| || |||||||| |||||||||||||
Sbjct: 298 agttccagggcggacttgagcgccatggacttga 265
Score = 73.8 bits (37), Expect = 3e-011
Identities = 82/97 (84%)
Strand = Plus / Minus
Query: 640 gccctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactccttga 699
|||| ||||| |||||||| ||||||| | ||| |||||||||| || |||||| |||
Sbjct: 804 gccccccggcaacgtcgaccagggagcctatcccctggaagacgtccccacactccctga 745
Query: 700 cgacgatgtccatgacgaagctgctgtcgcagaccat 736
| |||||||||||| ||||||||||||| |||||||
Sbjct: 744 tggcgatgtccatgaggaagctgctgtcggagaccat 708
>gb|BE404218.1|BE404218 WHE1203_F02_L03ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1203_F02_L03, mRNA
sequence
Length = 628
Score = 111 bits (56), Expect = 1e-022
Identities = 224/280 (80%)
Strand = Plus / Minus
Query: 457 cccagtcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaaca 516
|||||||||| | |||| |||| ||||||||||||||||||||||| | |||||| ||||
Sbjct: 341 cccagtcatgaagaaccgacttgaggaagacggcgtctgccggtggcacgctctcgaaca 282
Query: 517 tgtcgccagcaatatacttgacactggtgttagcgggagcattggcggcgacatgcggga 576
||||||| || | |||||||| |||||| || || || ||| | |||| ||| ||
Sbjct: 281 tgtcgccggcgacgtacttgacgctggtgccggccggcgccttgctgacgacgtgctcga 222
Query: 577 gatccaggacactgcactggacatgcgggaacgcggtcgagatagccagggccgccgcgc 636
| ||||| || ||||||| || ||||||||||| |||||| | ||||||||||||
Sbjct: 221 gctccagcacgctgcactccacgtgcgggaacgcctccgagatgacttgggccgccgcgc 162
Query: 637 caagccctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactcct 696
| || || || |||||||||| || ||||| | |||||||| |||||||||| ||||
Sbjct: 161 cgaggccacccccgacgtcgaccagtgagcttatcccccggaaaacgtcgccgctctccc 102
Query: 697 tgacgacgatgtccatgacgaagctgctgtcgcagaccat 736
||||| ||||||||| || ||||| |||||| |||||||
Sbjct: 101 tgacggcgatgtccacgatgaagcggctgtccgagaccat 62
Score = 50.1 bits (25), Expect = 4e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 207 cctagaacgggtatgattttgtagtcgctaaatccagcttc 247
|||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 582 cctagaaccggtataatcttgtagtcgctaaacccagcttc 542
>gb|BJ279395.1|BJ279395 BJ279395 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr2m04 5', mRNA sequence
Length = 573
Score = 109 bits (55), Expect = 5e-022
Identities = 124/147 (84%)
Strand = Plus / Minus
Query: 1032 cgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctggaaactatc 1091
||||||||||| |||||||||||||||||||||||||| | |||| ||||||| | ||||
Sbjct: 229 cgcatgaggcggcgcaggcaggggatcttggacgggtgcaccgcgaccctggacagtatc 170
Query: 1092 tggggcagggtggcgttgccaccgtggctgtggatggcgtcggctataccaaggtccact 1151
||||| ||||||||| ||| || ||| |||||||||||| || | | |||||||
Sbjct: 169 tgggggagggtggcggcgccgccatggtggtggatggcgtcagcgaggcggaggtccagg 110
Query: 1152 gcagacttgagagccatggacttgatg 1178
|| |||||||| |||||||||||||||
Sbjct: 109 gccgacttgagcgccatggacttgatg 83
>gb|BQ839184.1|BQ839184 WHE4163_C09_E17ZS Wheat CS whole plant cDNA library Triticum aestivum
cDNA clone WHE4163_C09_E17, mRNA sequence
Length = 545
Score = 109 bits (55), Expect = 5e-022
Identities = 151/183 (82%)
Strand = Plus / Minus
Query: 994 ggtgggcggcgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcagg 1053
||||| || ||||||||||||||| | | |||||| ||||||||||| ||||||||||
Sbjct: 253 ggtggtcgacgctgaagatgccggagacgacgagcacacgcatgaggcggcgcaggcagg 194
Query: 1054 ggatcttggacgggtggagcgcggccctggaaactatctggggcagggtggcgttgccac 1113
|||||||| ||||||||||| |||| ||| | ||||||| ||||| ||| ||| |
Sbjct: 193 agatcttggtcgggtggagcgtggccgtggcggcaatctgggagagggtagcggcgccgc 134
Query: 1114 cgtggctgtggatggcgtcggctataccaaggtccactgcagacttgagagccatggact 1173
| |||| |||||||||||| || || || ||||||| ||||||||||| ||||||||||
Sbjct: 133 cttggcggtggatggcgtccgcaatgccgaggtccagggcagacttgagcgccatggact 74
Query: 1174 tga 1176
|||
Sbjct: 73 tga 71
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 705 atgtccatgacgaagctgctgtcgcagaccat 736
|||||||||| ||||||||||||| |||||||
Sbjct: 545 atgtccatgaggaagctgctgtcggagaccat 514
>gb|BE490233.1|BE490233 WHE0366_H10_P20ZS Wheat cold-stressed seedling cDNA library Triticum
aestivum cDNA clone WHE0366_H10_P20, mRNA sequence
Length = 491
Score = 101 bits (51), Expect = 1e-019
Identities = 123/147 (83%)
Strand = Plus / Minus
Query: 1032 cgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctggaaactatc 1091
||||||||||| |||||||||||||||||||||||||| | || | |||||| |||||
Sbjct: 237 cgcatgaggcggcgcaggcaggggatcttggacgggtgcaccgtgaccctggcggctatc 178
Query: 1092 tggggcagggtggcgttgccaccgtggctgtggatggcgtcggctataccaaggtccact 1151
||||| ||||||||| ||| |||||| ||||||||||||||| | | ||||| |
Sbjct: 177 tgggggagggtggcgccgccgccgtggtggtggatggcgtcggcgaggcggaggtcgagg 118
Query: 1152 gcagacttgagagccatggacttgatg 1178
|| |||||||| |||||||||||||||
Sbjct: 117 gcggacttgagcgccatggacttgatg 91
>gb|BQ578376.1|BQ578376 WHE0302_B09_C18ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0302_B09_C18, mRNA
sequence
Length = 684
Score = 101 bits (51), Expect = 1e-019
Identities = 123/147 (83%)
Strand = Plus / Minus
Query: 1032 cgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctggaaactatc 1091
||||||||||| |||||||||||||||||||||||||| | |||| |||||| |||||
Sbjct: 271 cgcatgaggcggcgcaggcaggggatcttggacgggtgcaccgcgaccctggcggctatc 212
Query: 1092 tggggcagggtggcgttgccaccgtggctgtggatggcgtcggctataccaaggtccact 1151
|| || ||||||||| ||| |||||| ||||||||||||||| | | ||||| |
Sbjct: 211 tgagggagggtggcggcgccgccgtggtggtggatggcgtcggcgaggcggaggtcaagg 152
Query: 1152 gcagacttgagagccatggacttgatg 1178
|| |||||||| |||||||||||||||
Sbjct: 151 gccgacttgagcgccatggacttgatg 125
Score = 58.0 bits (29), Expect = 2e-006
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 676 ggaagacgtcgccgcactccttgacgacgatgtccatgacgaagctgctgtcgcagacca 735
||||||| |||||||||||| | | | |||||||||||| |||||||||||| ||||||
Sbjct: 666 ggaagacctcgccgcactccctcatggcgatgtccatgatgaagctgctgtccgagacca 607
Query: 736 t 736
|
Sbjct: 606 t 606
>gb|BE414993.1|BE414993 MWL010.A06F990625 ITEC MWL Wheat Root Library Triticum aestivum cDNA
clone MWL010.A06, mRNA sequence
Length = 410
Score = 95.6 bits (48), Expect = 7e-018
Identities = 127/154 (82%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctg 1082
|||||||| ||||||||||| |||||||||| |||||||||||||||||||| | || ||
Sbjct: 175 gtgagcacacgcatgaggcggcgcaggcaggagatcttggacgggtggagcgtgcccgtg 116
Query: 1083 gaaactatctggggcagggtggcgttgccaccgtggctgtggatggcgtcggctatacca 1142
| | ||||||| ||||||||| || || || | ||||||||||||||| || ||
Sbjct: 115 gcggcaatctgggagagggtggcggcnccgccttgncggtggatggcgtcggcgatgccg 56
Query: 1143 aggtccactgcagacttgagagccatggacttga 1176
|| |||| || |||||||| |||||||||||||
Sbjct: 55 agttccagggcggacttgagcgccatggacttga 22
>gb|AL822821.1|AL822821 AL822821 p:335 Triticum aestivum cDNA clone A03_p335_plate_3, mRNA
sequence
Length = 512
Score = 95.6 bits (48), Expect = 7e-018
Identities = 90/104 (86%)
Strand = Plus / Minus
Query: 1032 cgcatgaggcgacgcaggcaggggatcttggacgggtggagcgcggccctggaaactatc 1091
||||||||||| |||||||||||||||||||||||||| | || | |||||| |||||
Sbjct: 250 cgcatgaggcggcgcaggcaggggatcttggacgggtgcaccgtgaccctggcggctatc 191
Query: 1092 tggggcagggtggcgttgccaccgtggctgtggatggcgtcggc 1135
||||| ||||||||| ||| |||||| |||||||||||||||
Sbjct: 190 tgggggagggtggcgccgccgccgtggtggtggatggcgtcggc 147
>gb|CA691512.1|CA691512 wlm96.pk053.j18 wlm96 Triticum aestivum cDNA clone wlm96.pk053.j18
5' end, mRNA sequence
Length = 488
Score = 79.8 bits (40), Expect = 4e-013
Identities = 139/172 (80%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||||||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 362 tccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttc 303
Query: 419 cttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaacccactt 478
||| || ||||| |||| ||||| ||| || |||| | ||| || || |||| |||||
Sbjct: 302 cttgcaattcttcagtagcttgacacagtcttcatcacaccaatcgtgaaaaatgcactt 243
Query: 479 aaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagcaata 530
||||| | || || |||||||||||| || |||||| ||||||| ||||
Sbjct: 242 caggaaaagagcatccgccggtggaatgtacttaaacatatcgccagaaata 191
>gb|CK206856.1|CK206856 FGAS018467 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1017
Score = 79.8 bits (40), Expect = 4e-013
Identities = 139/172 (80%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||||||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 509 tccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttc 450
Query: 419 cttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaacccactt 478
||| || ||||| |||| ||||| ||| || |||| | ||| || || |||| |||||
Sbjct: 449 cttgcaattcttcagtagcttgacacagtcttcatcacaccaatcgtgaaaaatgcactt 390
Query: 479 aaggaagacggcgtctgccggtggaatgctctcaaacatgtcgccagcaata 530
||||| | || || |||||||||||| || |||||| ||||||| ||||
Sbjct: 389 caggaaaagagcatccgccggtggaatgtacttaaacatatcgccagaaata 338
>gb|CD866826.1|CD866826 AZO2.104I16R010327 AZO2 Triticum aestivum cDNA clone AZO2104I16,
mRNA sequence
Length = 675
Score = 77.8 bits (39), Expect = 2e-012
Identities = 120/147 (81%)
Strand = Plus / Plus
Query: 377 gattatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtat 436
|||||| |||||||||||| || || | ||| |||| |||||| |||||||| |||||
Sbjct: 453 gattattacctttcctcctttctctctcggaggaatagatttcttgcagttcttcagtat 512
Query: 437 cttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgc 496
||||| ||| || | | ||||||||||| | |||||||| || ||||| ||||||||
Sbjct: 513 cttgacacagtcctcgtgtccccagtcatgtagtacccacttgagaaagacagcgtctgc 572
Query: 497 cggtggaatgctctcaaacatgtcgcc 523
||| |||| |||||| |||||||||||
Sbjct: 573 cggcggaacgctctcgaacatgtcgcc 599
>gb|CK162825.1|CK162825 FGAS015425 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1032
Score = 77.8 bits (39), Expect = 2e-012
Identities = 72/83 (86%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||||||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 464 tccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatagcttc 405
Query: 419 cttacagttcttgagtatcttga 441
||| || ||||| |||| |||||
Sbjct: 404 cttgcaattcttcagtagcttga 382
>gb|BQ801256.1|BQ801256 WHE2812_B08_D16ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2812_B08_D16, mRNA
sequence
Length = 585
Score = 75.8 bits (38), Expect = 6e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||| ||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 374 tccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttc 315
Query: 419 cttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaacccactt 478
||| || || || | || ||||| ||| || |||| ||||| ||||| |||||||||||
Sbjct: 314 cttgcaatttttcaataacttgacacagtcttcatcaccccaatcatgaaaaacccactt 255
Query: 479 aaggaa 484
|||||
Sbjct: 254 taggaa 249
>gb|CD934893.1|CD934893 OV.002E03R010412 OV Triticum aestivum cDNA clone OV002E03, mRNA
sequence
Length = 498
Score = 75.8 bits (38), Expect = 6e-012
Identities = 104/126 (82%)
Strand = Plus / Plus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||| ||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 334 tccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttc 393
Query: 419 cttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaacccactt 478
||| || || || | || ||||| ||| || |||| ||||| ||||| |||||||||||
Sbjct: 394 cttgcaatttttcaataacttgacacagtcttcatcaccccaatcatgaaaaacccactt 453
Query: 479 aaggaa 484
|||||
Sbjct: 454 taggaa 459
>gb|CD939689.1|CD939689 OV.114J05F010312 OV Triticum aestivum cDNA clone OV114J05, mRNA
sequence
Length = 712
Score = 75.8 bits (38), Expect = 6e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||| ||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 630 tccaaccaccatatctacgattatcacctttccaccagcatctctgggaggaatagcttc 571
Query: 419 cttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaacccactt 478
||| || || || | || ||||| ||| || |||| ||||| ||||| |||||||||||
Sbjct: 570 cttgcaatttttcaataacttgacacagtcttcatcaccccaatcatgaaaaacccactt 511
Query: 479 aaggaa 484
|||||
Sbjct: 510 taggaa 505
>gb|BE406468.1|BE406468 WHE0416_g08_n16zB Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0416_g08_n16, mRNA
sequence
Length = 363
Score = 73.8 bits (37), Expect = 3e-011
Identities = 94/113 (83%)
Strand = Plus / Minus
Query: 411 atagctttcttacagttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaa 470
|||| |||||| |||||||| |||||||||| ||| || | | ||||||||||| |
Sbjct: 239 atagatttcttgcagttctttagtatcttgacacagtcctcgtgtccccagtcatgtagt 180
Query: 471 acccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgcc 523
|||||||| || ||||| ||||||||||| |||| |||||| |||||||||||
Sbjct: 179 acccacttgagaaagacagcgtctgccggcggaacgctctcgaacatgtcgcc 127
>gb|CA688703.1|CA688703 wlm96.pk041.h24 wlm96 Triticum aestivum cDNA clone wlm96.pk041.h24
5' end, mRNA sequence
Length = 497
Score = 65.9 bits (33), Expect = 6e-009
Identities = 76/89 (85%), Gaps = 1/89 (1%)
Strand = Plus / Plus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcc-tgcatccctggaaggtatagctt 417
|||||| |||||||||||||||||||||||||| || ||||| |||| ||| |||||||
Sbjct: 361 tccaaccaccatatcaacgattatcacctttccaccaagcatctctgggagggatagctt 420
Query: 418 tcttacagttcttgagtatcttgatacaa 446
||| || ||||| |||| ||||| ||||
Sbjct: 421 ccttgcaattcttcagtagcttgacacaa 449
>gb|CA682352.1|CA682352 wlm24.pk0028.a11 wlm24 Triticum aestivum cDNA clone
wlm24.pk0028.a11 5' end, mRNA sequence
Length = 488
Score = 63.9 bits (32), Expect = 2e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatag 414
|||||| |||||||||||||||||||||||||| || ||||| |||| ||| ||||
Sbjct: 202 tccaaccaccatatcaacgattatcacctttccaccagcatctctgggagggatag 257
>gb|BQ487518.1|BQ487518 WHE2164_C01_E02ZY Triticum turgidum L. var. durum (durum wheat)
whole plant cDNA library Triticum turgidum cDNA clone
WHE2164_C01_E02, mRNA sequence
Length = 542
Score = 61.9 bits (31), Expect = 1e-007
Identities = 88/107 (82%)
Strand = Plus / Plus
Query: 366 accatatcaacgattatcacctttcctcctgcatccctggaaggtatagctttcttacag 425
||||||||||| |||||||||||||| || ||||| |||| ||| ||||||| ||| ||
Sbjct: 279 accatatcaacaattatcacctttccaccagcatctctgggagggatagcttccttgcat 338
Query: 426 ttcttgagtatcttgatacaatcagcatcgccccagtcatgcaaaac 472
|| || | |||||| | ||| || |||||||||| ||||| |||||
Sbjct: 339 tttttcaatatcttaacacagtcttcatcgccccaatcatgaaaaac 385
Score = 44.1 bits (22), Expect = 0.023
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 299 catgatgaagagatcaaacaagacctgagtctct 332
|||||| |||||||||||||| ||||| ||||||
Sbjct: 212 catgataaagagatcaaacaaaacctgtgtctct 245
>gb|BJ284394.1|BJ284394 BJ284394 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr2m04 3', mRNA sequence
Length = 375
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 183 tagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatcca 242
|||||||||||||| || || | |||||||| ||||| || |||||||||||||| |||
Sbjct: 81 tagacctcgatgatcgaccggaaccctagaaccggtataatcttgtagtcgctaaaccca 140
Query: 243 gcttc 247
|||||
Sbjct: 141 gcttc 145
>gb|AL826309.1|AL826309 AL826309 p:436 Triticum aestivum cDNA clone H06_p436_plate_8_run_2,
mRNA sequence
Length = 298
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 183 tagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatcca 242
|||||||||||||| || || | |||||||| ||||| || |||||||||||||| |||
Sbjct: 74 tagacctcgatgatcgaccggaaccctagaaccggtataatcttgtagtcgctaaaccca 15
Query: 243 gcttc 247
|||||
Sbjct: 14 gcttc 10
>gb|CA611655.1|CA611655 wr1.pk0128.c8 wr1 Triticum aestivum cDNA clone wr1.pk0128.c8 5'
end, mRNA sequence
Length = 460
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 183 tagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatcca 242
|||||||||||||| || || | |||||||| ||||| || |||||||||||||| |||
Sbjct: 275 tagacctcgatgatcgaccggaaccctagaaccggtataatcttgtagtcgctaaaccca 216
Query: 243 gcttc 247
|||||
Sbjct: 215 gcttc 211
>gb|CA642361.1|CA642361 wre1n.pk0054.d1 wre1n Triticum aestivum cDNA clone wre1n.pk0054.d1
5' end, mRNA sequence
Length = 376
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 183 tagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatcca 242
|||||||||||||| || || | |||||||| ||||| || |||||||||||||| |||
Sbjct: 135 tagacctcgatgatcgaccggaaccctagaaccggtataatcttgtagtcgctaaaccca 76
Query: 243 gcttc 247
|||||
Sbjct: 75 gcttc 71
>gb|CA711702.1|CA711702 wdk2c.pk014.h15 wdk2c Triticum aestivum cDNA clone wdk2c.pk014.h15 5'
end, mRNA sequence
Length = 465
Score = 56.0 bits (28), Expect = 6e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 1097 cagggtggcgttgccaccgtggctgtggatggcgtcggctataccaaggtccactgcaga 1156
|||||||||| |||| ||| ||| |||||||||||||| || || |||||||| || |
Sbjct: 228 cagggtggcggtgccgccgcggcggtggatggcgtcggtgatgccgaggtccacggcgca 169
Query: 1157 cttgagagccatggacttga 1176
|||||| | |||||||||||
Sbjct: 168 cttgagcgacatggacttga 149
>gb|CA691251.1|CA691251 wlm96.pk050.k6 wlm96 Triticum aestivum cDNA clone wlm96.pk050.k6 5'
end, mRNA sequence
Length = 468
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 361 caacaaccatatcaacgattatcacctttcc 391
|||| ||||||||||||||||||||||||||
Sbjct: 418 caaccaccatatcaacgattatcacctttcc 448
>gb|BQ162433.1|BQ162433 WHE0416_g08_n16zT Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0416_g08_n16, mRNA
sequence
Length = 501
Score = 50.1 bits (25), Expect = 4e-004
Identities = 87/105 (82%), Gaps = 2/105 (1%)
Strand = Plus / Plus
Query: 180 gggtagacctcgatgatggatc-gaacacctagaacgggtatgattttgtagtcgctaaa 238
||||||||||||||||| || | |||| |||||||| ||||| || |||||| | |||||
Sbjct: 290 gggtagacctcgatgattgacctgaac-cctagaactggtataatcttgtagccactaaa 348
Query: 239 tccagcttcggaaattatctttttccactcatgttcgtctcgctc 283
||||||||| | |||||||||||||| || || ||||||||
Sbjct: 349 cccagcttcgaggaagatctttttccactcttgctcatctcgctc 393
>gb|BU100649.1|BU100649 WHE3355_H09_O17ZS Chinese Spring aluminum-stressed root tip cDNA
library Triticum aestivum cDNA clone WHE3355_H09_O17,
mRNA sequence
Length = 649
Score = 50.1 bits (25), Expect = 4e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 180 gggtagacctcgatgatggatcgaa 204
|||||||||||||||||||||||||
Sbjct: 267 gggtagacctcgatgatggatcgaa 291
Score = 44.1 bits (22), Expect = 0.023
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 366 accatatcaacgattatcacctttcctcctgcatccct 403
|||||||| | |||||||||||| || |||||||||||
Sbjct: 462 accatatcgatgattatcaccttcccgcctgcatccct 499
>gb|CA612183.1|CA612183 wr1.pk0141.f9 wr1 Triticum aestivum cDNA clone wr1.pk0141.f9 5'
end, mRNA sequence
Length = 487
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 693 tccttgacgacgatgtccatgacgaagctgctgtcg 728
||||||| | |||||||||||| |||||||||||||
Sbjct: 323 tccttgatggcgatgtccatgatgaagctgctgtcg 288
>gb|CA689381.1|CA689381 wlm96.pk046.i8 wlm96 Triticum aestivum cDNA clone wlm96.pk046.i8 5'
end, mRNA sequence
Length = 538
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 368 catatcaacgattatcacctttcc 391
||||||||||||||||||||||||
Sbjct: 478 catatcaacgattatcacctttcc 501
>gb|CA628512.1|CA628512 wle1n.pk0001.g1 wle1n Triticum aestivum cDNA clone wle1n.pk0001.g1
5' end, mRNA sequence
Length = 407
Score = 46.1 bits (23), Expect = 0.006
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 225 ttgtagtcgctaaatccagcttc 247
|||||||||||||||||||||||
Sbjct: 249 ttgtagtcgctaaatccagcttc 271
>gb|BJ256875.1|BJ256875 BJ256875 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh18m12 5', mRNA sequence
Length = 344
Score = 44.1 bits (22), Expect = 0.023
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 178 atgggtagacctcgatgatggatcga 203
|||||||||||||||||| |||||||
Sbjct: 60 atgggtagacctcgatgacggatcga 35
>gb|BJ262440.1|BJ262440 BJ262440 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh18m12 3', mRNA sequence
Length = 361
Score = 44.1 bits (22), Expect = 0.023
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 178 atgggtagacctcgatgatggatcga 203
|||||||||||||||||| |||||||
Sbjct: 264 atgggtagacctcgatgacggatcga 289
>gb|CA612125.1|CA612125 wr1.pk0140.f12 wr1 Triticum aestivum cDNA clone wr1.pk0140.f12 5'
end, mRNA sequence
Length = 461
Score = 44.1 bits (22), Expect = 0.023
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 462 tcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcg 521
||||||||||||||||| || | |||| ||| ||||| || ||| |||||||||||||
Sbjct: 99 tcatgcaaaacccacttgagtagaacggtgtccgccggcgggatgtactcaaacatgtcg 40
Query: 522 cc 523
||
Sbjct: 39 cc 38
>gb|CA645644.1|CA645644 wre1n.pk0099.f10 wre1n Triticum aestivum cDNA clone
wre1n.pk0099.f10 5' end, mRNA sequence
Length = 316
Score = 44.1 bits (22), Expect = 0.023
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 178 atgggtagacctcgatgatggatcga 203
|||||||||||||||||| |||||||
Sbjct: 251 atgggtagacctcgatgacggatcga 276
>gb|CD880941.1|CD880941 F1.100G13F010315 F1 Triticum aestivum cDNA clone F1100G13, mRNA
sequence
Length = 689
Score = 44.1 bits (22), Expect = 0.023
Identities = 55/66 (83%)
Strand = Plus / Minus
Query: 455 gccccagtcatgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaa 514
|||||||||||||||||| ||| || | ||| || || |||||||||||| ||||||
Sbjct: 250 gccccagtcatgcaaaacattcttgagcaggacagcatccgccggtggaatggactcaaa 191
Query: 515 catgtc 520
||||||
Sbjct: 190 catgtc 185
>gb|CA621418.1|CA621418 wl1n.pk0065.h7 wl1n Triticum aestivum cDNA clone wl1n.pk0065.h7 5'
end, mRNA sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.089
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 175 atcatgggtagacctcgatga 195
|||||||||||||||||||||
Sbjct: 162 atcatgggtagacctcgatga 182
>gb|CA622415.1|CA622415 wl1n.pk0095.e2 wl1n Triticum aestivum cDNA clone wl1n.pk0095.e2 5'
end, mRNA sequence
Length = 306
Score = 42.1 bits (21), Expect = 0.089
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 175 atcatgggtagacctcgatga 195
|||||||||||||||||||||
Sbjct: 223 atcatgggtagacctcgatga 203
>gb|CA624529.1|CA624529 wl1n.pk0120.b5 wl1n Triticum aestivum cDNA clone wl1n.pk0120.b5 5'
end, mRNA sequence
Length = 309
Score = 42.1 bits (21), Expect = 0.089
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 175 atcatgggtagacctcgatga 195
|||||||||||||||||||||
Sbjct: 149 atcatgggtagacctcgatga 129
>gb|CK199043.1|CK199043 FGAS007533 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 864
Score = 42.1 bits (21), Expect = 0.089
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 237 aatccagcttcggaaattatctttttcca 265
|||||||||||||||| |||||||||||
Sbjct: 510 aatccagcttcggaaaagatctttttcca 538
>gb|CK200736.1|CK200736 FGAS009253 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 866
Score = 42.1 bits (21), Expect = 0.089
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 183 tagacctcgatgatggatcgaacacctagaacgggtatgattttgtagtcgctaaatcca 242
||||||||||| ||||| | || ||||| || |||||||| |||||| | || ||||||
Sbjct: 293 tagacctcgattatggacctaattcctagcacaggtatgatattgtagccactgaatcca 352
Query: 243 gcttc 247
|||||
Sbjct: 353 gcttc 357
>gb|BE406921.1|BE406921 WHE0433_g09_m17zS Wheat etiolated seedling root cDNA library Triticum
aestivum cDNA clone WHE0433_g09_m17, mRNA sequence
Length = 454
Score = 40.1 bits (20), Expect = 0.35
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggc 1050
|||||||| ||||||||||| |||||||
Sbjct: 172 gtgagcacgcgcatgaggcggcgcaggc 145
>gb|BE425724.1|BE425724 WHE0303_C01_C01ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0303_C01_C01, mRNA
sequence
Length = 177
Score = 40.1 bits (20), Expect = 0.35
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 967 gctcgccgccgccgtcgtcc 986
||||||||||||||||||||
Sbjct: 98 gctcgccgccgccgtcgtcc 117
>gb|BE427290.1|BE427290 PSR6211 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum cDNA
clone PSR6211, mRNA sequence
Length = 640
Score = 40.1 bits (20), Expect = 0.35
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1152 gcagacttgagagccatgga 1171
||||||||||||||||||||
Sbjct: 132 gcagacttgagagccatgga 113
>gb|BE427303.1|BE427303 PSR6225 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum cDNA
clone PSR6225, mRNA sequence
Length = 1151
Score = 40.1 bits (20), Expect = 0.35
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1152 gcagacttgagagccatgga 1171
||||||||||||||||||||
Sbjct: 231 gcagacttgagagccatgga 212
>gb|BI479715.1|BI479715 WHE3451_C03_E05ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE3451_C03_E05, mRNA sequence
Length = 595
Score = 40.1 bits (20), Expect = 0.35
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 967 gctcgccgccgccgtcgtcc 986
||||||||||||||||||||
Sbjct: 133 gctcgccgccgccgtcgtcc 152
>gb|BJ228284.1|BJ228284 BJ228284 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl5j12 3', mRNA sequence
Length = 647
Score = 40.1 bits (20), Expect = 0.35
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 176 tcatgggtagacctcgatgatggatcga 203
|||||||||||| || ||||||||||||
Sbjct: 130 tcatgggtagacttcaatgatggatcga 157
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 330,418
Number of Sequences: 636343
Number of extensions: 330418
Number of successful extensions: 96915
Number of sequences better than 0.5: 68
Number of HSP's better than 0.5 without gapping: 66
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 96794
Number of HSP's gapped (non-prelim): 115
length of query: 1228
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1208
effective length of database: 354,513,379
effective search space: 428252161832
effective search space used: 428252161832
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)