BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276642.2.1
(1062 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ483142.1|BQ483142 WHE3505_B05_C09ZS Wheat unstressed r... 339 2e-091
gb|BJ226525.1|BJ226525 BJ226525 Y. Ogihara unpublished cDNA... 246 3e-063
gb|BJ231444.1|BJ231444 BJ231444 Y. Ogihara unpublished cDNA... 246 3e-063
gb|CK209167.1|CK209167 FGAS020915 Triticum aestivum FGAS: L... 236 3e-060
gb|CN010926.1|CN010926 WHE3877_G10_N19ZS Wheat Fusarium gra... 216 2e-054
gb|BJ257987.1|BJ257987 BJ257987 Y. Ogihara unpublished cDNA... 184 8e-045
gb|CV770492.1|CV770492 FGAS064885 Triticum aestivum FGAS: L... 172 3e-041
gb|CD938467.1|CD938467 OV.110B12F010312 OV Triticum aestivu... 135 7e-030
gb|BJ263607.1|BJ263607 BJ263607 Y. Ogihara unpublished cDNA... 123 3e-026
gb|CD893702.1|CD893702 G118.124F07F010828 G118 Triticum aes... 109 4e-022
gb|CD915996.1|CD915996 G550.128M19F010717 G550 Triticum aes... 109 4e-022
gb|CD915997.1|CD915997 G550.128M19R010920 G550 Triticum aes... 88 1e-015
gb|CD894158.1|CD894158 G118.125I12R011115 G118 Triticum aes... 86 6e-015
gb|CD894157.1|CD894157 G118.125I12F010828 G118 Triticum aes... 78 1e-012
gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aesti... 64 2e-008
gb|CD938468.1|CD938468 OV.110B12R010406 OV Triticum aestivu... 64 2e-008
gb|BJ237812.1|BJ237812 BJ237812 Y. Ogihara unpublished cDNA... 56 5e-006
gb|BI750806.1|BI750806 Ta01_02d11_R Ta01_AAFC_ECORC_Fusariu... 54 2e-005
gb|CV973529.1|CV973529 B02_q444_18 q:444 Triticum aestivum ... 50 3e-004
gb|BJ300905.1|BJ300905 BJ300905 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ306301.1|BJ306301 BJ306301 Y. Ogihara unpublished cDNA... 46 0.005
gb|CA497356.1|CA497356 WHE3226_E01_I02ZT Wheat meiotic anth... 44 0.020
gb|CA599858.1|CA599858 waw1c.pk004.l1 waw1c Triticum aestiv... 44 0.020
gb|CD898343.1|CD898343 G174.108N06F010821 G174 Triticum aes... 44 0.020
gb|CD898344.1|CD898344 G174.108N06R011121 G174 Triticum aes... 44 0.020
gb|CD906028.1|CD906028 G468.103L17F010808 G468 Triticum aes... 42 0.077
>gb|BQ483142.1|BQ483142 WHE3505_B05_C09ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3505_B05_C09, mRNA sequence
Length = 696
Score = 339 bits (171), Expect = 2e-091
Identities = 402/479 (83%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| ||||||||| |
Sbjct: 629 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtctggtaac 570
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | |||||||||||||||||||| ||||||||
Sbjct: 569 accgactcggtcacgttgtagcctccgtcaggatccaccaccctgatgtacgtctcctgg 510
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||||||||||||||| || || || || ||||| || || |||||||||||
Sbjct: 509 ccgaggtaccacgtgtccaggttctccgtgcgcacgttccagaaccccgggctgtcaagc 450
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 449 gacaacaggacggcggtccatgctccgggaaacacctgagtggtgcaacgggaaacacca 390
Query: 793 tcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccattcctaca 852
|||||||||||||| ||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 389 tcccacttgttgtatgtcccacggctgttgtcggtccactcaccgtagtccattcctacg 330
Query: 853 acccagaatgcatatccatcaatgtggtaggtctggacagttgagtcattgttctgaaat 912
|||||||| || |||||||| || ||||||||||| || | | |||||||||||||||
Sbjct: 329 acccagaaggcgtatccatcgatatggtaggtctgaactttcgtgtcattgttctgaaac 270
Query: 913 acaatttccaaaaagttcttgtatgtggagttaatgacagatgttctgatcactggcggt 972
||||| |||| ||||||||||| || ||||| |||||||| | ||||| || ||||||
Sbjct: 269 acaatctccatgaagttcttgtacgtcgagttgatgacagaagacctgataaccggcggt 210
Query: 973 ccatcaattggcattgtagggaagtcaagtgtgtagacatccttcttgtcgtacagatc 1031
|||||| ||||| || |||||||| ||||||||||| || |||||||| || |||||
Sbjct: 209 ccatcagacggcatggttgggaagtcgagtgtgtagacttctttcttgtcatagagatc 151
>gb|BJ226525.1|BJ226525 BJ226525 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl26n22 5', mRNA sequence
Length = 581
Score = 246 bits (124), Expect = 3e-063
Identities = 262/308 (85%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| ||||||||| |
Sbjct: 310 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtctggtaac 251
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | |||||||||||||||||||| ||||||||
Sbjct: 250 accgactcggtcacgttgtagcctccgtcaggatccaccaccctgatgtacgtctcctgg 191
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||||||||||||||| || || || || ||||| || || |||||||||||
Sbjct: 190 ccgaggtaccacgtgtccaggttctccgtgcgcacgttccagaaccccgggctgtcaagc 131
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 130 gacaacaggacggcggtccatgctccgggaaacacctgagtggtgcaacgggaaacacca 71
Query: 793 tcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccattcctaca 852
|||||||||||||| ||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 70 tcccacttgttgtatgtcccacggctgttgtcggtccactcaccgtagtccattcctacg 11
Query: 853 acccagaa 860
||||||||
Sbjct: 10 acccagaa 3
>gb|BJ231444.1|BJ231444 BJ231444 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl26n22 3', mRNA sequence
Length = 559
Score = 246 bits (124), Expect = 3e-063
Identities = 262/308 (85%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| ||||||||| |
Sbjct: 250 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtctggtaac 309
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | |||||||||||||||||||| ||||||||
Sbjct: 310 accgactcggtcacgttgtagcctccgtcaggatccaccaccctgatgtacgtctcctgg 369
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||||||||||||||| || || || || ||||| || || |||||||||||
Sbjct: 370 ccgaggtaccacgtgtccaggttctccgtgcgcacgttccagaaccccgggctgtcaagc 429
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 430 gacaacaggacggcggtccatgctccgggaaacacctgagtggtgcaacgggaaacacca 489
Query: 793 tcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccattcctaca 852
|||||||||||||| ||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 490 tcccacttgttgtatgtcccacggctgttgtcggtccactcaccgtagtccattcctacg 549
Query: 853 acccagaa 860
||||||||
Sbjct: 550 acccagaa 557
>gb|CK209167.1|CK209167 FGAS020915 Triticum aestivum FGAS: Library 5 GATE 7 Triticum aestivum
cDNA, mRNA sequence
Length = 1141
Score = 236 bits (119), Expect = 3e-060
Identities = 371/455 (81%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| |||||| || |
Sbjct: 419 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtccggtatc 478
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 479 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 538
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||||||||||||||| || || || || ||||| || || |||||||| ||
Sbjct: 539 ccgaggtaccacgtgtccaggttctccgtgcgcacgttccagaaccccgggctgtcgagc 598
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || |||||||||||||| || || |||||||| |||||||| |||||||||
Sbjct: 599 gacaacaggacggcagtccatgctccggggaatacctgagtggtgcaacgggaaacacca 658
Query: 793 tcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccattcctaca 852
|||||||||||||| || ||| || | | |||||||||||||||||||||||||
Sbjct: 659 tcccacttgttgtacgtagaacgactttcgttcttccactcaccatagtccattcctacg 718
Query: 853 acccagaatgcatatccatcaatgtggtaggtctggacagttgagtcattgttctgaaat 912
|||||||| |||||||| || |||||||||||||| || | | ||| | |||||||||
Sbjct: 719 acccagaaggcatatccgtcgatgtggtaggtctgaaccttcgtgtcgtggttctgaaac 778
Query: 913 acaatttccaaaaagttcttgtatgtggagttaatgacagatgttctgatcactggcggt 972
||||| |||| ||||||||||| |||||||| |||||||| | || ||| ||||||||
Sbjct: 779 acaatctccatgaagttcttgtacgtggagttgatgacagaagatccaatcgctggcggt 838
Query: 973 ccatcaattggcattgtagggaagtcaagtgtgta 1007
|| ||| ||| || || |||||||| ||||||||
Sbjct: 839 ccgtcagatgggatggttgggaagtccagtgtgta 873
>gb|CN010926.1|CN010926 WHE3877_G10_N19ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3877_G10_N19,
mRNA sequence
Length = 672
Score = 216 bits (109), Expect = 2e-054
Identities = 292/353 (82%)
Strand = Plus / Minus
Query: 643 ggatccaccaccctgatgtaagtctcctgacccagataccacgtgtccaggttttctgtc 702
||||||||||||| |||||| |||||||| || || ||||||||||||||||| || ||
Sbjct: 353 ggatccaccacccggatgtacgtctcctggccgaggtaccacgtgtccaggttctccgtg 294
Query: 703 cgtacattccaaaatcctgggctgtcaagtgacagcatcacagcagtccatgctcccgga 762
|| || ||||| || || |||||||| || |||| || || |||||||||||||| ||
Sbjct: 293 cgcacgttccagaaccccgggctgtcgagcgacaacaggacggcagtccatgctccgggg 234
Query: 763 aacacctgagtcgtgcaacgagaaacaccatcccacttgttgtaagtcccacggctattc 822
|| |||||||| |||||||| ||||||||||||||||||||||| || ||| || |
Sbjct: 233 aatacctgagtggtgcaacgggaaacaccatcccacttgttgtacgtagaacgactttcg 174
Query: 823 tcagtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtag 882
| ||||||||||||||||||||||||| |||||||| |||||||| || |||||||||
Sbjct: 173 ttcttccactcaccatagtccattcctacgacccagaaggcatatccgtcgatgtggtag 114
Query: 883 gtctggacagttgagtcattgttctgaaatacaatttccaaaaagttcttgtatgtggag 942
||||| || | | ||| ||||||||||| ||||| |||| ||||||||||| || |||
Sbjct: 113 gtctgaaccttcgtgtcgttgttctgaaacacaatctccatgaagttcttgtacgttgag 54
Query: 943 ttaatgacagatgttctgatcactggcggtccatcaattggcattgtagggaa 995
|| |||||||| | || |||| |||||||||| ||| |||||| || |||||
Sbjct: 53 ttgatgacagaagatccgatcgctggcggtccgtcagatggcatggttgggaa 1
>gb|BJ257987.1|BJ257987 BJ257987 Y. Ogihara unpublished cDNA library, Wh_h Triticum aestivum
cDNA clone whh5g03 5', mRNA sequence
Length = 601
Score = 184 bits (93), Expect = 8e-045
Identities = 315/389 (80%)
Strand = Plus / Minus
Query: 643 ggatccaccaccctgatgtaagtctcctgacccagataccacgtgtccaggttttctgtc 702
||||||||||||| |||||| |||||||| || || ||||| |||||||| || || ||
Sbjct: 567 ggatccaccacccggatgtacgtctcctggccgaggtaccaggtgtccagattctccgtg 508
Query: 703 cgtacattccaaaatcctgggctgtcaagtgacagcatcacagcagtccatgctcccgga 762
|| || ||||| || || |||||||| || |||| || || || ||||||||||| ||
Sbjct: 507 cgcacgttccagaaccccgggctgtcgagcgacaacaggacggcggtccatgctccgggg 448
Query: 763 aacacctgagtcgtgcaacgagaaacaccatcccacttgttgtaagtcccacggctattc 822
||||||||||| ||||| || ||||| ||||||||||||||||| || ||| || |
Sbjct: 447 aacacctgagtggtgcatcgggaaacgccatcccacttgttgtacgtagaacgactttcg 388
Query: 823 tcagtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtag 882
| |||||||||||||||||||||| || |||||||| || ||||| || |||||||||
Sbjct: 387 ttcttccactcaccatagtccattcccacgacccagaaggcgtatccgtcgatgtggtag 328
Query: 883 gtctggacagttgagtcattgttctgaaatacaatttccaaaaagttcttgtatgtggag 942
||||| || | | ||| |||||||| || ||||| |||| ||||||||||| || |||
Sbjct: 327 gtctgaaccttcgtgtcgttgttctggaacacaatctccatgaagttcttgtacgtcgag 268
Query: 943 ttaatgacagatgttctgatcactggcggtccatcaattggcattgtagggaagtcaagt 1002
|| |||||||| | || |||| | |||||||||||| ||||| || |||||||| |||
Sbjct: 267 ttgatgacagaagatccgatcgccggcggtccatcagacggcatggttgggaagtccagt 208
Query: 1003 gtgtagacatccttcttgtcgtacagatc 1031
|||||||| || |||||||| || |||||
Sbjct: 207 gtgtagacttctttcttgtcatagagatc 179
>gb|CV770492.1|CV770492 FGAS064885 Triticum aestivum FGAS: Library 2 Gate 3 Triticum aestivum
cDNA, mRNA sequence
Length = 870
Score = 172 bits (87), Expect = 3e-041
Identities = 303/375 (80%)
Strand = Plus / Minus
Query: 657 gatgtaagtctcctgacccagataccacgtgtccaggttttctgtccgtacattccaaaa 716
|||||| |||||||| || || ||||| |||||||| || || || || || ||||| ||
Sbjct: 680 gatgtacgtctcctggccgaggtaccaggtgtccagattctccgtgcgcacgttccagaa 621
Query: 717 tcctgggctgtcaagtgacagcatcacagcagtccatgctcccggaaacacctgagtcgt 776
|| |||||||| || |||| || || || ||||||||||| || ||||||||||| ||
Sbjct: 620 ccccgggctgtcgagcgacaacaggacggcggtccatgctccggggaacacctgagtggt 561
Query: 777 gcaacgagaaacaccatcccacttgttgtaagtcccacggctattctcagtccactcacc 836
|||||| ||||| ||||||||||||||||| || ||| || | | ||||||||||
Sbjct: 560 gcaacgggaaacgccatcccacttgttgtacgtagaacgactttcgttcttccactcacc 501
Query: 837 atagtccattcctacaacccagaatgcatatccatcaatgtggtaggtctggacagttga 896
|||||||||||| || |||||||| || ||||| || |||||||||||||| || | |
Sbjct: 500 atagtccattcccacgacccagaaggcgtatccgtcgatgtggtaggtctgaaccttcgt 441
Query: 897 gtcattgttctgaaatacaatttccaaaaagttcttgtatgtggagttaatgacagatgt 956
||| |||||||| || ||||| |||| ||||||||||| || ||||| |||||||| |
Sbjct: 440 gtcgttgttctggaacacaatctccatgaagttcttgtacgtcgagttgatgacagaaga 381
Query: 957 tctgatcactggcggtccatcaattggcattgtagggaagtcaagtgtgtagacatcctt 1016
|| |||| | |||||||||||| ||||| || |||||||| ||||||||||| || ||
Sbjct: 380 tccgatcgccggcggtccatcagacggcatggttgggaagtccagtgtgtagacttcttt 321
Query: 1017 cttgtcgtacagatc 1031
|||||| || |||||
Sbjct: 320 cttgtcatagagatc 306
>gb|CD938467.1|CD938467 OV.110B12F010312 OV Triticum aestivum cDNA clone OV110B12, mRNA
sequence
Length = 716
Score = 135 bits (68), Expect = 7e-030
Identities = 248/308 (80%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||||||||| ||||| ||| |||||||||||||| |||| |||||| || |
Sbjct: 311 ggcttctgagccttttgtttttccctgaggaggccacagaagagggcgttgtccggcaac 252
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 251 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 192
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||| |||||||| || || || || || ||||| || || |||||||| ||
Sbjct: 191 ccgaggtaccaggtgtccagattctccgtgcgcacgttccagaaccccgggctgtcgagc 132
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| || ||||||||||| |||||||| ||||| |||
Sbjct: 131 gacaacaggacggcggtccatgctccggggaacacctgagtggtgcaacgggaaacgcca 72
Query: 793 tcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccattcctaca 852
|||||||||||||| || ||| || | | |||||||||||||||||||||| ||
Sbjct: 71 tcccacttgttgtacgtagaacgactttcgttcttccactcaccatagtccattcccacg 12
Query: 853 acccagaa 860
||||||||
Sbjct: 11 acccagaa 4
>gb|BJ263607.1|BJ263607 BJ263607 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh5g03 3', mRNA sequence
Length = 611
Score = 123 bits (62), Expect = 3e-026
Identities = 206/254 (81%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||||||||| ||||| ||| |||||||||||||| |||| |||||| || |
Sbjct: 339 ggcttctgagccttttgtttttccctgaggaggccacagaagagggcgttgtccggcaac 398
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 399 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 458
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||| |||||||| || || || || || ||||| || || |||||||| ||
Sbjct: 459 ccgaggtaccaggtgtccagattctccgtgcgcacgttccagaaccccgggctgtcgagc 518
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| || ||||||||||| ||||| || ||||| |||
Sbjct: 519 gacaacaggacggcggtccatgctccggggaacacctgagtggtgcatcgggaaacgcca 578
Query: 793 tcccacttgttgta 806
||||||||||||||
Sbjct: 579 tcccacttgttgta 592
>gb|CD893702.1|CD893702 G118.124F07F010828 G118 Triticum aestivum cDNA clone G118124F07,
mRNA sequence
Length = 623
Score = 109 bits (55), Expect = 4e-022
Identities = 184/227 (81%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| |||||| || |
Sbjct: 244 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtccggtatc 185
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 184 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 125
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||||||||||||||| || || || || ||||| || || |||||||| ||
Sbjct: 124 ccgaggtaccacgtgtccaggttctccgtgcgcacgttccagaaccccgggctgtcgagc 65
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgca 779
|||| || || |||||||||||||| || || |||||||| |||||
Sbjct: 64 gacaacaggacggcagtccatgctccggggaatacctgagtggtgca 18
>gb|CD915996.1|CD915996 G550.128M19F010717 G550 Triticum aestivum cDNA clone G550128M19,
mRNA sequence
Length = 454
Score = 109 bits (55), Expect = 4e-022
Identities = 196/243 (80%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||||||||| ||||| ||| |||||||||||||| |||| |||||| || |
Sbjct: 252 ggcttctgagccttttgtttttccctgaggaggccacagaagagggcgttgtccggcaac 193
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 192 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 133
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||| |||||||| || || || || || ||||| || || |||||||| ||
Sbjct: 132 ccgaggtaccaggtgtccagattctccgtgcgcacgttccagaaccccgggctgtcgagc 73
Query: 733 gacagcatcacagcagtccatgctcccggaaacacctgagtcgtgcaacgagaaacacca 792
|||| || || || ||||||||||| || ||||||||||| |||||||| ||||| |||
Sbjct: 72 gacaacaggacggcggtccatgctccggggaacacctgagtggtgcaacgggaaacgcca 13
Query: 793 tcc 795
|||
Sbjct: 12 tcc 10
>gb|CD915997.1|CD915997 G550.128M19R010920 G550 Triticum aestivum cDNA clone G550128M19,
mRNA sequence
Length = 687
Score = 87.7 bits (44), Expect = 1e-015
Identities = 183/228 (80%), Gaps = 1/228 (0%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||||||||| ||||| ||| |||||||||||||| |||| |||||| || |
Sbjct: 434 ggcttctgagccttttgtttttccctgaggaggccacagaagagggcgttgtccggcaac 493
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 494 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 553
Query: 673 cccagataccacgtgtccaggttttctgtccgtacattccaaaatcctgggctgtcaagt 732
|| || ||||| |||||||| || || || || || ||||| || || |||||||| ||
Sbjct: 554 ccgaggtaccaggtgtccagattctccgtgcgcacgttccagaaccccgggctgtcgagc 613
Query: 733 gacagcatcacagcagtccatgctcc-cggaaacacctgagtcgtgca 779
|||| || || || ||||||||||| |||||||||||||| |||||
Sbjct: 614 gacaacaggacggcggtccatgctccggggaaacacctgagtggtgca 661
>gb|CD894158.1|CD894158 G118.125I12R011115 G118 Triticum aestivum cDNA clone G118125I12,
mRNA sequence
Length = 550
Score = 85.7 bits (43), Expect = 6e-015
Identities = 118/143 (82%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
||||||||||||||||| || ||| |||||||||||||| |||| |||||| || |
Sbjct: 349 ggcttctgagccttctgcttttccctgaggaggccacagaagagggcgttgtccggtatc 408
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || |||||||| | ||||||||||||| |||||| ||||||||
Sbjct: 409 accgactcggtcacgttgtagcctccgtcaggatccaccacccggatgtacgtctcctgg 468
Query: 673 cccagataccacgtgtccaggtt 695
|| || |||||||||||||||||
Sbjct: 469 ccgaggtaccacgtgtccaggtt 491
>gb|CD894157.1|CD894157 G118.125I12F010828 G118 Triticum aestivum cDNA clone G118125I12, mRNA
sequence
Length = 642
Score = 77.8 bits (39), Expect = 1e-012
Identities = 90/107 (84%)
Strand = Plus / Minus
Query: 925 aagttcttgtatgtggagttaatgacagatgttctgatcactggcggtccatcaattggc 984
||||||||||| || ||||| |||||||| | || |||| |||||||||| ||| ||||
Sbjct: 588 aagttcttgtacgttgagttgatgacagaagatccgatcgctggcggtccgtcagatggc 529
Query: 985 attgtagggaagtcaagtgtgtagacatccttcttgtcgtacagatc 1031
|| || |||||||| ||||||||||| || |||||||| || |||||
Sbjct: 528 atggttgggaagtccagtgtgtagacttctttcttgtcatagagatc 482
>gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aestivum cDNA clone wet1s.pk002.o23 5'
end, mRNA sequence
Length = 361
Score = 63.9 bits (32), Expect = 2e-008
Identities = 77/92 (83%)
Strand = Plus / Plus
Query: 940 gagttaatgacagatgttctgatcactggcggtccatcaattggcattgtagggaagtca 999
||||| |||||||| | || |||| |||||||||| ||| |||||| || ||||||||
Sbjct: 28 gagttgatgacagaagatccgatcgctggcggtccgtcagatggcatggttgggaagtcc 87
Query: 1000 agtgtgtagacatccttcttgtcgtacagatc 1031
||||||||||| || |||||||| || |||||
Sbjct: 88 agtgtgtagacttctttcttgtcatagagatc 119
>gb|CD938468.1|CD938468 OV.110B12R010406 OV Triticum aestivum cDNA clone OV110B12, mRNA
sequence
Length = 633
Score = 63.9 bits (32), Expect = 2e-008
Identities = 113/140 (80%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||||||||| ||||| ||| |||||||||||||| |||| |||||| || |
Sbjct: 433 ggcttctgagccttttgtttttccctgaggaggccacagaagagggcgttgtccggcaac 492
Query: 613 accatctcagtaacattatagcctccatttggatccaccaccctgatgtaagtctcctga 672
||| ||| || || || || ||||| | ||||||||||||| |||||| ||||||||
Sbjct: 493 accgactcggtcacgttgtaacctccgtcaggatccaccacccggatgtacgtctcctgg 552
Query: 673 cccagataccacgtgtccag 692
|| || ||||| ||||||||
Sbjct: 553 ccgaggtaccaggtgtccag 572
>gb|BJ237812.1|BJ237812 BJ237812 Y. Ogihara unpublished cDNA library, Wh_e Triticum
aestivum cDNA clone whe11f16 3', mRNA sequence
Length = 414
Score = 56.0 bits (28), Expect = 5e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagag 596
|||||||||||||| ||||| ||| |||||||||||||| ||||
Sbjct: 335 ggcttctgagccttttgtttttccctgaggaggccacagaagag 378
>gb|BI750806.1|BI750806 Ta01_02d11_R
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
ads Triticum aestivum cDNA clone Ta01_02d11, mRNA
sequence
Length = 383
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacag 591
||||||||||||||||| || ||| ||||||||||||||
Sbjct: 276 ggcttctgagccttctgcttttccctgaggaggccacag 314
>gb|CV973529.1|CV973529 B02_q444_18 q:444 Triticum aestivum cDNA, mRNA sequence
Length = 205
Score = 50.1 bits (25), Expect = 3e-004
Identities = 113/141 (80%), Gaps = 1/141 (0%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctgtttatccttgaggaggccacagtagagcatgttgtctggagcc 612
|||||||| |||||||| || | | |||||||||||||| |||| ||||||||| |
Sbjct: 153 ggcttctgcgccttctgcttttacctgaggaggccacagaagagggcgttgtctggtaac 94
Query: 613 accatctcagtaacattatagcctccatttggatccaccacc-ctgatgtaagtctcctg 671
||| ||| || || || |||||||| | |||||||||||| |||||||| ||||||||
Sbjct: 93 accgactcggtcacgttgtagcctccgtcaggatccaccaccactgatgtacgtctcctg 34
Query: 672 acccagataccacgtgtccag 692
|| | |||||||||||||
Sbjct: 33 gccaggtaaccacgtgtccag 13
>gb|BJ300905.1|BJ300905 BJ300905 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd4p07 5', mRNA sequence
Length = 632
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 786 aacaccatcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccat 845
|||||||||||| |||||||| || || || || || || |||||| |||||||||||
Sbjct: 382 aacaccatcccatttgttgtaggtacctcgactgttgtcggtccacaatccatagtccat 323
Query: 846 tcctacaacccagaatgcatatccatc 872
|| || || ||||||||||||||||
Sbjct: 322 cccaacgacaaagaatgcatatccatc 296
>gb|BJ306301.1|BJ306301 BJ306301 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd2i05 3', mRNA sequence
Length = 652
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 786 aacaccatcccacttgttgtaagtcccacggctattctcagtccactcaccatagtccat 845
|||||||||||| |||||||| || || || || || || |||||| |||||||||||
Sbjct: 525 aacaccatcccatttgttgtaggtacctcgactgttgtcggtccacaatccatagtccat 584
Query: 846 tcctacaacccagaatgcatatccatc 872
|| || || ||||||||||||||||
Sbjct: 585 cccaacgacaaagaatgcatatccatc 611
>gb|CA497356.1|CA497356 WHE3226_E01_I02ZT Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE3226_E01_I02, mRNA sequence
Length = 487
Score = 44.1 bits (22), Expect = 0.020
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 826 gtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtaggtc 885
|||||||||||||||||||| || || || |||||| ||| ||||| | |||||||||
Sbjct: 15 gtccactcaccatagtccatcccgactacaaagaatgaataaccatccagatggtaggtc 74
Query: 886 tg 887
||
Sbjct: 75 tg 76
>gb|CA599858.1|CA599858 waw1c.pk004.l1 waw1c Triticum aestivum cDNA clone waw1c.pk004.l1 5'
end, mRNA sequence
Length = 630
Score = 44.1 bits (22), Expect = 0.020
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 826 gtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtaggtc 885
|||||||||||||||||||| || || || |||||| ||| ||||| | |||||||||
Sbjct: 613 gtccactcaccatagtccatcccgactacaaagaatgaataaccatccagatggtaggtc 554
Query: 886 tg 887
||
Sbjct: 553 tg 552
>gb|CD898343.1|CD898343 G174.108N06F010821 G174 Triticum aestivum cDNA clone G174108N06,
mRNA sequence
Length = 697
Score = 44.1 bits (22), Expect = 0.020
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 826 gtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtaggtc 885
|||||||||||||||||||| || || || |||||| ||| ||||| | |||||||||
Sbjct: 342 gtccactcaccatagtccatcccgactacaaagaatgaataaccatccagatggtaggtc 283
Query: 886 tg 887
||
Sbjct: 282 tg 281
>gb|CD898344.1|CD898344 G174.108N06R011121 G174 Triticum aestivum cDNA clone G174108N06,
mRNA sequence
Length = 592
Score = 44.1 bits (22), Expect = 0.020
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 826 gtccactcaccatagtccattcctacaacccagaatgcatatccatcaatgtggtaggtc 885
|||||||||||||||||||| || || || |||||| ||| ||||| | |||||||||
Sbjct: 513 gtccactcaccatagtccatcccgactacaaagaatgaataaccatccagatggtaggtc 572
Query: 886 tg 887
||
Sbjct: 573 tg 574
>gb|CD906028.1|CD906028 G468.103L17F010808 G468 Triticum aestivum cDNA clone G468103L17,
mRNA sequence
Length = 508
Score = 42.1 bits (21), Expect = 0.077
Identities = 40/45 (88%), Gaps = 1/45 (2%)
Strand = Plus / Minus
Query: 553 ggcttctgagccttctg-tttatccttgaggaggccacagtagag 596
||||||||||||||||| ||| || |||||||||||||| ||||
Sbjct: 99 ggcttctgagccttctgcttttcccctgaggaggccacagaagag 55
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 174,191
Number of Sequences: 636343
Number of extensions: 174191
Number of successful extensions: 47071
Number of sequences better than 0.5: 26
Number of HSP's better than 0.5 without gapping: 23
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 47015
Number of HSP's gapped (non-prelim): 49
length of query: 1062
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1042
effective length of database: 354,513,379
effective search space: 369402940918
effective search space used: 369402940918
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)