BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131572.2.3
(1521 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA622992.1|CA622992 wl1n.pk0102.a10 wl1n Triticum aestiv... 942 0.0
gb|CA625638.1|CA625638 wl1n.pk0140.h5 wl1n Triticum aestivu... 868 0.0
gb|CA617503.1|CA617503 wl1n.pk0020.b8 wl1n Triticum aestivu... 737 0.0
gb|CA618900.1|CA618900 wl1n.pk0045.a3 wl1n Triticum aestivu... 704 0.0
gb|CA619704.1|CA619704 wl1n.pk0049.g11 wl1n Triticum aestiv... 704 0.0
gb|CA625560.1|CA625560 wl1n.pk0143.a12 wl1n Triticum aestiv... 624 e-177
gb|CA623232.1|CA623232 wl1n.pk0104.c12 wl1n Triticum aestiv... 617 e-174
gb|CA618940.1|CA618940 wl1n.pk0042.g3 wl1n Triticum aestivu... 601 e-170
gb|CA618826.1|CA618826 wl1n.pk0044.f6 wl1n Triticum aestivu... 593 e-167
gb|CA621784.1|CA621784 wl1n.pk0076.f7 wl1n Triticum aestivu... 553 e-155
gb|CA626327.1|CA626327 wl1n.pk0131.a10 wl1n Triticum aestiv... 513 e-143
gb|CA622417.1|CA622417 wl1n.pk0095.d5 wl1n Triticum aestivu... 511 e-143
gb|CA624646.1|CA624646 wl1n.pk0121.c11 wl1n Triticum aestiv... 408 e-112
gb|CA621172.1|CA621172 wl1n.pk0073.a10 wl1n Triticum aestiv... 385 e-105
gb|BE406989.1|BE406989 WHE0446_E10_I20ZS Wheat etiolated se... 76 8e-012
gb|BE444203.1|BE444203 WHE1128_D08_H16ZS Wheat etiolated se... 76 8e-012
gb|BJ279656.1|BJ279656 BJ279656 Y. Ogihara unpublished cDNA... 76 8e-012
gb|BQ483658.1|BQ483658 WHE3511_B03_D05ZS Wheat unstressed r... 76 8e-012
gb|BQ484041.1|BQ484041 WHE3515_G05_N09ZS Wheat unstressed r... 76 8e-012
gb|BQ803862.1|BQ803862 WHE2842_H10_O20ZS Triticum monococcu... 76 8e-012
gb|CA602657.1|CA602657 wr1.pk0019.a11 wr1 Triticum aestivum... 76 8e-012
gb|CA611244.1|CA611244 wr1.pk0122.d10 wr1 Triticum aestivum... 76 8e-012
gb|CA723630.1|CA723630 wdr1f.pk003.n6 wdr1f Triticum aestiv... 76 8e-012
gb|BE404466.1|BE404466 WHE0442_F01_K02ZS Wheat etiolated se... 74 3e-011
gb|BE425561.1|BE425561 WHE0317_G06_G06ZS Wheat unstressed s... 74 3e-011
gb|BE429397.1|BE429397 MTD017.F06F990621 ITEC MTD Durum Whe... 74 3e-011
gb|BE429476.1|BE429476 TAS000.E09R990610 ITEC TAS Wheat cDN... 74 3e-011
gb|BJ278212.1|BJ278212 BJ278212 Y. Ogihara unpublished cDNA... 74 3e-011
gb|BJ278236.1|BJ278236 BJ278236 Y. Ogihara unpublished cDNA... 74 3e-011
gb|BJ281126.1|BJ281126 BJ281126 Y. Ogihara unpublished cDNA... 74 3e-011
gb|AL825902.1|AL825902 AL825902 p:234 Triticum aestivum cDN... 74 3e-011
gb|AL826883.1|AL826883 AL826883 p:638 Triticum aestivum cDN... 74 3e-011
gb|AL827768.1|AL827768 AL827768 p:739 Triticum aestivum cDN... 74 3e-011
gb|BQ752900.1|BQ752900 WHE4120_E01_J02ZS Wheat salt-stresse... 74 3e-011
gb|BQ838119.1|BQ838119 WHE2906_G04_M08ZS Wheat aluminum-str... 74 3e-011
gb|CA602951.1|CA602951 wr1.pk0022.c10 wr1 Triticum aestivum... 74 3e-011
gb|CD872339.1|CD872339 AZO2.120G13F010209 AZO2 Triticum aes... 74 3e-011
gb|CK194761.1|CK194761 FGAS003193 Triticum aestivum FGAS: L... 74 3e-011
gb|CK196581.1|CK196581 FGAS005040 Triticum aestivum FGAS: L... 74 3e-011
gb|CA613069.1|CA613069 wr1.pk0150.h5 wr1 Triticum aestivum ... 70 5e-010
gb|BE404254.1|BE404254 WHE1204_B03_D06ZS Wheat etiolated se... 68 2e-009
gb|BE415544.1|BE415544 MWL034.F07000404 ITEC MWL Wheat Root... 68 2e-009
gb|BE470771.1|BE470771 WHE0281_D03_H06ZS Wheat drought-stre... 68 2e-009
gb|BI480486.1|BI480486 WHE2903_G08_N15ZS Wheat aluminum-str... 68 2e-009
gb|BJ281899.1|BJ281899 BJ281899 Y. Ogihara unpublished cDNA... 68 2e-009
gb|BJ281952.1|BJ281952 BJ281952 Y. Ogihara unpublished cDNA... 68 2e-009
gb|CA602100.1|CA602100 wr1.pk0015.a10 wr1 Triticum aestivum... 68 2e-009
gb|CA616234.1|CA616234 wr1.pk180.h3 wr1 Triticum aestivum c... 68 2e-009
gb|CK194018.1|CK194018 FGAS002437 Triticum aestivum FGAS: L... 68 2e-009
gb|CK199901.1|CK199901 FGAS008408 Triticum aestivum FGAS: L... 68 2e-009
gb|DR735399.1|DR735399 FGAS081069 Triticum aestivum FGAS: L... 68 2e-009
gb|CD865625.1|CD865625 AZO2.101F18F001107 AZO2 Triticum aes... 66 8e-009
gb|CK200536.1|CK200536 FGAS009051 Triticum aestivum FGAS: L... 66 8e-009
gb|BE415383.1|BE415383 MWL029.A08000301 ITEC MWL Wheat Root... 64 3e-008
gb|AL826565.1|AL826565 AL826565 p:537 Triticum aestivum cDN... 64 3e-008
gb|CA738407.1|CA738407 wpi2s.pk006.p18 wpi2s Triticum aesti... 58 2e-006
gb|CA742562.1|CA742562 wri1s.pk001.a6 wri1s Triticum aestiv... 58 2e-006
gb|AJ603069.1|AJ603069 AJ603069 T06 Triticum aestivum cDNA ... 58 2e-006
gb|CA725867.1|CA725867 wet1s.pk001.l19 wet1s Triticum aesti... 56 7e-006
gb|CA734638.1|CA734638 wpi1s.pk001.d5 wpi1s Triticum aestiv... 56 7e-006
gb|CA738452.1|CA738452 wpi2s.pk006.j8 wpi2s Triticum aestiv... 56 7e-006
gb|CA739376.1|CA739376 wpi2s.pk007.e13 wpi2s Triticum aesti... 56 7e-006
gb|CA739752.1|CA739752 wpi2s.pk010.k15 wpi2s Triticum aesti... 56 7e-006
gb|CA742410.1|CA742410 wri1s.pk001.a15 wri1s Triticum aesti... 56 7e-006
gb|CA742900.1|CA742900 wri1s.pk004.a17 wri1s Triticum aesti... 56 7e-006
gb|CA743224.1|CA743224 wri1s.pk002.j18 wri1s Triticum aesti... 56 7e-006
gb|CA745662.1|CA745662 wri2s.pk002.a23 wri2s Triticum aesti... 56 7e-006
gb|CB275421.1|CB275421 WLR15I-15C_ID01 Subtracted wheat lea... 56 7e-006
gb|CB275425.1|CB275425 WLR15I-15C_IDO8 Subtracted wheat lea... 56 7e-006
gb|AJ603387.1|AJ603387 AJ603387 T06 Triticum aestivum cDNA ... 56 7e-006
gb|CA669949.1|CA669949 wlsu1.pk024.e8 wlsu1 Triticum aestiv... 54 3e-005
gb|CA725691.1|CA725691 wet1s.pk001.k18 wet1s Triticum aesti... 54 3e-005
gb|CA725877.1|CA725877 wet1s.pk001.i17 wet1s Triticum aesti... 54 3e-005
gb|CA726010.1|CA726010 wet1s.pk002.g13 wet1s Triticum aesti... 54 3e-005
gb|CA726548.1|CA726548 wet1s.pk003.p20 wet1s Triticum aesti... 54 3e-005
gb|CA726557.1|CA726557 wet1s.pk003.j18 wet1s Triticum aesti... 54 3e-005
gb|CA735077.1|CA735077 wpi1s.pk003.h17 wpi1s Triticum aesti... 54 3e-005
gb|CA735122.1|CA735122 wpi1s.pk003.l21 wpi1s Triticum aesti... 54 3e-005
gb|CA735235.1|CA735235 wpi1s.pk003.j8 wpi1s Triticum aestiv... 54 3e-005
gb|CA735748.1|CA735748 wpi1s.pk004.h4 wpi1s Triticum aestiv... 54 3e-005
gb|CA735945.1|CA735945 wpi1s.pk005.p20 wpi1s Triticum aesti... 54 3e-005
gb|CA736526.1|CA736526 wpi1s.pk007.k10 wpi1s Triticum aesti... 54 3e-005
gb|CA736882.1|CA736882 wpi1s.pk008.j6 wpi1s Triticum aestiv... 54 3e-005
gb|CA736974.1|CA736974 wpi1s.pk009.g24 wpi1s Triticum aesti... 54 3e-005
gb|CA737088.1|CA737088 wpi1s.pk009.b17 wpi1s Triticum aesti... 54 3e-005
gb|CA738291.1|CA738291 wpi2s.pk006.b5 wpi2s Triticum aestiv... 54 3e-005
gb|CA738720.1|CA738720 wpi2s.pk002.o23 wpi2s Triticum aesti... 54 3e-005
gb|CA738871.1|CA738871 wpi2s.pk008.l4 wpi2s Triticum aestiv... 54 3e-005
gb|CA739079.1|CA739079 wpi2s.pk009.n21 wpi2s Triticum aesti... 54 3e-005
gb|CA739524.1|CA739524 wpi2s.pk007.b16 wpi2s Triticum aesti... 54 3e-005
gb|CA739661.1|CA739661 wpi2s.pk010.e11 wpi2s Triticum aesti... 54 3e-005
gb|CA739730.1|CA739730 wpi2s.pk010.i8 wpi2s Triticum aestiv... 54 3e-005
gb|CA739745.1|CA739745 wpi2s.pk010.i20 wpi2s Triticum aesti... 54 3e-005
gb|CA739818.1|CA739818 wpi2s.pk010.n14 wpi2s Triticum aesti... 54 3e-005
gb|CA742550.1|CA742550 wri1s.pk001.e4 wri1s Triticum aestiv... 54 3e-005
gb|CA743208.1|CA743208 wri1s.pk002.j12 wri1s Triticum aesti... 54 3e-005
gb|CA743261.1|CA743261 wri1s.pk002.a24 wri1s Triticum aesti... 54 3e-005
gb|CA744122.1|CA744122 wri1s.pk006.n5 wri1s Triticum aestiv... 54 3e-005
gb|CA744604.1|CA744604 wri1s.pk008.b18 wri1s Triticum aesti... 54 3e-005
gb|CA744710.1|CA744710 wri1s.pk009.i15 wri1s Triticum aesti... 54 3e-005
gb|CA744766.1|CA744766 wri1s.pk009.m21 wri1s Triticum aesti... 54 3e-005
gb|CA744996.1|CA744996 wri1s.pk009.p6 wri1s Triticum aestiv... 54 3e-005
gb|CB275426.1|CB275426 WLR15I-15C_ID09 Subtracted wheat lea... 54 3e-005
gb|AJ602523.1|AJ602523 AJ602523 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ602593.1|AJ602593 AJ602593 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ602697.1|AJ602697 AJ602697 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ602745.1|AJ602745 AJ602745 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ602821.1|AJ602821 AJ602821 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ602996.1|AJ602996 AJ602996 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ603233.1|AJ603233 AJ603233 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ603265.1|AJ603265 AJ603265 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ603312.1|AJ603312 AJ603312 T06 Triticum aestivum cDNA ... 54 3e-005
gb|AJ613559.1|AJ613559 AJ613559 Triticum turgidum subsp. du... 54 3e-005
gb|DT948978.1|DT948978 14-1-22 SSH-cDNA Library of stripe r... 54 3e-005
gb|DV799619.1|DV799619 05D24 AAFC_CRC Fusarium graminearum ... 54 3e-005
gb|DV799683.1|DV799683 09L13 AAFC_CRC Fusarium graminearum ... 54 3e-005
gb|DV799684.1|DV799684 09M06 AAFC_CRC Fusarium graminearum ... 54 3e-005
gb|DV799706.1|DV799706 11E18 AAFC_CRC Fusarium graminearum ... 54 3e-005
gb|DV799712.1|DV799712 11L21 AAFC_CRC Fusarium graminearum ... 54 3e-005
gb|BJ261725.1|BJ261725 BJ261725 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ312697.1|BJ312697 BJ312697 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ318406.1|BJ318406 BJ318406 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ318685.1|BJ318685 BJ318685 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ319360.1|BJ319360 BJ319360 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ320160.1|BJ320160 BJ320160 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ320181.1|BJ320181 BJ320181 Y. Ogihara unpublished cDNA... 52 1e-004
gb|CA725694.1|CA725694 wet1s.pk001.k22 wet1s Triticum aesti... 52 1e-004
gb|CA725759.1|CA725759 wet1s.pk001.o10 wet1s Triticum aesti... 52 1e-004
gb|CA725769.1|CA725769 wet1s.pk001.g3 wet1s Triticum aestiv... 52 1e-004
gb|CA725870.1|CA725870 wet1s.pk001.p5 wet1s Triticum aestiv... 52 1e-004
gb|CA725929.1|CA725929 wet1s.pk001.j22 wet1s Triticum aesti... 52 1e-004
gb|CA725958.1|CA725958 wet1s.pk001.l7 wet1s Triticum aestiv... 52 1e-004
gb|CA725969.1|CA725969 wet1s.pk001.d8 wet1s Triticum aestiv... 52 1e-004
gb|CA726028.1|CA726028 wet1s.pk002.m21 wet1s Triticum aesti... 52 1e-004
gb|CA726273.1|CA726273 wet1s.pk003.a14 wet1s Triticum aesti... 52 1e-004
gb|CA726309.1|CA726309 wet1s.pk002.l14 wet1s Triticum aesti... 52 1e-004
gb|CA726531.1|CA726531 wet1s.pk003.a19 wet1s Triticum aesti... 52 1e-004
gb|CA726538.1|CA726538 wet1s.pk003.n24 wet1s Triticum aesti... 52 1e-004
gb|CA726574.1|CA726574 wet1s.pk003.l14 wet1s Triticum aesti... 52 1e-004
gb|CA726578.1|CA726578 wet1s.pk003.n12 wet1s Triticum aesti... 52 1e-004
gb|CA734844.1|CA734844 wpi1s.pk002.a12 wpi1s Triticum aesti... 52 1e-004
gb|CA735070.1|CA735070 wpi1s.pk003.p19 wpi1s Triticum aesti... 52 1e-004
gb|CA735115.1|CA735115 wpi1s.pk003.p23 wpi1s Triticum aesti... 52 1e-004
gb|CA735229.1|CA735229 wpi1s.pk003.f18 wpi1s Triticum aesti... 52 1e-004
gb|CA735411.1|CA735411 wpi1s.pk002.b23 wpi1s Triticum aesti... 52 1e-004
gb|CA735450.1|CA735450 wpi1s.pk003.g24 wpi1s Triticum aesti... 52 1e-004
gb|CA735540.1|CA735540 wpi1s.pk002.l1 wpi1s Triticum aestiv... 52 1e-004
gb|CA735623.1|CA735623 wpi1s.pk004.l10 wpi1s Triticum aesti... 52 1e-004
gb|CA735655.1|CA735655 wpi1s.pk005.a11 wpi1s Triticum aesti... 52 1e-004
gb|CA735815.1|CA735815 wpi1s.pk005.d17 wpi1s Triticum aesti... 52 1e-004
gb|CA735870.1|CA735870 wpi1s.pk005.l18 wpi1s Triticum aesti... 52 1e-004
gb|CA735908.1|CA735908 wpi1s.pk005.g16 wpi1s Triticum aesti... 52 1e-004
gb|CA735925.1|CA735925 wpi1s.pk006.g1 wpi1s Triticum aestiv... 52 1e-004
gb|CA735968.1|CA735968 wpi1s.pk006.k5 wpi1s Triticum aestiv... 52 1e-004
gb|CA735973.1|CA735973 wpi1s.pk006.k9 wpi1s Triticum aestiv... 52 1e-004
gb|CA736126.1|CA736126 wpi1s.pk006.a17 wpi1s Triticum aesti... 52 1e-004
gb|CA736141.1|CA736141 wpi1s.pk006.i7 wpi1s Triticum aestiv... 52 1e-004
gb|CA736204.1|CA736204 wpi1s.pk006.h20 wpi1s Triticum aesti... 52 1e-004
gb|CA736213.1|CA736213 wpi1s.pk006.b14 wpi1s Triticum aesti... 52 1e-004
gb|CA736255.1|CA736255 wpi1s.pk006.j8 wpi1s Triticum aestiv... 52 1e-004
gb|CA736293.1|CA736293 wpi1s.pk007.m21 wpi1s Triticum aesti... 52 1e-004
gb|CA736477.1|CA736477 wpi1s.pk007.e18 wpi1s Triticum aesti... 52 1e-004
gb|CA736479.1|CA736479 wpi1s.pk007.i22 wpi1s Triticum aesti... 52 1e-004
gb|CA736568.1|CA736568 wpi1s.pk007.p8 wpi1s Triticum aestiv... 52 1e-004
gb|CA736725.1|CA736725 wpi1s.pk008.k16 wpi1s Triticum aesti... 52 1e-004
gb|CA736744.1|CA736744 wpi1s.pk008.h7 wpi1s Triticum aestiv... 52 1e-004
gb|CA736780.1|CA736780 wpi1s.pk008.j16 wpi1s Triticum aesti... 52 1e-004
gb|CA736796.1|CA736796 wpi1s.pk008.p12 wpi1s Triticum aesti... 52 1e-004
gb|CA736963.1|CA736963 wpi1s.pk009.o22 wpi1s Triticum aesti... 52 1e-004
gb|CA736997.1|CA736997 wpi1s.pk009.e12 wpi1s Triticum aesti... 52 1e-004
gb|CA737028.1|CA737028 wpi1s.pk009.l18 wpi1s Triticum aesti... 52 1e-004
gb|CA737045.1|CA737045 wpi1s.pk009.j6 wpi1s Triticum aestiv... 52 1e-004
gb|CA737126.1|CA737126 wpi1s.pk009.d11 wpi1s Triticum aesti... 52 1e-004
gb|CA737516.1|CA737516 wpi2s.pk004.i9 wpi2s Triticum aestiv... 52 1e-004
gb|CA737529.1|CA737529 wpi2s.pk004.m17 wpi2s Triticum aesti... 52 1e-004
gb|CA737590.1|CA737590 wpi2s.pk004.i8 wpi2s Triticum aestiv... 52 1e-004
gb|CA737624.1|CA737624 wpi2s.pk004.h23 wpi2s Triticum aesti... 52 1e-004
gb|CA737667.1|CA737667 wpi2s.pk004.k22 wpi2s Triticum aesti... 52 1e-004
gb|CA737680.1|CA737680 wpi2s.pk004.m20 wpi2s Triticum aesti... 52 1e-004
gb|CA737716.1|CA737716 wpi2s.pk004.n23 wpi2s Triticum aesti... 52 1e-004
gb|CA737895.1|CA737895 wpi2s.pk005.k13 wpi2s Triticum aesti... 52 1e-004
gb|CA737925.1|CA737925 wpi2s.pk005.m3 wpi2s Triticum aestiv... 52 1e-004
gb|CA737950.1|CA737950 wpi2s.pk005.h7 wpi2s Triticum aestiv... 52 1e-004
gb|CA737954.1|CA737954 wpi2s.pk005.l21 wpi2s Triticum aesti... 52 1e-004
gb|CA737964.1|CA737964 wpi2s.pk005.p13 wpi2s Triticum aesti... 52 1e-004
gb|CA737993.1|CA737993 wpi2s.pk005.n17 wpi2s Triticum aesti... 52 1e-004
gb|CA738024.1|CA738024 wpi2s.pk002.d22 wpi2s Triticum aesti... 52 1e-004
gb|CA738131.1|CA738131 wpi2s.pk002.h7 wpi2s Triticum aestiv... 52 1e-004
gb|CA738199.1|CA738199 wpi2s.pk002.b22 wpi2s Triticum aesti... 52 1e-004
gb|CA738209.1|CA738209 wpi2s.pk002.j6 wpi2s Triticum aestiv... 52 1e-004
gb|CA738232.1|CA738232 wpi2s.pk006.e4 wpi2s Triticum aestiv... 52 1e-004
gb|CA738397.1|CA738397 wpi2s.pk006.k8 wpi2s Triticum aestiv... 52 1e-004
gb|CA738414.1|CA738414 wpi2s.pk006.j24 wpi2s Triticum aesti... 52 1e-004
gb|CA738472.1|CA738472 wpi2s.pk008.m16 wpi2s Triticum aesti... 52 1e-004
gb|CA738475.1|CA738475 wpi2s.pk008.a6 wpi2s Triticum aestiv... 52 1e-004
gb|CA738487.1|CA738487 wpi2s.pk008.k18 wpi2s Triticum aesti... 52 1e-004
gb|CA738568.1|CA738568 wpi2s.pk006.l6 wpi2s Triticum aestiv... 52 1e-004
gb|CA738694.1|CA738694 wpi2s.pk002.i12 wpi2s Triticum aesti... 52 1e-004
gb|CA738731.1|CA738731 wpi2s.pk002.i6 wpi2s Triticum aestiv... 52 1e-004
gb|CA738800.1|CA738800 wpi2s.pk008.j21 wpi2s Triticum aesti... 52 1e-004
gb|CA738926.1|CA738926 wpi2s.pk009.i5 wpi2s Triticum aestiv... 52 1e-004
gb|CA738953.1|CA738953 wpi2s.pk008.d16 wpi2s Triticum aesti... 52 1e-004
gb|CA739100.1|CA739100 wpi2s.pk009.d3 wpi2s Triticum aestiv... 52 1e-004
gb|CA739164.1|CA739164 wpi2s.pk009.l22 wpi2s Triticum aesti... 52 1e-004
gb|CA739202.1|CA739202 wpi2s.pk009.p3 wpi2s Triticum aestiv... 52 1e-004
gb|CA739205.1|CA739205 wpi2s.pk009.p7 wpi2s Triticum aestiv... 52 1e-004
gb|CA739221.1|CA739221 wpi2s.pk005.p24 wpi2s Triticum aesti... 52 1e-004
gb|CA739312.1|CA739312 wpi2s.pk007.c1 wpi2s Triticum aestiv... 52 1e-004
gb|CA739349.1|CA739349 wpi2s.pk007.e19 wpi2s Triticum aesti... 52 1e-004
gb|CA739373.1|CA739373 wpi2s.pk007.k10 wpi2s Triticum aesti... 52 1e-004
gb|CA739394.1|CA739394 wpi2s.pk007.g12 wpi2s Triticum aesti... 52 1e-004
gb|CA739450.1|CA739450 wpi2s.pk007.o22 wpi2s Triticum aesti... 52 1e-004
gb|CA739458.1|CA739458 wpi2s.pk007.k24 wpi2s Triticum aesti... 52 1e-004
gb|CA739651.1|CA739651 wpi2s.pk010.c17 wpi2s Triticum aesti... 52 1e-004
gb|CA739658.1|CA739658 wpi2s.pk010.e21 wpi2s Triticum aesti... 52 1e-004
gb|CA739674.1|CA739674 wpi2s.pk010.c10 wpi2s Triticum aesti... 52 1e-004
gb|CA739696.1|CA739696 wpi2s.pk010.o2 wpi2s Triticum aestiv... 52 1e-004
gb|CA739817.1|CA739817 wpi2s.pk010.n12 wpi2s Triticum aesti... 52 1e-004
gb|CA739832.1|CA739832 wpi2s.pk010.l10 wpi2s Triticum aesti... 52 1e-004
gb|CA742503.1|CA742503 wri1s.pk001.g2 wri1s Triticum aestiv... 52 1e-004
gb|CA742559.1|CA742559 wri1s.pk001.b12 wri1s Triticum aesti... 52 1e-004
gb|CA742665.1|CA742665 wri1s.pk001.h1 wri1s Triticum aestiv... 52 1e-004
gb|CA742759.1|CA742759 wri1s.pk004.b11 wri1s Triticum aesti... 52 1e-004
gb|CA742905.1|CA742905 wri1s.pk004.c20 wri1s Triticum aesti... 52 1e-004
gb|CA743260.1|CA743260 wri1s.pk002.a22 wri1s Triticum aesti... 52 1e-004
gb|CA743283.1|CA743283 wri1s.pk002.m22 wri1s Triticum aesti... 52 1e-004
gb|CA743426.1|CA743426 wri1s.pk003.i12 wri1s Triticum aesti... 52 1e-004
gb|CA743432.1|CA743432 wri1s.pk003.i16 wri1s Triticum aesti... 52 1e-004
gb|CA743467.1|CA743467 wri1s.pk005.e21 wri1s Triticum aesti... 52 1e-004
gb|CA743497.1|CA743497 wri1s.pk002.d15 wri1s Triticum aesti... 52 1e-004
gb|CA743506.1|CA743506 wri1s.pk002.f9 wri1s Triticum aestiv... 52 1e-004
gb|CA743604.1|CA743604 wri1s.pk002.l15 wri1s Triticum aesti... 52 1e-004
gb|CA743651.1|CA743651 wri1s.pk005.o8 wri1s Triticum aestiv... 52 1e-004
gb|CA743676.1|CA743676 wri1s.pk005.e22 wri1s Triticum aesti... 52 1e-004
gb|CA743754.1|CA743754 wri1s.pk005.f15 wri1s Triticum aesti... 52 1e-004
gb|CA743779.1|CA743779 wri1s.pk005.a6 wri1s Triticum aestiv... 52 1e-004
gb|CA743904.1|CA743904 wri1s.pk006.i5 wri1s Triticum aestiv... 52 1e-004
gb|CA743942.1|CA743942 wri1s.pk006.a7 wri1s Triticum aestiv... 52 1e-004
gb|CA743950.1|CA743950 wri1s.pk006.m15 wri1s Triticum aesti... 52 1e-004
gb|CA743988.1|CA743988 wri1s.pk006.o10 wri1s Triticum aesti... 52 1e-004
gb|CA743994.1|CA743994 wri1s.pk006.g13 wri1s Triticum aesti... 52 1e-004
gb|CA744160.1|CA744160 wri1s.pk006.f12 wri1s Triticum aesti... 52 1e-004
gb|CA744377.1|CA744377 wri1s.pk007.i12 wri1s Triticum aesti... 52 1e-004
gb|CA744438.1|CA744438 wri1s.pk007.n3 wri1s Triticum aestiv... 52 1e-004
gb|CA744562.1|CA744562 wri1s.pk008.h21 wri1s Triticum aesti... 52 1e-004
gb|CA744579.1|CA744579 wri1s.pk008.p11 wri1s Triticum aesti... 52 1e-004
gb|CA744623.1|CA744623 wri1s.pk008.b8 wri1s Triticum aestiv... 52 1e-004
gb|CA744638.1|CA744638 wri1s.pk008.n10 wri1s Triticum aesti... 52 1e-004
gb|CA744654.1|CA744654 wri1s.pk008.h14 wri1s Triticum aesti... 52 1e-004
gb|CA744678.1|CA744678 wri1s.pk009.k5 wri1s Triticum aestiv... 52 1e-004
gb|CA744752.1|CA744752 wri1s.pk009.d23 wri1s Triticum aesti... 52 1e-004
gb|CA744833.1|CA744833 wri1s.pk009.k16 wri1s Triticum aesti... 52 1e-004
gb|CA744847.1|CA744847 wri1s.pk009.g10 wri1s Triticum aesti... 52 1e-004
gb|CA744853.1|CA744853 wri1s.pk009.h9 wri1s Triticum aestiv... 52 1e-004
gb|CA744921.1|CA744921 wri1s.pk009.h15 wri1s Triticum aesti... 52 1e-004
gb|CA745146.1|CA745146 wri1s.pk008.m21 wri1s Triticum aesti... 52 1e-004
gb|CA745153.1|CA745153 wri1s.pk008.o12 wri1s Triticum aesti... 52 1e-004
gb|CA745249.1|CA745249 wri1s.pk003.f10 wri1s Triticum aesti... 52 1e-004
gb|CA745319.1|CA745319 wri1s.pk003.m23 wri1s Triticum aesti... 52 1e-004
gb|CA745325.1|CA745325 wri1s.pk003.g23 wri1s Triticum aesti... 52 1e-004
gb|CA745472.1|CA745472 wri2s.pk001.f21 wri2s Triticum aesti... 52 1e-004
gb|CA745474.1|CA745474 wri2s.pk001.h5 wri2s Triticum aestiv... 52 1e-004
gb|CA745606.1|CA745606 wri2s.pk002.i15 wri2s Triticum aesti... 52 1e-004
gb|CA745629.1|CA745629 wri2s.pk002.g13 wri2s Triticum aesti... 52 1e-004
gb|CA745717.1|CA745717 wri2s.pk002.l9 wri2s Triticum aestiv... 52 1e-004
gb|CA745795.1|CA745795 wri2s.pk002.d7 wri2s Triticum aestiv... 52 1e-004
gb|CA745882.1|CA745882 wri2s.pk003.b21 wri2s Triticum aesti... 52 1e-004
gb|CA745887.1|CA745887 wri2s.pk003.l21 wri2s Triticum aesti... 52 1e-004
gb|CA745980.1|CA745980 wri2s.pk003.c21 wri2s Triticum aesti... 52 1e-004
gb|CA746036.1|CA746036 wri2s.pk003.c10 wri2s Triticum aesti... 52 1e-004
gb|CA746044.1|CA746044 wri2s.pk003.g12 wri2s Triticum aesti... 52 1e-004
gb|CA746050.1|CA746050 wri2s.pk003.e10 wri2s Triticum aesti... 52 1e-004
gb|CA746060.1|CA746060 wri2s.pk003.o10 wri2s Triticum aesti... 52 1e-004
gb|CA746122.1|CA746122 wri2s.pk005.g19 wri2s Triticum aesti... 52 1e-004
gb|CA746298.1|CA746298 wri2s.pk005.p24 wri2s Triticum aesti... 52 1e-004
gb|CA746379.1|CA746379 wri2s.pk005.l6 wri2s Triticum aestiv... 52 1e-004
gb|CA746454.1|CA746454 wri2s.pk007.a20 wri2s Triticum aesti... 52 1e-004
gb|CA746589.1|CA746589 wri2s.pk004.k8 wri2s Triticum aestiv... 52 1e-004
gb|CA746618.1|CA746618 wri2s.pk004.e6 wri2s Triticum aestiv... 52 1e-004
gb|CA746620.1|CA746620 wri2s.pk004.e14 wri2s Triticum aesti... 52 1e-004
gb|CA746628.1|CA746628 wri2s.pk004.i7 wri2s Triticum aestiv... 52 1e-004
gb|CA746729.1|CA746729 wri2s.pk004.j14 wri2s Triticum aesti... 52 1e-004
gb|CA746752.1|CA746752 wri2s.pk004.p18 wri2s Triticum aesti... 52 1e-004
gb|CA746974.1|CA746974 wri2s.pk006.b12 wri2s Triticum aesti... 52 1e-004
gb|CA746977.1|CA746977 wri2s.pk006.b11 wri2s Triticum aesti... 52 1e-004
gb|CA747056.1|CA747056 wri2s.pk007.b19 wri2s Triticum aesti... 52 1e-004
gb|CA747145.1|CA747145 wri2s.pk007.h2 wri2s Triticum aestiv... 52 1e-004
gb|CA747256.1|CA747256 wri2s.pk008.n3.f wri2s Triticum aest... 52 1e-004
gb|CA747306.1|CA747306 wri2s.pk008.k18.f wri2s Triticum aes... 52 1e-004
gb|CA747337.1|CA747337 wri2s.pk008.f5.f wri2s Triticum aest... 52 1e-004
gb|CA747345.1|CA747345 wri2s.pk008.n20.f wri2s Triticum aes... 52 1e-004
gb|AJ602461.1|AJ602461 AJ602461 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602470.1|AJ602470 AJ602470 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602473.1|AJ602473 AJ602473 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602482.1|AJ602482 AJ602482 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602517.1|AJ602517 AJ602517 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602557.1|AJ602557 AJ602557 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602599.1|AJ602599 AJ602599 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602602.1|AJ602602 AJ602602 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602662.1|AJ602662 AJ602662 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602664.1|AJ602664 AJ602664 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602674.1|AJ602674 AJ602674 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602676.1|AJ602676 AJ602676 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602702.1|AJ602702 AJ602702 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602832.1|AJ602832 AJ602832 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602863.1|AJ602863 AJ602863 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602881.1|AJ602881 AJ602881 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602886.1|AJ602886 AJ602886 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602898.1|AJ602898 AJ602898 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602909.1|AJ602909 AJ602909 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602934.1|AJ602934 AJ602934 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602960.1|AJ602960 AJ602960 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ602963.1|AJ602963 AJ602963 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603018.1|AJ603018 AJ603018 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603023.1|AJ603023 AJ603023 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603028.1|AJ603028 AJ603028 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603039.1|AJ603039 AJ603039 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603060.1|AJ603060 AJ603060 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603086.1|AJ603086 AJ603086 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603112.1|AJ603112 AJ603112 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603119.1|AJ603119 AJ603119 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603160.1|AJ603160 AJ603160 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603178.1|AJ603178 AJ603178 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603195.1|AJ603195 AJ603195 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603236.1|AJ603236 AJ603236 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603237.1|AJ603237 AJ603237 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603245.1|AJ603245 AJ603245 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603283.1|AJ603283 AJ603283 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603285.1|AJ603285 AJ603285 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603377.1|AJ603377 AJ603377 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603384.1|AJ603384 AJ603384 T06 Triticum aestivum cDNA ... 52 1e-004
gb|AJ603414.1|AJ603414 AJ603414 T06 Triticum aestivum cDNA ... 52 1e-004
gb|CK206299.1|CK206299 FGAS017886 Triticum aestivum FGAS: L... 52 1e-004
gb|CK211353.1|CK211353 FGAS023192 Triticum aestivum FGAS: L... 52 1e-004
gb|CF569151.1|CF569151 EST012 Subtracted, Clontech (cat. # ... 52 1e-004
gb|CV522475.1|CV522475 RP-103 Triticum aestivum subtracted,... 52 1e-004
gb|CV523011.1|CV523011 LP-9 Triticum aestivum subtracted, c... 52 1e-004
gb|CV523137.1|CV523137 LP-232 Triticum aestivum subtracted,... 52 1e-004
gb|CV523154.1|CV523154 LP-251 Triticum aestivum subtracted,... 52 1e-004
gb|DV799635.1|DV799635 06H04 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799657.1|DV799657 07J21 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799682.1|DV799682 09E23 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799696.1|DV799696 10K04 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799701.1|DV799701 11B02 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799703.1|DV799703 11B21 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799721.1|DV799721 12E11 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799742.1|DV799742 14P09 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DV799754.1|DV799754 15M14 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|DW986534.1|DW986534 01G21 AAFC_CRC Fusarium graminearum ... 52 1e-004
gb|BI750410.1|BI750410 Ta01_08a04_R Ta01_AAFC_ECORC_Fusariu... 50 5e-004
gb|BJ285804.1|BJ285804 BJ285804 Y. Ogihara unpublished cDNA... 50 5e-004
gb|CA654356.1|CA654356 wre1n.pk161.c5 wre1n Triticum aestiv... 50 5e-004
gb|CA667229.1|CA667229 wlsu1.pk0011.d5 wlsu1 Triticum aesti... 50 5e-004
gb|CA667547.1|CA667547 wlsu1.pk017.k7 wlsu1 Triticum aestiv... 50 5e-004
gb|CA668067.1|CA668067 wlsu1.pk017.n22 wlsu1 Triticum aesti... 50 5e-004
gb|CA668147.1|CA668147 wlsu1.pk018.n22 wlsu1 Triticum aesti... 50 5e-004
gb|CA668387.1|CA668387 wlsu1.pk019.j4 wlsu1 Triticum aestiv... 50 5e-004
gb|CA668688.1|CA668688 wlsu1.pk021.j17 wlsu1 Triticum aesti... 50 5e-004
gb|CA668954.1|CA668954 wlsu1.pk023.c10 wlsu1 Triticum aesti... 50 5e-004
gb|CA668970.1|CA668970 wlsu1.pk023.a10 wlsu1 Triticum aesti... 50 5e-004
gb|CA669470.1|CA669470 wlsu1.pk022.e4 wlsu1 Triticum aestiv... 50 5e-004
gb|CA669697.1|CA669697 wlsu1.pk022.b8 wlsu1 Triticum aestiv... 50 5e-004
gb|CA672963.1|CA672963 wlsu2.pk019.f9 wlsu2 Triticum aestiv... 50 5e-004
gb|CA673259.1|CA673259 wlsu2.pk021.c3 wlsu2 Triticum aestiv... 50 5e-004
gb|CA673332.1|CA673332 wlsu2.pk021.h16 wlsu2 Triticum aesti... 50 5e-004
gb|CA673430.1|CA673430 wlsu2.pk022.c15 wlsu2 Triticum aesti... 50 5e-004
gb|CA673633.1|CA673633 wlsu2.pk021.p1 wlsu2 Triticum aestiv... 50 5e-004
gb|CA675558.1|CA675558 wlsu2.pk027.n10 wlsu2 Triticum aesti... 50 5e-004
gb|CA725683.1|CA725683 wet1s.pk001.g2 wet1s Triticum aestiv... 50 5e-004
gb|CA725686.1|CA725686 wet1s.pk001.g20 wet1s Triticum aesti... 50 5e-004
gb|CA725690.1|CA725690 wet1s.pk001.k2 wet1s Triticum aestiv... 50 5e-004
gb|CA725706.1|CA725706 wet1s.pk001.e20 wet1s Triticum aesti... 50 5e-004
gb|CA725712.1|CA725712 wet1s.pk001.i24 wet1s Triticum aesti... 50 5e-004
gb|CA725721.1|CA725721 wet1s.pk001.a18 wet1s Triticum aesti... 50 5e-004
gb|CA725723.1|CA725723 wet1s.pk001.a22 wet1s Triticum aesti... 50 5e-004
gb|CA725729.1|CA725729 wet1s.pk001.o4 wet1s Triticum aestiv... 50 5e-004
gb|CA725732.1|CA725732 wet1s.pk001.a4 wet1s Triticum aestiv... 50 5e-004
gb|CA725740.1|CA725740 wet1s.pk001.m10 wet1s Triticum aesti... 50 5e-004
gb|CA725750.1|CA725750 wet1s.pk001.i14 wet1s Triticum aesti... 50 5e-004
gb|CA725756.1|CA725756 wet1s.pk001.e10 wet1s Triticum aesti... 50 5e-004
gb|CA725764.1|CA725764 wet1s.pk001.c15 wet1s Triticum aesti... 50 5e-004
gb|CA725768.1|CA725768 wet1s.pk001.g23 wet1s Triticum aesti... 50 5e-004
gb|CA725774.1|CA725774 wet1s.pk001.k21 wet1s Triticum aesti... 50 5e-004
gb|CA725784.1|CA725784 wet1s.pk001.e3 wet1s Triticum aestiv... 50 5e-004
gb|CA725789.1|CA725789 wet1s.pk001.i3 wet1s Triticum aestiv... 50 5e-004
gb|CA725792.1|CA725792 wet1s.pk001.i23 wet1s Triticum aesti... 50 5e-004
gb|CA725800.1|CA725800 wet1s.pk001.a19 wet1s Triticum aesti... 50 5e-004
gb|CA725801.1|CA725801 wet1s.pk001.a21 wet1s Triticum aesti... 50 5e-004
gb|CA725811.1|CA725811 wet1s.pk001.o5 wet1s Triticum aestiv... 50 5e-004
gb|CA725813.1|CA725813 wet1s.pk001.p11 wet1s Triticum aesti... 50 5e-004
gb|CA725814.1|CA725814 wet1s.pk001.p13 wet1s Triticum aesti... 50 5e-004
gb|CA725829.1|CA725829 wet1s.pk001.f21 wet1s Triticum aesti... 50 5e-004
gb|CA725838.1|CA725838 wet1s.pk001.i9 wet1s Triticum aestiv... 50 5e-004
gb|CA725842.1|CA725842 wet1s.pk001.p17 wet1s Triticum aesti... 50 5e-004
gb|CA725843.1|CA725843 wet1s.pk001.p19 wet1s Triticum aesti... 50 5e-004
gb|CA725858.1|CA725858 wet1s.pk001.f7 wet1s Triticum aestiv... 50 5e-004
gb|CA725861.1|CA725861 wet1s.pk001.j9 wet1s Triticum aestiv... 50 5e-004
gb|CA725875.1|CA725875 wet1s.pk001.g9 wet1s Triticum aestiv... 50 5e-004
gb|CA725876.1|CA725876 wet1s.pk001.h13 wet1s Triticum aesti... 50 5e-004
gb|CA725906.1|CA725906 wet1s.pk001.p14 wet1s Triticum aesti... 50 5e-004
gb|CA725914.1|CA725914 wet1s.pk001.f12 wet1s Triticum aesti... 50 5e-004
gb|CA725921.1|CA725921 wet1s.pk001.n14 wet1s Triticum aesti... 50 5e-004
gb|CA725923.1|CA725923 wet1s.pk001.j10 wet1s Triticum aesti... 50 5e-004
gb|CA725927.1|CA725927 wet1s.pk001.j18 wet1s Triticum aesti... 50 5e-004
gb|CA725930.1|CA725930 wet1s.pk001.j21 wet1s Triticum aesti... 50 5e-004
gb|CA725931.1|CA725931 wet1s.pk001.j2 wet1s Triticum aestiv... 50 5e-004
gb|CA725948.1|CA725948 wet1s.pk001.f23 wet1s Triticum aesti... 50 5e-004
gb|CA725950.1|CA725950 wet1s.pk001.j6 wet1s Triticum aestiv... 50 5e-004
gb|CA725953.1|CA725953 wet1s.pk001.j23 wet1s Triticum aesti... 50 5e-004
gb|CA725962.1|CA725962 wet1s.pk001.l8 wet1s Triticum aestiv... 50 5e-004
gb|CA725984.1|CA725984 wet1s.pk001.h2 wet1s Triticum aestiv... 50 5e-004
gb|CA725988.1|CA725988 wet1s.pk001.h8 wet1s Triticum aestiv... 50 5e-004
gb|CA726000.1|CA726000 wet1s.pk002.a15 wet1s Triticum aesti... 50 5e-004
gb|CA726004.1|CA726004 wet1s.pk002.c17 wet1s Triticum aesti... 50 5e-004
gb|CA726015.1|CA726015 wet1s.pk002.k13 wet1s Triticum aesti... 50 5e-004
gb|CA726035.1|CA726035 wet1s.pk002.m5 wet1s Triticum aestiv... 50 5e-004
gb|CA726040.1|CA726040 wet1s.pk002.g23 wet1s Triticum aesti... 50 5e-004
gb|CA726042.1|CA726042 wet1s.pk002.g5 wet1s Triticum aestiv... 50 5e-004
gb|CA726044.1|CA726044 wet1s.pk002.g9 wet1s Triticum aestiv... 50 5e-004
gb|CA726046.1|CA726046 wet1s.pk002.g1 wet1s Triticum aestiv... 50 5e-004
gb|CA726051.1|CA726051 wet1s.pk002.o9 wet1s Triticum aestiv... 50 5e-004
gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aesti... 50 5e-004
gb|CA726070.1|CA726070 wet1s.pk002.c23 wet1s Triticum aesti... 50 5e-004
gb|CA726075.1|CA726075 wet1s.pk002.e1 wet1s Triticum aestiv... 50 5e-004
gb|CA726082.1|CA726082 wet1s.pk002.a12 wet1s Triticum aesti... 50 5e-004
gb|CA726083.1|CA726083 wet1s.pk002.a14 wet1s Triticum aesti... 50 5e-004
gb|CA726086.1|CA726086 wet1s.pk002.c20 wet1s Triticum aesti... 50 5e-004
gb|CA726092.1|CA726092 wet1s.pk002.k18 wet1s Triticum aesti... 50 5e-004
gb|CA726107.1|CA726107 wet1s.pk002.g12 wet1s Triticum aesti... 50 5e-004
gb|CA726130.1|CA726130 wet1s.pk002.a4 wet1s Triticum aestiv... 50 5e-004
gb|CA726131.1|CA726131 wet1s.pk002.m20 wet1s Triticum aesti... 50 5e-004
gb|CA726154.1|CA726154 wet1s.pk002.i6 wet1s Triticum aestiv... 50 5e-004
gb|CA726156.1|CA726156 wet1s.pk002.c6 wet1s Triticum aestiv... 50 5e-004
gb|CA726162.1|CA726162 wet1s.pk002.b19 wet1s Triticum aesti... 50 5e-004
gb|CA726171.1|CA726171 wet1s.pk002.f9 wet1s Triticum aestiv... 50 5e-004
gb|CA726172.1|CA726172 wet1s.pk002.h11 wet1s Triticum aesti... 50 5e-004
gb|CA726174.1|CA726174 wet1s.pk002.h15 wet1s Triticum aesti... 50 5e-004
gb|CA726197.1|CA726197 wet1s.pk002.h9 wet1s Triticum aestiv... 50 5e-004
gb|CA726207.1|CA726207 wet1s.pk002.n19 wet1s Triticum aesti... 50 5e-004
gb|CA726215.1|CA726215 wet1s.pk002.j23 wet1s Triticum aesti... 50 5e-004
gb|CA726218.1|CA726218 wet1s.pk002.d21 wet1s Triticum aesti... 50 5e-004
gb|CA726222.1|CA726222 wet1s.pk002.d7 wet1s Triticum aestiv... 50 5e-004
gb|CA726225.1|CA726225 wet1s.pk002.l17 wet1s Triticum aesti... 50 5e-004
gb|CA726227.1|CA726227 wet1s.pk002.l21 wet1s Triticum aesti... 50 5e-004
gb|CA726228.1|CA726228 wet1s.pk002.l23 wet1s Triticum aesti... 50 5e-004
gb|CA726234.1|CA726234 wet1s.pk002.b10 wet1s Triticum aesti... 50 5e-004
gb|CA726245.1|CA726245 wet1s.pk002.f8 wet1s Triticum aestiv... 50 5e-004
gb|CA726247.1|CA726247 wet1s.pk002.h18 wet1s Triticum aesti... 50 5e-004
gb|CA726253.1|CA726253 wet1s.pk002.h8 wet1s Triticum aestiv... 50 5e-004
gb|CA726256.1|CA726256 wet1s.pk002.h24 wet1s Triticum aesti... 50 5e-004
gb|CA726272.1|CA726272 wet1s.pk003.a12 wet1s Triticum aesti... 50 5e-004
gb|CA726278.1|CA726278 wet1s.pk002.n24 wet1s Triticum aesti... 50 5e-004
gb|CA726291.1|CA726291 wet1s.pk002.j2 wet1s Triticum aestiv... 50 5e-004
gb|CA726297.1|CA726297 wet1s.pk002.j24 wet1s Triticum aesti... 50 5e-004
gb|CA726306.1|CA726306 wet1s.pk002.d8 wet1s Triticum aestiv... 50 5e-004
gb|CA726308.1|CA726308 wet1s.pk002.l12 wet1s Triticum aesti... 50 5e-004
gb|CA726310.1|CA726310 wet1s.pk002.l16 wet1s Triticum aesti... 50 5e-004
gb|CA726311.1|CA726311 wet1s.pk002.l18 wet1s Triticum aesti... 50 5e-004
gb|CA726328.1|CA726328 wet1s.pk003.a8 wet1s Triticum aestiv... 50 5e-004
gb|CA726331.1|CA726331 wet1s.pk003.g20 wet1s Triticum aesti... 50 5e-004
gb|CA726340.1|CA726340 wet1s.pk003.a20 wet1s Triticum aesti... 50 5e-004
gb|CA726347.1|CA726347 wet1s.pk003.o10 wet1s Triticum aesti... 50 5e-004
gb|CA726350.1|CA726350 wet1s.pk003.k14 wet1s Triticum aesti... 50 5e-004
gb|CA726354.1|CA726354 wet1s.pk003.i24 wet1s Triticum aesti... 50 5e-004
gb|CA726357.1|CA726357 wet1s.pk003.i18 wet1s Triticum aesti... 50 5e-004
gb|CA726373.1|CA726373 wet1s.pk003.m22 wet1s Triticum aesti... 50 5e-004
gb|CA726374.1|CA726374 wet1s.pk003.m24 wet1s Triticum aesti... 50 5e-004
gb|CA726381.1|CA726381 wet1s.pk003.m14 wet1s Triticum aesti... 50 5e-004
gb|CA726398.1|CA726398 wet1s.pk003.f7 wet1s Triticum aestiv... 50 5e-004
gb|CA726401.1|CA726401 wet1s.pk003.b21 wet1s Triticum aesti... 50 5e-004
gb|CA726425.1|CA726425 wet1s.pk003.l21 wet1s Triticum aesti... 50 5e-004
gb|CA726426.1|CA726426 wet1s.pk003.p2 wet1s Triticum aestiv... 50 5e-004
gb|CA726433.1|CA726433 wet1s.pk003.p23 wet1s Triticum aesti... 50 5e-004
gb|CA726434.1|CA726434 wet1s.pk003.j1 wet1s Triticum aestiv... 50 5e-004
gb|CA726437.1|CA726437 wet1s.pk003.l11 wet1s Triticum aesti... 50 5e-004
gb|CA726452.1|CA726452 wet1s.pk003.l9 wet1s Triticum aestiv... 50 5e-004
gb|CA726459.1|CA726459 wet1s.pk003.j19 wet1s Triticum aesti... 50 5e-004
gb|CA726484.1|CA726484 wet1s.pk003.d13 wet1s Triticum aesti... 50 5e-004
gb|CA726490.1|CA726490 wet1s.pk003.d4 wet1s Triticum aestiv... 50 5e-004
gb|CA726499.1|CA726499 wet1s.pk003.e7 wet1s Triticum aestiv... 50 5e-004
gb|CA726515.1|CA726515 wet1s.pk003.g11 wet1s Triticum aesti... 50 5e-004
gb|CA726518.1|CA726518 wet1s.pk003.b20 wet1s Triticum aesti... 50 5e-004
gb|CA726519.1|CA726519 wet1s.pk003.b22 wet1s Triticum aesti... 50 5e-004
gb|CA726536.1|CA726536 wet1s.pk003.c21 wet1s Triticum aesti... 50 5e-004
gb|CA726544.1|CA726544 wet1s.pk003.l18 wet1s Triticum aesti... 50 5e-004
gb|CA726562.1|CA726562 wet1s.pk003.i17 wet1s Triticum aesti... 50 5e-004
gb|CA726565.1|CA726565 wet1s.pk003.o15 wet1s Triticum aesti... 50 5e-004
gb|CA726573.1|CA726573 wet1s.pk003.l12 wet1s Triticum aesti... 50 5e-004
gb|CA726575.1|CA726575 wet1s.pk003.k7 wet1s Triticum aestiv... 50 5e-004
gb|CA726576.1|CA726576 wet1s.pk003.k21 wet1s Triticum aesti... 50 5e-004
gb|CA726600.1|CA726600 wet1s.pk003.g9 wet1s Triticum aestiv... 50 5e-004
gb|CA734778.1|CA734778 wpi1s.pk002.i3 wpi1s Triticum aestiv... 50 5e-004
gb|CA734858.1|CA734858 wpi1s.pk002.i4 wpi1s Triticum aestiv... 50 5e-004
gb|CA734862.1|CA734862 wpi1s.pk002.o14 wpi1s Triticum aesti... 50 5e-004
gb|CA734865.1|CA734865 wpi1s.pk002.e16 wpi1s Triticum aesti... 50 5e-004
gb|CA734866.1|CA734866 wpi1s.pk002.e18 wpi1s Triticum aesti... 50 5e-004
gb|CA734869.1|CA734869 wpi1s.pk002.g14 wpi1s Triticum aesti... 50 5e-004
gb|CA734873.1|CA734873 wpi1s.pk002.k16 wpi1s Triticum aesti... 50 5e-004
gb|CA734875.1|CA734875 wpi1s.pk002.k20 wpi1s Triticum aesti... 50 5e-004
gb|CA734876.1|CA734876 wpi1s.pk002.k22 wpi1s Triticum aesti... 50 5e-004
>gb|CA622992.1|CA622992 wl1n.pk0102.a10 wl1n Triticum aestivum cDNA clone wl1n.pk0102.a10
5' end, mRNA sequence
Length = 633
Score = 942 bits (475), Expect = 0.0
Identities = 519/530 (97%), Gaps = 4/530 (0%)
Strand = Plus / Minus
Query: 184 ccttaagaaagcatccaacgtcatgtgctcagatccatggccatccatgaataccgcaag 243
|||| ||||||||||||| | ||| |||||||| ||||||||| |||||| | |||||||
Sbjct: 527 cctttagaaagcatccaa-gncatttgctcaganccatggcca-ccatga-tnccgcaag 471
Query: 244 cacacccaccctctttatttatgacatcatcacgccaagccacgcaaggcacccacacac 303
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 470 cacacccaccctctttatttatgacatcatcacgccaagccangcaaggcacccacacac 411
Query: 304 atacatatatgtatgtaaatatatatgtatagtccaggtgcaatctcacggatagacttc 363
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 atacatatatgtatgtaaatatatatgtatagtccaggtgcaatctcacggatagacttc 351
Query: 364 gaaggcaacacgagctccaaattccttcaggatcttgtattcgct-gaaccctgctttgg 422
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 350 gaaggcaacacgagctccaaattccttcaggatcttgtattcgcttgaaccntgctttgg 291
Query: 423 tgaagagctcgctccattctttttcatctctctgccgtccttttgtcatggtcatcatgc 482
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 290 tgaagagctcgctccattctttttcatctctctgccgtccttttgtcatggtcatcatgc 231
Query: 483 cgatgtccatcaggaggtgagtttccagcataggcccagagtggtcaatcataatatcac 542
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230 cgatgtccatcaggaggtgagtttccagcataggcccagagtggtcaatcataatatcac 171
Query: 543 cgattataactttcccgccatccttccgtgaaggaatcgccttccggcattgagccagga 602
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170 cgattataactttcccgccatccttccgtgaaggaatcgccttccggcattgagccagga 111
Query: 603 gcttgacgcactcctcatcggtcaggtggtgcagcacaagctttagcacgacagtttgag 662
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 110 gcttgacgcactcctcatcggtcaggtggtgcagcacaagctttagcacgacagtttgag 51
Query: 663 caggtggaatgaaactgaacatgtcaccttcgacatagtttatcatcgct 712
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50 caggtggaatgaaactgaacatgtcaccttcgacatagtttatcatcgct 1
>gb|CA625638.1|CA625638 wl1n.pk0140.h5 wl1n Triticum aestivum cDNA clone wl1n.pk0140.h5 5'
end, mRNA sequence
Length = 480
Score = 868 bits (438), Expect = 0.0
Identities = 466/473 (98%), Gaps = 2/473 (0%)
Strand = Plus / Minus
Query: 979 cccgtgcagctcctcgaacggtgacgtgaccacgtccctcttgaaccactccgccagccc 1038
|||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||
Sbjct: 478 cccgtgcagctcctcgaacg-tga-gtgaccacgtccttcttgaaccactccgccagccn 421
Query: 1039 tatccccgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcat 1098
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 420 tatccccgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcat 361
Query: 1099 gtggtcctcgtgagggatgccgtccaccaggaggtaggacacggggctgatgcggtaccg 1158
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 gtggtcctcgtgagggatgccgtccaccaggaggtaggacacggggctgatgcggtaccg 301
Query: 1159 ctcctcctccgtgctctgcctgtcgacggtgaacacgcccgacgcggcgaggagccgcag 1218
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 ctcctcctccgagctctgcttgtcgacggtgaacacgcccgacgcggcgaggagccgcag 241
Query: 1219 caggcggcggaggaacggcagcttagcggaggggagagacagcgccgtgaccagctcagc 1278
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 240 caggcggcggaggaacggcagcttagtggaggggagagacagcgccgtgaccagctcagc 181
Query: 1279 ggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctccacggcgca 1338
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 ggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctccacggcgca 121
Query: 1339 cctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggcttgtgcctt 1398
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120 cctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggcttgtgcctt 61
Query: 1399 tagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtgc 1451
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60 tagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtgc 8
>gb|CA617503.1|CA617503 wl1n.pk0020.b8 wl1n Triticum aestivum cDNA clone wl1n.pk0020.b8 5'
end, mRNA sequence
Length = 494
Score = 737 bits (372), Expect = 0.0
Identities = 393/396 (99%), Gaps = 3/396 (0%)
Strand = Plus / Minus
Query: 461 ccttttgtcatggtcatcatgccgatgtccatcaggaggtgagtttccagcataggccca 520
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||
Sbjct: 393 ccttttgtcatggtcatcatgccgatgtccatcaggag-tgagtttccagcatag-ccca 336
Query: 521 gagtggtcaatcataatatcaccgattataactttcccgccatccttccgtgaaggaatc 580
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 gagtggtcaatcataatatcaccgattataactttcccgccatccttccgtgaaggaatc 276
Query: 581 gccttccggcattgagccaggagcttgacgcactcctcatcggtcaggtggtgcagcaca 640
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 -ccttccggcattgagccaggagcttgacgcactcctcatcggtcaggtggtgcagcaca 217
Query: 641 agctttagcacgacagtttgagcaggtggaatgaaactgaacatgtcaccttcgacatag 700
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 agctttagcacgacagtttgagcaggtggaatgaaactgaacatgtcaccttcgacatag 157
Query: 701 tttatcatcgctccatcggccggtttggtggcaatgatcttgggaggggccagcacagtg 760
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 156 tttatcatcgctccatcggccggtttggtggcaatgatcttgggaggggccagcacagtg 97
Query: 761 cattttatgtgtgggaaggctttgacaatggccctggcacccttgtcatcaccgaagtta 820
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 96 cattttatgtgtgggaaggctttgacaatggccctggcacccttgtcatcaccgaagtta 37
Query: 821 ccgcagcagtaggtcatggactggatcccctcgaac 856
||||||||||||||||||||||||||||||||||||
Sbjct: 36 ccgcagcagtaggtcatggactggatcccctcgaac 1
>gb|CA618900.1|CA618900 wl1n.pk0045.a3 wl1n Triticum aestivum cDNA clone wl1n.pk0045.a3 5'
end, mRNA sequence
Length = 593
Score = 704 bits (355), Expect = 0.0
Identities = 436/452 (96%), Gaps = 9/452 (1%)
Strand = Plus / Minus
Query: 1002 acgtgaccacgtccctcttgaaccactccgccagccctatccccgcctcgatgtagcgcg 1061
||||||||| |||| |||||| ||| |||||||||| ||||||||||| ||| ||||| |
Sbjct: 464 acgtgacca-gtccntcttga-ccantccgccagccttatccccgcctngat-tagcg-g 409
Query: 1062 tcgaggtgcaggtgagcacc-agagcggtgtggttcatgtggtcctcgtgagggatgccg 1120
||||||||||| |||||||| ||||||||||| |||||||| ||||||||||||||||||
Sbjct: 408 tcgaggtgcag-tgagcacccagagcggtgtg-ttcatgtg-tcctcgtgagggatgccg 352
Query: 1121 tccacc-aggaggtaggacacggggctgatgcggtaccgctcctcctccgtgctctgcct 1179
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 351 tccacccaggaggtaggacacggggctgatgcggtaccgctcctcctccgagctctgctt 292
Query: 1180 gtcgacggtgaacacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggcag 1239
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 291 gtcgacggtgaacacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggcag 232
Query: 1240 cttagcggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccgccatg 1299
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231 cttagtggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccgccatg 172
Query: 1300 gcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgag 1359
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 171 gcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgag 112
Query: 1360 gtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagg 1419
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 gtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagg 52
Query: 1420 gcggacaacctcagaagccattgctagagtgc 1451
||||||||||||||||||||||||||||||||
Sbjct: 51 gcggacaacctcagaagccattgctagagtgc 20
>gb|CA619704.1|CA619704 wl1n.pk0049.g11 wl1n Triticum aestivum cDNA clone wl1n.pk0049.g11 5'
end, mRNA sequence
Length = 577
Score = 704 bits (355), Expect = 0.0
Identities = 417/431 (96%), Gaps = 8/431 (1%)
Strand = Plus / Minus
Query: 747 gggccagcacagtgcattttatgtgtgggaaggctttgacaatggccctggcacccttgt 806
|||||||||||||| ||||||||||| | ||||||||| || || ||||||||||||
Sbjct: 425 gggccagcacagtgn--tttatgtgtggaa--gctttgacantg-ccttggcacccttgt 371
Query: 807 catcaccgaagttaccgcagcagtaggtcatggactggatcccctcgaacaagtccctga 866
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 370 catcaccgaagttaccgcagcagtaggtcatggactggatcccctcgaacaagtccttga 311
Query: 867 actcccgcatagctatctcgatgccgaagttgtcgtgggcgtcc-aaggcctcgctcgcc 925
| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 310 a-tcccgcatagctatctcgatgccgaagttgtcgtgggcgtcccaaggcctcgctcgcc 252
Query: 926 -atgtcgtggaaatctgcgtcgaggctccccatgctctcgtggaacagagtcgccccgtg 984
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 catgtcgtggaaatctgcgtcgaggctccccatgctctcgtggaacagagtcgccccgtg 192
Query: 985 cagctcctcgaacggtgacgtgaccacgtccctcttgaaccactccgccagccctatccc 1044
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 cagctcctcgaacggtgacgtgaccacgtccctcttgaaccactccgccagccctatccc 132
Query: 1045 cgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcatgtggtc 1104
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 131 cgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcatgtggtc 72
Query: 1105 ctcgtgagggatgccgtccaccaggaggtaggacacggggctgatgcggtaccgctcctc 1164
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 71 ctcgtgagggatgccgtccaccaggaggtaggacacggggctgatgcggtaccgctcctc 12
Query: 1165 ctccgtgctct 1175
||||| |||||
Sbjct: 11 ctccgagctct 1
>gb|CA625560.1|CA625560 wl1n.pk0143.a12 wl1n Triticum aestivum cDNA clone wl1n.pk0143.a12 5'
end, mRNA sequence
Length = 506
Score = 624 bits (315), Expect = e-177
Identities = 418/441 (94%), Gaps = 9/441 (2%)
Strand = Plus / Minus
Query: 1012 gtccctcttgaaccactccgccagccctatccccgcctcgatgtagcgcgtcgaggtgca 1071
|||| |||||||||| ||||||| || ||||||||||| |||||||||||||||| ||||
Sbjct: 440 gtccttcttgaaccaatccgcca-ccntatccccgccttgatgtagcgcgtcgag-tgca 383
Query: 1072 ggtgagcacc-agagcggtgtggttcatgtggtcctcgtgagggatgccgtccaccagga 1130
| | |||||| |||||| |||| |||||||| | |||||||| || |||||||||||||
Sbjct: 382 gtt-agcacccagagcgttgtg-ttcatgtgtccttcgtgagg-at-ccgtccaccagga 327
Query: 1131 ggtaggacacggggctgatgcggtaccgctcctcctccgtgctctgcctgtcgacggtga 1190
| |||||||||||||||||||||||||| || ||||||| | ||||| ||||||||||||
Sbjct: 326 g-taggacacggggctgatgcggtaccgttcntcctccgag-tctgcttgtcgacggtga 269
Query: 1191 acacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggcagcttagcggagg 1250
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 268 acacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggcagcttagtggagg 209
Query: 1251 ggagagacagcgccgtgaccagctcagcggctgaggcagccccgccatggcggtagatcg 1310
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 ggagagacagcgccgtgaccagctcagcggctgaggcagccccgccatggcggtagatcg 149
Query: 1311 ccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgaggtaggagaggc 1370
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 ccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgaggtaggagaggc 89
Query: 1371 tgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagggcggacaacct 1430
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 88 tgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagggcggacaacct 29
Query: 1431 cagaagccattgctagagtgc 1451
|||||||||||||||||||||
Sbjct: 28 cagaagccattgctagagtgc 8
>gb|CA623232.1|CA623232 wl1n.pk0104.c12 wl1n Triticum aestivum cDNA clone wl1n.pk0104.c12 5'
end, mRNA sequence
Length = 590
Score = 617 bits (311), Expect = e-174
Identities = 383/397 (96%), Gaps = 8/397 (2%)
Strand = Plus / Minus
Query: 1055 tagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcatgtggtcctcgtgaggg 1114
|||||||||||| ||||| | |||||||||||| |||| |||||||| || |||||||||
Sbjct: 400 tagcgcgtcgag-tgcagtt-agcaccagagcg-tgtg-ttcatgtg-tcntcgtgaggg 346
Query: 1115 atgccgtccaccaggaggtaggacacggggctgatgcggtaccgctcctcctccgtgctc 1174
|| |||||||||||||| ||||||||||| ||||||||||||||||| ||||||| ||||
Sbjct: 345 at-ccgtccaccaggag-taggacacggg-ctgatgcggtaccgctcntcctccgagctc 289
Query: 1175 tgcctgtcgacggtgaacacgcccgacgcggcgaggagccgcagcaggcggcggaggaac 1234
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 tgcttgtcgacggtgaacacgcccgacgcggcgaggagccgcagcaggcggcggaggaac 229
Query: 1235 ggcagcttagcggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccg 1294
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 228 ggcagcttagtggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccg 169
Query: 1295 ccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggc 1354
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 168 ccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggc 109
Query: 1355 gtgaggtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcg 1414
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 108 gtgaggtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcg 49
Query: 1415 ctagggcggacaacctcagaagccattgctagagtgc 1451
|||||||||||||||||||||||||||||||||||||
Sbjct: 48 ctagggcggacaacctcagaagccattgctagagtgc 12
>gb|CA618940.1|CA618940 wl1n.pk0042.g3 wl1n Triticum aestivum cDNA clone wl1n.pk0042.g3 5'
end, mRNA sequence
Length = 592
Score = 601 bits (303), Expect = e-170
Identities = 397/414 (95%), Gaps = 11/414 (2%)
Strand = Plus / Minus
Query: 1039 tatccccgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtggttcat 1098
||||||||| ||||||||||| |||||| ||||| ||||||||||||||||||| |||||
Sbjct: 432 tatccccgcntcgatgtagcg-gtcgag-tgcag-tgagcaccagagcggtgtg-ttcat 377
Query: 1099 gtggtcctcgtgagggatgccgtcc-accaggaggtaggacacggggctgatgcggtacc 1157
||| || ||||||||| |||||||| |||||||| |||||||||||| ||||||||||||
Sbjct: 376 gtg-tcttcgtgaggg-tgccgtcccaccaggag-taggacacgggg-tgatgcggtacc 321
Query: 1158 gctcctcctccgtgctctgcctgtcgacggtgaacacgcccgacgcggcgaggagccgca 1217
|||||||||||| | | ||| ||||||||||||||||||||||||||||||||| |||||
Sbjct: 320 gctcctcctccgagtt-tgcttgtcgacggtgaacacgcccgacgcggcgagga-ccgca 263
Query: 1218 gcaggcggcggaggaacggcagcttagcggaggggagagacagcgccgtgaccagctcag 1277
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 262 gcaggcggcggaggaacggcagcttagtggaggggagagacagcgccgtgaccagctcag 203
Query: 1278 cggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctccacggcgc 1337
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 cggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctccacggcgc 143
Query: 1338 acctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggcttgtgcct 1397
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 acctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggcttgtgcct 83
Query: 1398 ttagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtgc 1451
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82 ttagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtgc 29
>gb|CA618826.1|CA618826 wl1n.pk0044.f6 wl1n Triticum aestivum cDNA clone wl1n.pk0044.f6 5'
end, mRNA sequence
Length = 640
Score = 593 bits (299), Expect = e-167
Identities = 401/421 (95%), Gaps = 11/421 (2%)
Strand = Plus / Minus
Query: 1033 cagccctatccccgcctcgatgtagcgcgtcgaggtgcaggtgagcaccagagcggtgtg 1092
||||| ||||||||||| ||| ||||| ||||||||||||||||||||||||||| ||||
Sbjct: 413 cagccttatccccgccttgat-tagcg-gtcgaggtgcaggtgagcaccagagcg-tgtg 357
Query: 1093 gttcatgtggtcctcgt-gagggatgccgtccaccaggaggtaggacacggggct-gatg 1150
|||||||| || |||| ||||||| |||||||||||||| |||||||||||| | ||||
Sbjct: 356 -ttcatgtg-tcttcgttgagggat-ccgtccaccaggag-taggacacgggggttgatg 301
Query: 1151 cggtaccgctcctcctccgtgctctgcctgtcgacggtgaacacgcccgacgcggcgagg 1210
|| |||||||| ||||||| | ||||| ||||||||||||||||||||||||||||||||
Sbjct: 300 cgntaccgctcntcctccgag-tctgcttgtcgacggtgaacacgcccgacgcggcgagg 242
Query: 1211 agccgcagcaggcggcggaggaacggcagcttagcggaggggagagacagcgccgtgacc 1270
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 241 a-ccgcagcaggcggcggaggaacggcagcttagtggaggggagagacagcgccgtgacc 183
Query: 1271 agctcagcggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctcc 1330
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 agctcagcggctgaggcagccccgccatggcggtagatcgccgtagggatgccaagctcc 123
Query: 1331 acggcgcacctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggct 1390
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122 acggcgcacctcagtgacaggggcgtgaggtaggagaggctgagccgccatatgtcggct 63
Query: 1391 tgtgcctttagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtg 1450
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62 tgtgcctttagtagctcggcgtcgctagggcggacaacctcagaagccattgctagagtg 3
Query: 1451 c 1451
|
Sbjct: 2 c 2
>gb|CA621784.1|CA621784 wl1n.pk0076.f7 wl1n Triticum aestivum cDNA clone wl1n.pk0076.f7 5'
end, mRNA sequence
Length = 635
Score = 553 bits (279), Expect = e-155
Identities = 306/313 (97%), Gaps = 2/313 (0%)
Strand = Plus / Minus
Query: 683 atgtcaccttcgacatagtttatcatcgctccatcggccggtttggtggcaatgatcttg 742
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 311 atgtcacnttcganatagtttatcatcgctccatcggccggtttggtggcaat-atcttt 253
Query: 743 ggaggggccagcacagtgcattttatgtgtgggaaggctttgacaatggccctggcaccc 802
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 252 gggagggccagcacagtgcattttatgtgtgggaagg-tttgacaatggccctggcaccc 194
Query: 803 ttgtcatcaccgaagttaccgcagcagtaggtcatggactggatcccctcgaacaagtcc 862
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 ttgtcatcaccgaagttaccgcagcagtaggtcatggactggatcccctcgaacaagtcc 134
Query: 863 ctgaactcccgcatagctatctcgatgccgaagttgtcgtgggcgtccaaggcctcgctc 922
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133 ctgaactcccgcatagctatctcgatgccgaagttgtcgtgggcgtccaaggcctcgctc 74
Query: 923 gccatgtcgtggaaatctgcgtcgaggctccccatgctctcgtggaacagagtcgccccg 982
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 73 gccatgtcgtggaaatctgcgtcgaggctccccatgctctcgtggaacagagtcgccccg 14
Query: 983 tgcagctcctcga 995
|||||||||||||
Sbjct: 13 tgcagctcctcga 1
>gb|CA626327.1|CA626327 wl1n.pk0131.a10 wl1n Triticum aestivum cDNA clone wl1n.pk0131.a10 5'
end, mRNA sequence
Length = 485
Score = 513 bits (259), Expect = e-143
Identities = 315/333 (94%), Gaps = 2/333 (0%)
Strand = Plus / Minus
Query: 1120 gtccaccaggaggtaggacacggggctgatgcggtaccgctcctcctccgtgctctgcct 1179
||||||| ||||||||||||||| ||||||| ||||| || || |||| |||||| |
Sbjct: 345 gtccacccagaggtaggacacgggcttgatgcgntaccgntcttcntccga-ctctgctt 287
Query: 1180 gtcgacggtgaacacgcccg-acgcggcgaggagccgcagcaggcggcggaggaacggca 1238
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 286 gtngacggtgaacacgcccggacgcggcgaggagccgcagcaggcggcggaggaacggca 227
Query: 1239 gcttagcggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccgccat 1298
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 226 gcttagtggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccnccat 167
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 ggcggtagatctccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 107
Query: 1359 ggtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctag 1418
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 gttaggagaggntgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctag 47
Query: 1419 ggcggacaacctcagaagccattgctagagtgc 1451
|||||||||||||||||||||||||||||||||
Sbjct: 46 ggcggacaacctcagaagccattgctagagtgc 14
>gb|CA622417.1|CA622417 wl1n.pk0095.d5 wl1n Triticum aestivum cDNA clone wl1n.pk0095.d5 5'
end, mRNA sequence
Length = 563
Score = 511 bits (258), Expect = e-143
Identities = 270/273 (98%), Gaps = 2/273 (0%)
Strand = Plus / Minus
Query: 1181 tcgacggtgaa--cacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggca 1238
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280 tcgacggtgaaaccacgcccgacgcggcgaggagccgcagcaggcggcggaggaacggca 221
Query: 1239 gcttagcggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccgccat 1298
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220 gcttagtggaggggagagacagcgccgtgaccagctcagcggctgaggcagccccgccat 161
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 160 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 101
Query: 1359 ggtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctag 1418
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 100 ggtaggagaggctgagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctag 41
Query: 1419 ggcggacaacctcagaagccattgctagagtgc 1451
|||||||||||||||||||||||||||||||||
Sbjct: 40 ggcggacaacctcagaagccattgctagagtgc 8
>gb|CA624646.1|CA624646 wl1n.pk0121.c11 wl1n Triticum aestivum cDNA clone wl1n.pk0121.c11 5'
end, mRNA sequence
Length = 261
Score = 408 bits (206), Expect = e-112
Identities = 246/255 (96%), Gaps = 4/255 (1%)
Strand = Plus / Minus
Query: 1193 acgcccgacgcggcgaggagccgcagcaggcggcggaggaacggcagcttagcggagggg 1252
||||||||||| | ||||| ||||||||||||||||||||| |||| |||| |||||||
Sbjct: 252 acgcccgacgcngngagga-ccgcagcaggcggcggaggaa-ggcantttagtggagggg 195
Query: 1253 agagacagcgccgtgacc-agctcagcggctgaggcagccccgccatggcggtagatcgc 1311
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 194 agagacagc-ccgtgacccagctcagcggctgaggcagccccgccatggcggtagatcgc 136
Query: 1312 cgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgaggtaggagaggct 1371
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135 cgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgaggtaggagaggct 76
Query: 1372 gagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagggcggacaacctc 1431
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75 gagccgccatatgtcggcttgtgcctttagtagctcggcgtcgctagggcggacaacctc 16
Query: 1432 agaagccattgctag 1446
|||||||||||||||
Sbjct: 15 agaagccattgctag 1
>gb|CA621172.1|CA621172 wl1n.pk0073.a10 wl1n Triticum aestivum cDNA clone wl1n.pk0073.a10
5' end, mRNA sequence
Length = 657
Score = 385 bits (194), Expect = e-105
Identities = 223/229 (97%), Gaps = 3/229 (1%)
Strand = Plus / Minus
Query: 644 tttagcacg-acagtttg-agcaggtggaatgaaactgaacatgtcaccttcg-acatag 700
||||||||| |||||||| ||||||||||||| || ||||||||||||||| | ||||||
Sbjct: 229 tttagcacggacagtttggagcaggtggaatggaaatgaacatgtcaccttnggacatag 170
Query: 701 tttatcatcgctccatcggccggtttggtggcaatgatcttgggaggggccagcacagtg 760
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 tttatcatcgctccatcggccggtttggtggcaatgatcttgggaggggccagcacagtg 110
Query: 761 cattttatgtgtgggaaggctttgacaatggccctggcacccttgtcatcaccgaagtta 820
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 109 cattttatgtgtgggaaggctttgacaatggccctggcacccttgtcatcaccgaagtta 50
Query: 821 ccgcagcagtaggtcatggactggatcccctcgaacaagtccctgaact 869
|||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 49 ccgcagcagtaggtcatggactggatcccctcgaacaagtccctgaact 1
Score = 46.1 bits (23), Expect = 0.007
Identities = 33/35 (94%), Gaps = 1/35 (2%)
Strand = Plus / Minus
Query: 462 cttttgtcatggtcatcatgccgatgtccatcagg 496
||||||||||||||||||||| |||| ||||||||
Sbjct: 411 cttttgtcatggtcatcatgcggatg-ccatcagg 378
>gb|BE406989.1|BE406989 WHE0446_E10_I20ZS Wheat etiolated seedling root cDNA library Triticum
aestivum cDNA clone WHE0446_E10_I20, mRNA sequence
Length = 304
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 121 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 62
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 61 ggtaggtgaggctg 48
>gb|BE444203.1|BE444203 WHE1128_D08_H16ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1128_D08_H16,
mRNA sequence
Length = 557
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 142 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 83
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 82 ggtaggtgaggctg 69
>gb|BJ279656.1|BJ279656 BJ279656 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr4a19 5', mRNA sequence
Length = 390
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 182 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 123
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 122 ggtaggtgaggctg 109
>gb|BQ483658.1|BQ483658 WHE3511_B03_D05ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3511_B03_D05, mRNA sequence
Length = 644
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 173 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 114
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 113 ggtaggtgaggctg 100
>gb|BQ484041.1|BQ484041 WHE3515_G05_N09ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3515_G05_N09, mRNA sequence
Length = 605
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 131 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 72
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 71 ggtaggtgaggctg 58
>gb|BQ803862.1|BQ803862 WHE2842_H10_O20ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2842_H10_O20, mRNA
sequence
Length = 189
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 136 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 77
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 76 ggtaggtgaggctg 63
>gb|CA602657.1|CA602657 wr1.pk0019.a11 wr1 Triticum aestivum cDNA clone wr1.pk0019.a11 5'
end, mRNA sequence
Length = 519
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 161 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 102
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 101 ggtaggtgaggctg 88
>gb|CA611244.1|CA611244 wr1.pk0122.d10 wr1 Triticum aestivum cDNA clone wr1.pk0122.d10 5'
end, mRNA sequence
Length = 543
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 175 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 116
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 115 ggtaggtgaggctg 102
>gb|CA723630.1|CA723630 wdr1f.pk003.n6 wdr1f Triticum aestivum cDNA clone wdr1f.pk003.n6 5'
end, mRNA sequence
Length = 474
Score = 75.8 bits (38), Expect = 8e-012
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 164 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 105
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 104 ggtaggtgaggctg 91
>gb|BE404466.1|BE404466 WHE0442_F01_K02ZS Wheat etiolated seedling root cDNA library Triticum
aestivum cDNA clone WHE0442_F01_K02, mRNA sequence
Length = 516
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 146 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 87
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 86 gacgtgaggtaggtgaggctg 66
>gb|BE425561.1|BE425561 WHE0317_G06_G06ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0317_G06_G06, mRNA
sequence
Length = 456
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 146 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 87
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 86 gacgtgaggtaggtgaggctg 66
>gb|BE429397.1|BE429397 MTD017.F06F990621 ITEC MTD Durum Wheat Root Library Triticum turgidum
subsp. durum cDNA clone MTD017.F06, mRNA sequence
Length = 398
Score = 73.8 bits (37), Expect = 3e-011
Identities = 64/73 (87%)
Strand = Plus / Minus
Query: 1300 gcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgag 1359
||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || ||||||
Sbjct: 147 gcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtgag 88
Query: 1360 gtaggagaggctg 1372
||||| |||||||
Sbjct: 87 gtaggtgaggctg 75
>gb|BE429476.1|BE429476 TAS000.E09R990610 ITEC TAS Wheat cDNA Library Triticum aestivum cDNA
clone TAS000.E09, mRNA sequence
Length = 571
Score = 73.8 bits (37), Expect = 3e-011
Identities = 64/73 (87%)
Strand = Plus / Minus
Query: 1300 gcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgag 1359
||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || ||||||
Sbjct: 167 gcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtgag 108
Query: 1360 gtaggagaggctg 1372
||||| |||||||
Sbjct: 107 gtaggtgaggctg 95
>gb|BJ278212.1|BJ278212 BJ278212 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr15d21 5', mRNA sequence
Length = 531
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 156 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 97
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 96 gacgtgaggtaggtgaggctg 76
>gb|BJ278236.1|BJ278236 BJ278236 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr15f13 5', mRNA sequence
Length = 529
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 156 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 97
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 96 gacgtgaggtaggtgaggctg 76
>gb|BJ281126.1|BJ281126 BJ281126 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr20k06 5', mRNA sequence
Length = 591
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 172 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 113
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 112 gacgtgaggtaggtgaggctg 92
>gb|AL825902.1|AL825902 AL825902 p:234 Triticum aestivum cDNA clone H08_p234_plate_17_run_2,
mRNA sequence
Length = 547
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 177 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 118
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 117 gacgtgaggtaggtgaggctg 97
>gb|AL826883.1|AL826883 AL826883 p:638 Triticum aestivum cDNA clone F01_p638_plate_10, mRNA
sequence
Length = 608
Score = 73.8 bits (37), Expect = 3e-011
Identities = 64/73 (87%)
Strand = Plus / Minus
Query: 1300 gcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtgag 1359
||||| ||||||||| |||||||| ||||| | ||||||||| ||||||| || ||||||
Sbjct: 179 gcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtgag 120
Query: 1360 gtaggagaggctg 1372
||||| |||||||
Sbjct: 119 gtaggtgaggctg 107
>gb|AL827768.1|AL827768 AL827768 p:739 Triticum aestivum cDNA clone B01_p739_plate_10, mRNA
sequence
Length = 322
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 183 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 124
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 123 gacgtgaggtaggtgaggctg 103
>gb|BQ752900.1|BQ752900 WHE4120_E01_J02ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4120_E01_J02, mRNA sequence
Length = 660
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 186 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 127
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 126 gacgtgaggtaggtgaggctg 106
>gb|BQ838119.1|BQ838119 WHE2906_G04_M08ZS Wheat aluminum-stressed root tip cDNA library
Triticum aestivum cDNA clone WHE2906_G04_M08, mRNA
sequence
Length = 628
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 165 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 106
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 105 gacgtgaggtaggtgaggctg 85
>gb|CA602951.1|CA602951 wr1.pk0022.c10 wr1 Triticum aestivum cDNA clone wr1.pk0022.c10 5'
end, mRNA sequence
Length = 561
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 168 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 109
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 108 gacgtgaggtaggtgaggctg 88
>gb|CD872339.1|CD872339 AZO2.120G13F010209 AZO2 Triticum aestivum cDNA clone AZO2120G13, mRNA
sequence
Length = 693
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 124 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 65
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 64 gacgtgaggtaggtgaggctg 44
>gb|CK194761.1|CK194761 FGAS003193 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 815
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 280 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 221
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 220 gacgtgaggtaggtgaggctg 200
>gb|CK196581.1|CK196581 FGAS005040 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 921
Score = 73.8 bits (37), Expect = 3e-011
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 1292 ccgccatggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacagg 1351
|||||| |||||| ||||||||| |||||||| ||||| | ||||||||| || |||| |
Sbjct: 296 ccgccaaggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagcgacatg 237
Query: 1352 ggcgtgaggtaggagaggctg 1372
| ||||||||||| |||||||
Sbjct: 236 gacgtgaggtaggtgaggctg 216
>gb|CA613069.1|CA613069 wr1.pk0150.h5 wr1 Triticum aestivum cDNA clone wr1.pk0150.h5 5' end,
mRNA sequence
Length = 713
Score = 69.9 bits (35), Expect = 5e-010
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| |||||||| |||||||| ||||| | ||||||||| ||||||| || |||||
Sbjct: 163 ggcggtgnatcgccgtcgggatgccgagctcgatggcgcacctgagtgacatggacgtga 104
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 103 ggtaggtgaggctg 90
>gb|BE404254.1|BE404254 WHE1204_B03_D06ZS Wheat etiolated seedling root cDNA library Triticum
aestivum cDNA clone WHE1204_B03_D06, mRNA sequence
Length = 650
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 75 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 16
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 15 ggtaggtgaggctg 2
>gb|BE415544.1|BE415544 MWL034.F07000404 ITEC MWL Wheat Root Library Triticum aestivum cDNA
clone MWL034.F07, mRNA sequence
Length = 295
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 177 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 118
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 117 ggtaggtgaggctg 104
>gb|BE470771.1|BE470771 WHE0281_D03_H06ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0281_D03_H06, mRNA
sequence
Length = 608
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 140 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 81
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 80 ggtaggtgaggctg 67
>gb|BI480486.1|BI480486 WHE2903_G08_N15ZS Wheat aluminum-stressed root tip cDNA library
Triticum aestivum cDNA clone WHE2903_G08_N15, mRNA
sequence
Length = 443
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 90 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 31
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 30 ggtaggtgaggctg 17
>gb|BJ281899.1|BJ281899 BJ281899 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr24d23 5', mRNA sequence
Length = 508
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 156 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 97
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 96 ggtaggtgaggctg 83
>gb|BJ281952.1|BJ281952 BJ281952 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr24h17 5', mRNA sequence
Length = 660
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 189 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 130
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 129 ggtaggtgaggctg 116
>gb|CA602100.1|CA602100 wr1.pk0015.a10 wr1 Triticum aestivum cDNA clone wr1.pk0015.a10 5'
end, mRNA sequence
Length = 594
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 140 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 81
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 80 ggtaggtgaggctg 67
>gb|CA616234.1|CA616234 wr1.pk180.h3 wr1 Triticum aestivum cDNA clone wr1.pk180.h3 5' end,
mRNA sequence
Length = 556
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 103 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 44
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 43 ggtaggtgaggctg 30
>gb|CK194018.1|CK194018 FGAS002437 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 831
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 282 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 223
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 222 ggtaggtgaggctg 209
>gb|CK199901.1|CK199901 FGAS008408 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum
cDNA, mRNA sequence
Length = 800
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1299 ggcggtagatcgccgtagggatgccaagctccacggcgcacctcagtgacaggggcgtga 1358
|||||| ||||||||| |||||||| ||||| | ||||||||| |||| || || |||||
Sbjct: 262 ggcggtggatcgccgtcgggatgccgagctcgatggcgcacctgagtgccatggacgtga 203
Query: 1359 ggtaggagaggctg 1372
|||||| |||||||
Sbjct: 202 ggtaggtgaggctg 189
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 351,441
Number of Sequences: 636343
Number of extensions: 351441
Number of successful extensions: 120712
Number of sequences better than 0.5: 14075
Number of HSP's better than 0.5 without gapping: 14058
Number of HSP's successfully gapped in prelim test: 17
Number of HSP's that attempted gapping in prelim test: 104963
Number of HSP's gapped (non-prelim): 15719
length of query: 1521
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1501
effective length of database: 354,513,379
effective search space: 532124581879
effective search space used: 532124581879
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)