BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.593
(1027 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL808348.1|AL808348 AL808348 a:22 Triticum aestivum cDNA... 155 7e-036
gb|AL808306.1|AL808306 AL808306 a:22 Triticum aestivum cDNA... 147 2e-033
gb|CK208615.1|CK208615 FGAS020329 Triticum aestivum FGAS: L... 135 7e-030
gb|CD890607.1|CD890607 G118.115A19F010718 G118 Triticum aes... 105 6e-021
gb|CD930597.1|CD930597 GR45.111M19F010511 GR45 Triticum aes... 105 6e-021
gb|CD933035.1|CD933035 GR45.119L01R010830 GR45 Triticum aes... 105 6e-021
gb|BF474767.1|BF474767 WHE2105_H10_O19ZS Wheat salt-stresse... 101 9e-020
gb|BQ241980.1|BQ241980 TaE15035G04F TaE15 Triticum aestivum... 98 1e-018
gb|BE516873.1|BE516873 WHE0622_C04_E08ZA Wheat ABA-treated ... 88 1e-015
gb|BE517063.1|BE517063 WHE623_C04_F07ZA Wheat ABA-treated e... 88 1e-015
gb|CV761619.1|CV761619 FGAS056007 Triticum aestivum FGAS: L... 86 6e-015
gb|CV761878.1|CV761878 FGAS056266 Triticum aestivum FGAS: L... 86 6e-015
gb|CV762035.1|CV762035 FGAS056424 Triticum aestivum FGAS: L... 86 6e-015
gb|CV767524.1|CV767524 FGAS061914 Triticum aestivum FGAS: L... 86 6e-015
gb|CV772244.1|CV772244 FGAS066637 Triticum aestivum FGAS: L... 86 6e-015
gb|CV772635.1|CV772635 FGAS067030 Triticum aestivum FGAS: L... 86 6e-015
gb|CV776756.1|CV776756 FGAS071160 Triticum aestivum FGAS: L... 86 6e-015
gb|CV777547.1|CV777547 FGAS071953 Triticum aestivum FGAS: L... 86 6e-015
gb|CV777819.1|CV777819 FGAS072226 Triticum aestivum FGAS: L... 86 6e-015
gb|CV778500.1|CV778500 FGAS072908 Triticum aestivum FGAS: L... 86 6e-015
gb|CD883826.1|CD883826 F1.114I23F010503 F1 Triticum aestivu... 84 2e-014
gb|CV770727.1|CV770727 FGAS065120 Triticum aestivum FGAS: L... 84 2e-014
gb|CV776029.1|CV776029 FGAS070433 Triticum aestivum FGAS: L... 84 2e-014
gb|BG263207.1|BG263207 WHE2339_C11_F21ZS Wheat pre-anthesis... 80 3e-013
gb|CD454207.1|CD454207 WHE0995-0998_I19_I19ZT CS wheat pre-... 80 3e-013
gb|DR738078.1|DR738078 FGAS083295 Triticum aestivum FGAS: L... 80 3e-013
gb|BE406058.1|BE406058 WHE0405_h12_h12zB Wheat etiolated se... 78 1e-012
gb|CV777233.1|CV777233 FGAS071638 Triticum aestivum FGAS: L... 76 5e-012
gb|AJ612643.1|AJ612643 AJ612643 Triticum turgidum subsp. du... 74 2e-011
gb|BE430003.1|BE430003 TAS006.A08R990616 ITEC TAS Wheat cDN... 72 8e-011
gb|CD884519.1|CD884519 F1.116O01R010628 F1 Triticum aestivu... 72 8e-011
gb|AJ602452.1|AJ602452 AJ602452 T05 Triticum aestivum cDNA ... 72 8e-011
gb|CN012430.1|CN012430 WHE3896_E12_I24ZS Wheat Fusarium gra... 72 8e-011
gb|CN012954.1|CN012954 WHE3955_A01_A01ZS Wheat Fusarium gra... 72 8e-011
gb|CV762827.1|CV762827 FGAS057216 Triticum aestivum FGAS: L... 72 8e-011
gb|DR738789.1|DR738789 FGAS084006 Triticum aestivum FGAS: L... 72 8e-011
gb|DR739394.1|DR739394 FGAS084611 Triticum aestivum FGAS: L... 72 8e-011
dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, com... 72 8e-011
gb|BE420363.1|BE420363 WWS05.G8R000101 ITEC WWS Wheat Scute... 70 3e-010
gb|BE493038.1|BE493038 WHE0562_G01_N02ZE Triticum monococcu... 70 3e-010
gb|BE638023.1|BE638023 WHE0995-0998_I19_I19ZS Wheat pre-ant... 70 3e-010
gb|BJ260741.1|BJ260741 BJ260741 Y. Ogihara unpublished cDNA... 70 3e-010
gb|BQ619862.1|BQ619862 TaLr1156B09F TaLr1 Triticum aestivum... 70 3e-010
gb|BQ620021.1|BQ620021 TaLr1137F07F TaLr1 Triticum aestivum... 70 3e-010
gb|AL825263.1|AL825263 AL825263 p:335 Triticum aestivum cDN... 70 3e-010
gb|BQ802348.1|BQ802348 WHE2824_H11_P22ZS Triticum monococcu... 70 3e-010
gb|BQ805737.1|BQ805737 WHE3570_D11_H22ZS Wheat developing g... 70 3e-010
gb|CD872819.1|CD872819 AZO2.121K08F010209 AZO2 Triticum aes... 70 3e-010
gb|CD872820.1|CD872820 AZO2.121K08R010405 AZO2 Triticum aes... 70 3e-010
gb|CB307458.1|CB307458 HFIG443 Hessian fly infested cDNA li... 70 3e-010
gb|CK214142.1|CK214142 FGAS026065 Triticum aestivum FGAS: L... 70 3e-010
gb|AJ613987.1|AJ613987 AJ613987 Triticum turgidum subsp. du... 70 3e-010
gb|CV758665.1|CV758665 FGAS052941 Triticum aestivum FGAS: L... 70 3e-010
gb|CV758565.1|CV758565 FGAS053010 Triticum aestivum FGAS: L... 70 3e-010
gb|CV759533.1|CV759533 FGAS053917 Triticum aestivum FGAS: L... 70 3e-010
gb|CV760192.1|CV760192 FGAS054576 Triticum aestivum FGAS: L... 70 3e-010
gb|CV760196.1|CV760196 FGAS054580 Triticum aestivum FGAS: L... 70 3e-010
gb|CV760583.1|CV760583 FGAS054969 Triticum aestivum FGAS: L... 70 3e-010
gb|CV760716.1|CV760716 FGAS055102 Triticum aestivum FGAS: L... 70 3e-010
gb|CV760725.1|CV760725 FGAS055111 Triticum aestivum FGAS: L... 70 3e-010
gb|CV761078.1|CV761078 FGAS055466 Triticum aestivum FGAS: L... 70 3e-010
gb|CV761109.1|CV761109 FGAS055497 Triticum aestivum FGAS: L... 70 3e-010
gb|CV761239.1|CV761239 FGAS055627 Triticum aestivum FGAS: L... 70 3e-010
gb|CV761474.1|CV761474 FGAS055862 Triticum aestivum FGAS: L... 70 3e-010
gb|CV761660.1|CV761660 FGAS056048 Triticum aestivum FGAS: L... 70 3e-010
gb|CV762467.1|CV762467 FGAS056856 Triticum aestivum FGAS: L... 70 3e-010
gb|CV764840.1|CV764840 FGAS059225 Triticum aestivum FGAS: L... 70 3e-010
gb|CV766385.1|CV766385 FGAS060772 Triticum aestivum FGAS: L... 70 3e-010
gb|CV766407.1|CV766407 FGAS060794 Triticum aestivum FGAS: L... 70 3e-010
gb|CV768706.1|CV768706 FGAS063097 Triticum aestivum FGAS: L... 70 3e-010
gb|CV768788.1|CV768788 FGAS063179 Triticum aestivum FGAS: L... 70 3e-010
gb|CV768981.1|CV768981 FGAS063372 Triticum aestivum FGAS: L... 70 3e-010
gb|CV769052.1|CV769052 FGAS063443 Triticum aestivum FGAS: L... 70 3e-010
gb|CV770647.1|CV770647 FGAS065040 Triticum aestivum FGAS: L... 70 3e-010
gb|CV771069.1|CV771069 FGAS065462 Triticum aestivum FGAS: L... 70 3e-010
gb|CV771133.1|CV771133 FGAS065526 Triticum aestivum FGAS: L... 70 3e-010
gb|CV771955.1|CV771955 FGAS066348 Triticum aestivum FGAS: L... 70 3e-010
gb|CV772056.1|CV772056 FGAS066449 Triticum aestivum FGAS: L... 70 3e-010
gb|CV772266.1|CV772266 FGAS066659 Triticum aestivum FGAS: L... 70 3e-010
gb|CV772947.1|CV772947 FGAS067342 Triticum aestivum FGAS: L... 70 3e-010
gb|CV773199.1|CV773199 FGAS067595 Triticum aestivum FGAS: L... 70 3e-010
gb|CV773712.1|CV773712 FGAS068109 Triticum aestivum FGAS: L... 70 3e-010
gb|CV774388.1|CV774388 FGAS068786 Triticum aestivum FGAS: L... 70 3e-010
gb|CV776052.1|CV776052 FGAS070456 Triticum aestivum FGAS: L... 70 3e-010
gb|CV777673.1|CV777673 FGAS072079 Triticum aestivum FGAS: L... 70 3e-010
gb|CV777907.1|CV777907 FGAS072314 Triticum aestivum FGAS: L... 70 3e-010
gb|CV778529.1|CV778529 FGAS072938 Triticum aestivum FGAS: L... 70 3e-010
gb|CV778973.1|CV778973 FGAS073382 Triticum aestivum FGAS: L... 70 3e-010
gb|CV779005.1|CV779005 FGAS073414 Triticum aestivum FGAS: L... 70 3e-010
gb|CV780021.1|CV780021 FGAS074430 Triticum aestivum FGAS: L... 70 3e-010
gb|CV781976.1|CV781976 FGAS076389 Triticum aestivum FGAS: L... 70 3e-010
gb|CV782487.1|CV782487 FGAS076900 Triticum aestivum FGAS: L... 70 3e-010
gb|CV782535.1|CV782535 FGAS076948 Triticum aestivum FGAS: L... 70 3e-010
gb|DN829392.1|DN829392 KUCD01_12_E12_T3 WSWR cDNA library T... 70 3e-010
gb|DN829502.1|DN829502 KUCD01_10_H05_T3 WSWR cDNA library T... 70 3e-010
gb|DN829693.1|DN829693 KUCD01_11_D02_T3 WSWR cDNA library T... 70 3e-010
gb|DR736593.1|DR736593 FGAS081963 Triticum aestivum FGAS: L... 70 3e-010
gb|DR738847.1|DR738847 FGAS084064 Triticum aestivum FGAS: L... 70 3e-010
gb|DR738899.1|DR738899 FGAS084116 Triticum aestivum FGAS: L... 70 3e-010
gb|DR740636.1|DR740636 FGAS000577 Triticum aestivum FGAS: L... 70 3e-010
gb|DR740726.1|DR740726 FGAS000663 Triticum aestivum FGAS: L... 70 3e-010
gb|DR741355.1|DR741355 FGAS030411 Triticum aestivum FGAS: L... 70 3e-010
dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase ... 70 3e-010
gb|BE498719.1|BE498719 WHE0965_F08_L15ZS Wheat pre-anthesis... 68 1e-009
gb|CN008536.1|CN008536 WHE2642_C12_E24ZE Wheat Fusarium gra... 68 1e-009
gb|BE405888.1|BE405888 WHE0401_d06_d06zB Wheat etiolated se... 66 5e-009
gb|BJ277962.1|BJ277962 BJ277962 Y. Ogihara unpublished cDNA... 66 5e-009
gb|BJ283032.1|BJ283032 BJ283032 Y. Ogihara unpublished cDNA... 66 5e-009
gb|BQ578855.1|BQ578855 WHE0407_E07_J13ZS Wheat etiolated se... 66 5e-009
gb|CK213891.1|CK213891 FGAS025803 Triticum aestivum FGAS: L... 66 5e-009
gb|AL809638.1|AL809638 AL809638 a:11 Triticum aestivum cDNA... 66 5e-009
gb|AL809644.1|AL809644 AL809644 a:11 Triticum aestivum cDNA... 66 5e-009
gb|CV759044.1|CV759044 FGAS053426 Triticum aestivum FGAS: L... 66 5e-009
gb|CV766211.1|CV766211 FGAS060598 Triticum aestivum FGAS: L... 66 5e-009
gb|CV766581.1|CV766581 FGAS060968 Triticum aestivum FGAS: L... 66 5e-009
gb|CV771073.1|CV771073 FGAS065466 Triticum aestivum FGAS: L... 66 5e-009
gb|CV772789.1|CV772789 FGAS067184 Triticum aestivum FGAS: L... 66 5e-009
gb|BQ160979.1|BQ160979 WHE1058_B08_D16ZT Wheat unstressed s... 64 2e-008
gb|BQ245836.1|BQ245836 TaE15019E11R TaE15 Triticum aestivum... 64 2e-008
gb|BQ247101.1|BQ247101 TaE15001D05R TaE15 Triticum aestivum... 64 2e-008
gb|AL824843.1|AL824843 AL824843 p:234 Triticum aestivum cDN... 64 2e-008
gb|BQ806773.1|BQ806773 WHE3583_A09_A17ZS Wheat developing g... 64 2e-008
gb|CD490766.1|CD490766 WHE3005_A03_A05ZT Wheat etiolated se... 64 2e-008
gb|CD903986.1|CD903986 G356.112B03F010919 G356 Triticum aes... 64 2e-008
gb|CD909555.1|CD909555 G468.112O21F010820 G468 Triticum aes... 64 2e-008
gb|CD918655.1|CD918655 G608.110F03F010910 G608 Triticum aes... 64 2e-008
gb|CK212112.1|CK212112 FGAS023978 Triticum aestivum FGAS: L... 64 2e-008
gb|CK214631.1|CK214631 FGAS026561 Triticum aestivum FGAS: L... 64 2e-008
emb|AX660761.1| Sequence 1118 from Patent WO03000906 64 2e-008
gb|BJ269037.1|BJ269037 BJ269037 Y. Ogihara unpublished cDNA... 62 8e-008
gb|BJ273963.1|BJ273963 BJ273963 Y. Ogihara unpublished cDNA... 62 8e-008
gb|BQ578681.1|BQ578681 WHE0308_E06_J12ZS Wheat unstressed s... 62 8e-008
gb|CD490568.1|CD490568 WHE2959_F03_K05ZT Brevor wheat dorma... 62 8e-008
gb|CD900879.1|CD900879 G356.102B21R011023 G356 Triticum aes... 62 8e-008
gb|CV779996.1|CV779996 FGAS074405 Triticum aestivum FGAS: L... 62 8e-008
gb|BJ272874.1|BJ272874 BJ272874 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ288649.1|BJ288649 BJ288649 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ292436.1|BJ292436 BJ292436 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ294806.1|BJ294806 BJ294806 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ298928.1|BJ298928 BJ298928 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BQ806705.1|BQ806705 WHE3582_C03_F06ZS Wheat developing g... 60 3e-007
gb|BQ806983.1|BQ806983 WHE3585_D06_H11ZS Wheat developing g... 60 3e-007
gb|CD902597.1|CD902597 G356.107H13R011024 G356 Triticum aes... 60 3e-007
gb|CD909854.1|CD909854 G468.113L12F010821 G468 Triticum aes... 60 3e-007
gb|CD909855.1|CD909855 G468.113L12R010929 G468 Triticum aes... 60 3e-007
gb|CK207575.1|CK207575 FGAS019211 Triticum aestivum FGAS: L... 60 3e-007
gb|AJ612894.1|AJ612894 AJ612894 Triticum turgidum subsp. du... 60 3e-007
gb|AJ615517.1|AJ615517 AJ615517 Triticum turgidum subsp. du... 60 3e-007
dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase ... 60 3e-007
gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I... 60 3e-007
gb|BE405578.1|BE405578 WHE1209_A02_A03ZS Wheat etiolated se... 58 1e-006
gb|BE425245.1|BE425245 WHE313_A05_A05ZS Wheat unstressed se... 58 1e-006
gb|BE488961.1|BE488961 WHE1077_C01_F01ZS Wheat unstressed s... 58 1e-006
gb|BJ278989.1|BJ278989 BJ278989 Y. Ogihara unpublished cDNA... 58 1e-006
gb|BJ284042.1|BJ284042 BJ284042 Y. Ogihara unpublished cDNA... 58 1e-006
gb|CD904673.1|CD904673 G468.001F24F010503 G468 Triticum aes... 58 1e-006
gb|CV765022.1|CV765022 FGAS059407 Triticum aestivum FGAS: L... 58 1e-006
gb|BE398921.1|BE398921 WHE0027.H03F990514 ITEC WHE Wheat En... 56 5e-006
gb|BE398922.1|BE398922 WHE0027.H04F990514 ITEC WHE Wheat En... 56 5e-006
gb|BF473270.1|BF473270 WHE0926_E10_I20ZS Wheat 5-15 DAP spi... 56 5e-006
gb|BJ243966.1|BJ243966 BJ243966 Y. Ogihara unpublished cDNA... 56 5e-006
gb|BJ244133.1|BJ244133 BJ244133 Y. Ogihara unpublished cDNA... 56 5e-006
gb|BJ285949.1|BJ285949 BJ285949 Y. Ogihara unpublished cDNA... 56 5e-006
gb|BQ804601.1|BQ804601 WHE3556_F03_K06ZS Wheat developing g... 56 5e-006
gb|BQ805128.1|BQ805128 WHE3563_B12_C23ZS Wheat developing g... 56 5e-006
gb|BQ805783.1|BQ805783 WHE3570_H12_P24ZS Wheat developing g... 56 5e-006
gb|BQ807107.1|BQ807107 WHE3586_H03_P06ZS Wheat developing g... 56 5e-006
gb|BG604379.1|BG604379 WHE2506_G06_M12ZS Wheat subtracted e... 56 5e-006
gb|CK163518.1|CK163518 FGAS016147 Triticum aestivum FGAS: L... 56 5e-006
gb|CK205943.1|CK205943 FGAS017507 Triticum aestivum FGAS: L... 56 5e-006
gb|CK209921.1|CK209921 FGAS021709 Triticum aestivum FGAS: L... 56 5e-006
gb|CK212251.1|CK212251 FGAS024120 Triticum aestivum FGAS: L... 56 5e-006
gb|CV760581.1|CV760581 FGAS054967 Triticum aestivum FGAS: L... 56 5e-006
gb|CV767828.1|CV767828 FGAS062219 Triticum aestivum FGAS: L... 56 5e-006
gb|CV773149.1|CV773149 FGAS067545 Triticum aestivum FGAS: L... 56 5e-006
gb|CV774189.1|CV774189 FGAS068586 Triticum aestivum FGAS: L... 56 5e-006
gb|DR736166.1|DR736166 FGAS020986 Triticum aestivum FGAS: L... 56 5e-006
gb|DR736168.1|DR736168 FGAS021008 Triticum aestivum FGAS: L... 56 5e-006
gb|DR741223.1|DR741223 FGAS001154 Triticum aestivum FGAS: L... 56 5e-006
gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II ... 56 5e-006
gb|BE497948.1|BE497948 WHE0958_D09_H18ZS Wheat pre-anthesis... 54 2e-005
gb|BJ252462.1|BJ252462 BJ252462 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ266432.1|BJ266432 BJ266432 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ280819.1|BJ280819 BJ280819 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ287459.1|BJ287459 BJ287459 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ292669.1|BJ292669 BJ292669 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ292913.1|BJ292913 BJ292913 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ294034.1|BJ294034 BJ294034 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ297301.1|BJ297301 BJ297301 Y. Ogihara unpublished cDNA... 54 2e-005
gb|BJ299110.1|BJ299110 BJ299110 Y. Ogihara unpublished cDNA... 54 2e-005
gb|AL826878.1|AL826878 AL826878 p:638 Triticum aestivum cDN... 54 2e-005
gb|AL827261.1|AL827261 AL827261 p:638 Triticum aestivum cDN... 54 2e-005
gb|BQ805168.1|BQ805168 WHE3563_F04_K07ZS Wheat developing g... 54 2e-005
gb|BQ805600.1|BQ805600 WHE3569_A07_B13ZS Wheat developing g... 54 2e-005
gb|BQ806790.1|BQ806790 WHE3583_C05_E09ZS Wheat developing g... 54 2e-005
gb|CD900878.1|CD900878 G356.102B21F010913 G356 Triticum aes... 54 2e-005
gb|CD901004.1|CD901004 G356.102H12R011023 G356 Triticum aes... 54 2e-005
gb|CD901656.1|CD901656 G356.104H08F010917 G356 Triticum aes... 54 2e-005
gb|CD902818.1|CD902818 G356.108D09F010918 G356 Triticum aes... 54 2e-005
gb|CD904314.1|CD904314 G356.113C19F010920 G356 Triticum aes... 54 2e-005
gb|CD905855.1|CD905855 G468.103B08F010809 G468 Triticum aes... 54 2e-005
gb|CD905856.1|CD905856 G468.103B08R010929 G468 Triticum aes... 54 2e-005
gb|CD909727.1|CD909727 G468.113G05F010821 G468 Triticum aes... 54 2e-005
gb|CD910267.1|CD910267 G468.114N19R010930 G468 Triticum aes... 54 2e-005
gb|CD910378.1|CD910378 G550.001C06F010301 G550 Triticum aes... 54 2e-005
gb|CD910379.1|CD910379 G550.001C06R010829 G550 Triticum aes... 54 2e-005
gb|CD910491.1|CD910491 G550.001G11F010228 G550 Triticum aes... 54 2e-005
gb|CD910492.1|CD910492 G550.001G11R010829 G550 Triticum aes... 54 2e-005
gb|CD913069.1|CD913069 G550.116M01F010525 G550 Triticum aes... 54 2e-005
gb|CV760174.1|CV760174 FGAS054558 Triticum aestivum FGAS: L... 54 2e-005
gb|CV766272.1|CV766272 FGAS060659 Triticum aestivum FGAS: L... 54 2e-005
gb|CV771320.1|CV771320 FGAS065713 Triticum aestivum FGAS: L... 54 2e-005
gb|CV772835.1|CV772835 FGAS067230 Triticum aestivum FGAS: L... 54 2e-005
gb|CV775326.1|CV775326 FGAS069730 Triticum aestivum FGAS: L... 54 2e-005
gb|CV776929.1|CV776929 FGAS071333 Triticum aestivum FGAS: L... 54 2e-005
gb|CV779691.1|CV779691 FGAS074100 Triticum aestivum FGAS: L... 54 2e-005
emb|AJ400140.1|TAE400140 Triticum aestivum partial CHI gene... 54 2e-005
gb|BJ246528.1|BJ246528 BJ246528 Y. Ogihara unpublished cDNA... 52 8e-005
gb|BJ252681.1|BJ252681 BJ252681 Y. Ogihara unpublished cDNA... 52 8e-005
gb|BJ287745.1|BJ287745 BJ287745 Y. Ogihara unpublished cDNA... 52 8e-005
gb|BJ291173.1|BJ291173 BJ291173 Y. Ogihara unpublished cDNA... 52 8e-005
gb|BJ294046.1|BJ294046 BJ294046 Y. Ogihara unpublished cDNA... 52 8e-005
gb|BQ246793.1|BQ246793 TaE15005D10R TaE15 Triticum aestivum... 52 8e-005
gb|CD902471.1|CD902471 G356.107B11F010918 G356 Triticum aes... 52 8e-005
gb|CD902596.1|CD902596 G356.107H13F010918 G356 Triticum aes... 52 8e-005
gb|CD903534.1|CD903534 G356.110K02F010919 G356 Triticum aes... 52 8e-005
gb|CD903574.1|CD903574 G356.110L15F010919 G356 Triticum aes... 52 8e-005
gb|CD906969.1|CD906969 G468.105M01F011012 G468 Triticum aes... 52 8e-005
gb|CD908233.1|CD908233 G468.109E15F010816 G468 Triticum aes... 52 8e-005
gb|CD908234.1|CD908234 G468.109E15R010929 G468 Triticum aes... 52 8e-005
gb|CD909937.1|CD909937 G468.113P01F010820 G468 Triticum aes... 52 8e-005
gb|CD917058.1|CD917058 G608.103N22F010904 G608 Triticum aes... 52 8e-005
gb|CD917059.1|CD917059 G608.103N22R011025 G608 Triticum aes... 52 8e-005
gb|CD919923.1|CD919923 G608.115C17F010911 G608 Triticum aes... 52 8e-005
gb|CD921636.1|CD921636 G750.001F20F010309 G750 Triticum aes... 52 8e-005
gb|CK216083.1|CK216083 FGAS028060 Triticum aestivum FGAS: L... 52 8e-005
gb|CV765548.1|CV765548 FGAS059935 Triticum aestivum FGAS: L... 52 8e-005
gb|CV770399.1|CV770399 FGAS064792 Triticum aestivum FGAS: L... 52 8e-005
gb|DR740966.1|DR740966 FGAS000899 Triticum aestivum FGAS: L... 52 8e-005
emb|AX935408.1| Sequence 12 from Patent WO03089475 52 8e-005
gb|AY973229.1| Triticum aestivum cultivar Gamenya class II ... 52 8e-005
emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene fo... 52 8e-005
gb|BM134776.1|BM134776 WHE0453_E10_E10ZS Wheat Fusarium gra... 50 3e-004
gb|BQ803233.1|BQ803233 WHE2835_C05_F09ZS Triticum monococcu... 50 3e-004
gb|BQ842497.1|BQ842497 WHE2993_G02_N03ZS Wheat dormant embr... 50 3e-004
gb|CD903332.1|CD903332 G356.110A22F010919 G356 Triticum aes... 50 3e-004
gb|CK161231.1|CK161231 FGAS013796 Triticum aestivum FGAS: L... 50 3e-004
gb|CK161245.1|CK161245 FGAS013810 Triticum aestivum FGAS: L... 50 3e-004
gb|CK198901.1|CK198901 FGAS007389 Triticum aestivum FGAS: L... 50 3e-004
gb|CK200819.1|CK200819 FGAS009336 Triticum aestivum FGAS: L... 50 3e-004
gb|DR733309.1|DR733309 FGAS079069 Triticum aestivum FGAS: L... 50 3e-004
gb|DR740372.1|DR740372 FGAS000319 Triticum aestivum FGAS: L... 50 3e-004
gb|BE605136.1|BE605136 WHE1701-1704_I06_I06ZS Wheat heat st... 48 0.001
gb|BF428949.1|BF428949 WHE1712_C09_F18ZS Wheat heat stresse... 48 0.001
gb|BJ287733.1|BJ287733 BJ287733 Y. Ogihara unpublished cDNA... 48 0.001
gb|BJ290695.1|BJ290695 BJ290695 Y. Ogihara unpublished cDNA... 48 0.001
gb|CA486383.1|CA486383 WHE4330_H01_O02ZS Wheat meiotic anth... 48 0.001
gb|CD901003.1|CD901003 G356.102H12F010913 G356 Triticum aes... 48 0.001
gb|CD904558.1|CD904558 G468.001B10F010503 G468 Triticum aes... 48 0.001
gb|CD906007.1|CD906007 G468.103K10F010809 G468 Triticum aes... 48 0.001
gb|CD909964.1|CD909964 G468.114A11F010821 G468 Triticum aes... 48 0.001
gb|CD910266.1|CD910266 G468.114N19F010821 G468 Triticum aes... 48 0.001
gb|BQ620463.1|BQ620463 TaLr1156B09R TaLr1 Triticum aestivum... 46 0.005
gb|CD870331.1|CD870331 AZO2.114B08F001123 AZO2 Triticum aes... 46 0.005
gb|CD900816.1|CD900816 G356.101O19F010906 G356 Triticum aes... 46 0.005
gb|AJ602937.1|AJ602937 AJ602937 T06 Triticum aestivum cDNA ... 46 0.005
gb|CN012246.1|CN012246 WHE3894_D08_H16ZS Wheat Fusarium gra... 46 0.005
gb|CV758911.1|CV758911 FGAS053293 Triticum aestivum FGAS: L... 46 0.005
gb|BJ292386.1|BJ292386 BJ292386 Y. Ogihara unpublished cDNA... 44 0.019
gb|AL821095.1|AL821095 AL821095 O:232 Triticum aestivum cDN... 44 0.019
gb|CD906968.1|CD906968 G468.105M01F010810 G468 Triticum aes... 44 0.019
gb|CK201148.1|CK201148 FGAS009667 Triticum aestivum FGAS: L... 44 0.019
gb|AJ609915.1|AJ609915 AJ609915 Triticum turgidum subsp. du... 44 0.019
gb|DR734693.1|DR734693 FGAS080447 Triticum aestivum FGAS: L... 44 0.019
emb|X95000.1|TACHIA T.aestivum ChiA 0.1 gene 44 0.019
gb|BG313150.1|BG313150 WHE2054_D01_H02ZS Wheat salt-stresse... 42 0.075
gb|BG606329.1|BG606329 WHE2959_F03_K05ZS Wheat dormant embr... 42 0.075
gb|BG907985.1|BG907985 TaLr1165D03F TaLr1 Triticum aestivum... 42 0.075
gb|BI479785.1|BI479785 WHE3452_A10_A20ZS Wheat pre-anthesis... 42 0.075
gb|BJ229894.1|BJ229894 BJ229894 Y. Ogihara unpublished cDNA... 42 0.075
gb|BJ252866.1|BJ252866 BJ252866 Y. Ogihara unpublished cDNA... 42 0.075
gb|BQ245791.1|BQ245791 TaE15020C07R TaE15 Triticum aestivum... 42 0.075
gb|BQ578437.1|BQ578437 WHE0302_H01_O02ZS Wheat unstressed s... 42 0.075
gb|BQ578524.1|BQ578524 WHE0304_H04_P08ZS Wheat unstressed s... 42 0.075
gb|BQ902029.1|BQ902029 Ta02_07d03_R Ta02_AAFC_ECORC_Fusariu... 42 0.075
gb|BQ902441.1|BQ902441 Ta02_02d03_R Ta02_AAFC_ECORC_Fusariu... 42 0.075
gb|BQ167480.1|BQ167480 WHE0067_E07_I13ZK Cheyenne wheat end... 42 0.075
gb|CD895258.1|CD895258 G174.001G06F010514 G174 Triticum aes... 42 0.075
gb|CD901169.1|CD901169 G356.102P14F010913 G356 Triticum aes... 42 0.075
gb|CD901901.1|CD901901 G356.105E23F010918 G356 Triticum aes... 42 0.075
gb|CD909307.1|CD909307 G468.112F02F010820 G468 Triticum aes... 42 0.075
gb|CK209325.1|CK209325 FGAS021087 Triticum aestivum FGAS: L... 42 0.075
gb|CK210588.1|CK210588 FGAS022411 Triticum aestivum FGAS: L... 42 0.075
gb|CK212185.1|CK212185 FGAS024053 Triticum aestivum FGAS: L... 42 0.075
gb|AL814806.1|AL814806 AL814806 h:116 Triticum aestivum cDN... 42 0.075
gb|CV761963.1|CV761963 FGAS056352 Triticum aestivum FGAS: L... 42 0.075
gb|DR740356.1|DR740356 FGAS000303 Triticum aestivum FGAS: L... 42 0.075
gb|DV799638.1|DV799638 06J17 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799645.1|DV799645 06O05 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799647.1|DV799647 07C11 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799657.1|DV799657 07J21 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799658.1|DV799658 07K24 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799682.1|DV799682 09E23 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799686.1|DV799686 09M18 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799716.1|DV799716 11P19 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799726.1|DV799726 12P19 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|DV799753.1|DV799753 15M01 AAFC_CRC Fusarium graminearum ... 42 0.075
gb|BG906960.1|BG906960 TaLr1156A09R TaLr1 Triticum aestivum... 40 0.29
gb|AL820950.1|AL820950 AL820950 O:232 Triticum aestivum cDN... 40 0.29
gb|AL829494.1|AL829494 AL829494 p:840 Triticum aestivum cDN... 40 0.29
gb|CA484292.1|CA484292 WHE4304_F12_L24ZS Wheat meiotic anth... 40 0.29
gb|CD924728.1|CD924728 G750.114E20F010706 G750 Triticum aes... 40 0.29
gb|CK194162.1|CK194162 FGAS002581 Triticum aestivum FGAS: L... 40 0.29
>gb|AL808348.1|AL808348 AL808348 a:22 Triticum aestivum cDNA clone F05_a22_plate_15, mRNA
sequence
Length = 569
Score = 155 bits (78), Expect = 7e-036
Identities = 181/215 (84%), Gaps = 9/215 (4%)
Strand = Plus / Plus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 241 ccggacctggtgtcgaccgaccccgtggtggccttcaagacggccatctggttctggatg 300
Query: 537 acgccgc------agtcgcccaag---ccgtcgtgccacgccgtgatgaccggcgactgg 587
||||||| || ||| |||| ||||| |||||||||||||||||||||| ||||
Sbjct: 301 acgccgcgacatgaggcgcacaagacgccgtcctgccacgccgtgatgaccggcggctgg 360
Query: 588 acgccgtccgccaccgaccgcgccgccgggaggctccccggatatggcctcacctcgaac 647
| |||||| ||| |||||| |||||||||||||||||| || ||| | ||| | |||
Sbjct: 361 aggccgtcgcgcacggaccgccgcgccgggaggctccccgggtacggcatgaccaccaac 420
Query: 648 atcatcaacggcgggctagagtgcggcaagggcca 682
||||||| ||||||||| | |||||||||| ||||
Sbjct: 421 atcatcagcggcgggctggcgtgcggcaagcgcca 455
Score = 79.8 bits (40), Expect = 3e-013
Identities = 73/84 (86%)
Strand = Plus / Plus
Query: 227 cggcttcggcaccaccggcgacgagcagacgcgcaggcgggagctcgccgccttcttcgg 286
|||||||||||||||||||||| || || ||| | ||||||||||||||||||||||
Sbjct: 28 cggcttcggcaccaccggcgaccaggccacccgccgccgggagctcgccgccttcttcgc 87
Query: 287 ccagacgtcccacgaaaccaccgg 310
||||| |||||||| ||||||||
Sbjct: 88 gcagacctcccacgagaccaccgg 111
>gb|AL808306.1|AL808306 AL808306 a:22 Triticum aestivum cDNA clone A11_a22_plate_15, mRNA
sequence
Length = 484
Score = 147 bits (74), Expect = 2e-033
Identities = 180/215 (83%), Gaps = 9/215 (4%)
Strand = Plus / Plus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||| ||| ||||||||||| ||||||||||||||||||| ||||||||||
Sbjct: 207 ccggacctggtgtcgaccgaccccgtggtggccttcaagacggccatctcgttctggatg 266
Query: 537 acgccgc------agtcgcccaag---ccgtcgtgccacgccgtgatgaccggcgactgg 587
||||||| || ||| |||| |||||||||||||||||||||||||||| ||||
Sbjct: 267 acgccgcgacatgaggcgcacaagacgccgtcgtgccacgccgtgatgaccggcggctgg 326
Query: 588 acgccgtccgccaccgaccgcgccgccgggaggctccccggatatggcctcacctcgaac 647
| |||||| || |||||| |||||||||||||||||| || ||| | ||| | |||
Sbjct: 327 aggccgtcgcgcagggaccgccgcgccgggaggctccccgggtacggcatgaccaccaac 386
Query: 648 atcatcaacggcgggctagagtgcggcaagggcca 682
||||||| ||||||||| | |||||||||| ||||
Sbjct: 387 atcatcagcggcgggctggcgtgcggcaagcgcca 421
Score = 61.9 bits (31), Expect = 8e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 236 caccaccggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtc 295
||||||||||||| || || ||| | |||||||||||||||||||||| ||||| ||
Sbjct: 1 caccaccggcgaccaggccacccgccgccgggagctcgccgccttcttcgcgcagacctc 60
Query: 296 ccacgaaaccaccgg 310
|||||| ||||||||
Sbjct: 61 ccacgagaccaccgg 75
>gb|CK208615.1|CK208615 FGAS020329 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1147
Score = 135 bits (68), Expect = 7e-030
Identities = 236/292 (80%)
Strand = Plus / Plus
Query: 389 ctactatggacgaggacccatacagctaactcataagtacaactacaggctcgccgggca 448
|||||| |||||||| ||||||||||| ||||| | ||||||||| ||| || ||| |
Sbjct: 391 ctactacggacgaggccccatacagctgactcacgactacaactaccggcaagctgggga 450
Query: 449 agcgctgaacctgaacctggtgggcgacccggacctggtggcgagagaccccgtggtagc 508
|||||| ||| ||||| |||| |||||||||||||| | | ||||| || || ||
Sbjct: 451 cgcgctggggctggacctgctgggtaacccggacctggtgtccaccgaccctgtcgtcgc 510
Query: 509 cttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacgc 568
|| |||||||| ||||||| |||||||| ||||| ||||||||||||||||||||||
Sbjct: 511 gtttaagacggctatctggtggtggatgacaccgcaagcgcccaagccgtcgtgccacgc 570
Query: 569 cgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgccgggaggctccccgg 628
||||||||||| || ||||||||||||| || || |||| ||| || | |||||||||
Sbjct: 571 cgtgatgaccgacggctggacgccgtccacccaggagcgcgacgcaggcatgctccccgg 630
Query: 629 atatggcctcacctcgaacatcatcaacggcgggctagagtgcggcaagggc 680
|||||| | ||| | ||||||| |||||| || |||||||||||||||
Sbjct: 631 atatggtatgaccacttacatcattaacggcacccttgagtgcggcaagggc 682
Score = 99.6 bits (50), Expect = 4e-019
Identities = 77/86 (89%)
Strand = Plus / Plus
Query: 216 agcaagttccccggcttcggcaccaccggcgacgagcagacgcgcaggcgggagctcgcc 275
|||||| ||| |||||||||||||| |||||||||| | || |||||||| |||||||||
Sbjct: 257 agcaagctccgcggcttcggcaccatcggcgacgaggatacacgcaggcgcgagctcgcc 316
Query: 276 gccttcttcggccagacgtcccacga 301
||||||||||| ||||| ||||||||
Sbjct: 317 gccttcttcgggcagacctcccacga 342
>gb|CD890607.1|CD890607 G118.115A19F010718 G118 Triticum aestivum cDNA clone G118115A19,
mRNA sequence
Length = 387
Score = 105 bits (53), Expect = 6e-021
Identities = 110/129 (85%)
Strand = Plus / Plus
Query: 554 gccgtcgtgccacgccgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgc 613
||||||||||||||||||||||||||||| ||||| |||||| || |||||| |||
Sbjct: 43 gccgtcgtgccacgccgtgatgaccggcggctggaggccgtcgcgcagggaccgccgcgc 102
Query: 614 cgggaggctccccggatatggcctcacctcgaacatcatcaacggcgggctagagtgcgg 673
||||||||||||||| || ||| | ||| | |||||||||| ||||||||| | ||||||
Sbjct: 103 cgggaggctccccgggtacggcatgaccaccaacatcatcagcggcgggctggcgtgcgg 162
Query: 674 caagggcca 682
|||| ||||
Sbjct: 163 caagcgcca 171
>gb|CD930597.1|CD930597 GR45.111M19F010511 GR45 Triticum aestivum cDNA clone GR45111M19,
mRNA sequence
Length = 654
Score = 105 bits (53), Expect = 6e-021
Identities = 110/129 (85%)
Strand = Plus / Plus
Query: 554 gccgtcgtgccacgccgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgc 613
||||||||||||||||||||||||||||| ||||| |||||| || |||||| |||
Sbjct: 274 gccgtcgtgccacgccgtgatgaccggcggctggaggccgtcgcgcagggaccgccgcgc 333
Query: 614 cgggaggctccccggatatggcctcacctcgaacatcatcaacggcgggctagagtgcgg 673
||||||||||||||| || ||| | ||| | |||||||||| ||||||||| | ||||||
Sbjct: 334 cgggaggctccccgggtacggcatgaccaccaacatcatcagcggcgggctggcgtgcgg 393
Query: 674 caagggcca 682
|||| ||||
Sbjct: 394 caagcgcca 402
Score = 101 bits (51), Expect = 9e-020
Identities = 63/67 (94%)
Strand = Plus / Plus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 188 ccggacctggtgtcgaccgaccccgtggtggccttcaagacggccatctggttctggatg 247
Query: 537 acgccgc 543
|||||||
Sbjct: 248 acgccgc 254
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 264 cgggagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||| ||||| |||||||| ||||||||
Sbjct: 14 cgggagctcgccgccttcttcgcgcagacctcccacgagaccaccgg 60
>gb|CD933035.1|CD933035 GR45.119L01R010830 GR45 Triticum aestivum cDNA clone GR45119L01,
mRNA sequence
Length = 661
Score = 105 bits (53), Expect = 6e-021
Identities = 110/129 (85%)
Strand = Plus / Minus
Query: 554 gccgtcgtgccacgccgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgc 613
||||||||||||||||||||||||||||| ||||| |||||| || |||||| |||
Sbjct: 371 gccgtcgtgccacgccgtgatgaccggcggctggaggccgtcgcgcagggaccgccgcgc 312
Query: 614 cgggaggctccccggatatggcctcacctcgaacatcatcaacggcgggctagagtgcgg 673
||||||||||||||| || ||| | ||| | |||||||||| ||||||||| | ||||||
Sbjct: 311 cgggaggctccccgggtacggcatgaccaccaacatcatcagcggcgggctggcgtgcgg 252
Query: 674 caagggcca 682
|||| ||||
Sbjct: 251 caagcgcca 243
Score = 101 bits (51), Expect = 9e-020
Identities = 63/67 (94%)
Strand = Plus / Minus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 457 ccggacctggtgtcgaccgaccccgtggtggccttcaagacggccatctggttctggatg 398
Query: 537 acgccgc 543
|||||||
Sbjct: 397 acgccgc 391
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 264 cgggagctcgccgccttcttcggccagacgtcccacgaaaccacc 308
||||||||| |||||||||||| ||||| |||||||| ||||||
Sbjct: 632 cgggagctcaccgccttcttcgcgcagacctcccacgagaccacc 588
>gb|BF474767.1|BF474767 WHE2105_H10_O19ZS Wheat salt-stressed crown cDNA library Triticum
aestivum cDNA clone WHE2105_H10_O19, mRNA sequence
Length = 603
Score = 101 bits (51), Expect = 9e-020
Identities = 120/143 (83%)
Strand = Plus / Plus
Query: 520 ccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacgccgtgatgaccg 579
|||||||||||||||||||| || | |||| | |||||||||||||||||||||||||
Sbjct: 1 ccatctggttctggatgacggcggcggcgccgagtccgtcgtgccacgccgtgatgaccg 60
Query: 580 gcgactggacgccgtccgccaccgaccgcgccgccgggaggctccccggatatggcctca 639
||| ||||||||| |||||| ||||||| ||||||| ||||||||| || ||| | |
Sbjct: 61 gcggctggacgccctccgcccaagaccgcgacgccgggctgctccccgggtacggcatga 120
Query: 640 cctcgaacatcatcaacggcggg 662
|| | ||||| |||||||||||
Sbjct: 121 ccacctacatcctcaacggcggg 143
>gb|BQ241980.1|BQ241980 TaE15035G04F TaE15 Triticum aestivum cDNA clone TaE15035G04F, mRNA
sequence
Length = 491
Score = 97.6 bits (49), Expect = 1e-018
Identities = 109/129 (84%)
Strand = Plus / Minus
Query: 554 gccgtcgtgccacgccgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgc 613
||||||||||||||||||||||||||||| ||||| |||||| || |||||| |||
Sbjct: 344 gccgtcgtgccacgccgtgatgaccggcggctggaggccgtcgcgcagggaccgccgcgc 285
Query: 614 cgggaggctccccggatatggcctcacctcgaacatcatcaacggcgggctagagtgcgg 673
||||||||||||||| || ||| | ||| | |||||||||| ||||||| | | ||||||
Sbjct: 284 cgggaggctccccgggtacggcatgaccaccaacatcatcagcggcgggttggcgtgcgg 225
Query: 674 caagggcca 682
|||| ||||
Sbjct: 224 caagcgcca 216
Score = 85.7 bits (43), Expect = 6e-015
Identities = 61/67 (91%)
Strand = Plus / Minus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||| ||| ||||||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 430 ccggacctggtgtcgaccgaccccgtggtggccttcaagacggccatttggttttggatg 371
Query: 537 acgccgc 543
|||||||
Sbjct: 370 acgccgc 364
>gb|BE516873.1|BE516873 WHE0622_C04_E08ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0622_C04_E08, mRNA sequence
Length = 520
Score = 87.7 bits (44), Expect = 1e-015
Identities = 65/72 (90%)
Strand = Plus / Plus
Query: 221 gttccccggcttcggcaccaccggcgacgagcagacgcgcaggcgggagctcgccgcctt 280
|||||||||||| |||||||||||||| || |||| ||| |||||||||||||||||||
Sbjct: 255 gttccccggctttggcaccaccggcgatgacaagacccgccggcgggagctcgccgcctt 314
Query: 281 cttcggccagac 292
|||||| |||||
Sbjct: 315 cttcgggcagac 326
Score = 40.1 bits (20), Expect = 0.29
Identities = 45/52 (86%), Gaps = 1/52 (1%)
Strand = Plus / Plus
Query: 475 acccggacctggtggcgagagaccccgtggtagccttcaagacggccatctg 526
|||||||||||||| | | |||||||| || |||||| |||||||||||||
Sbjct: 470 acccggacctggtgtccacggaccccgtcgtcgccttc-agacggccatctg 520
>gb|BE517063.1|BE517063 WHE623_C04_F07ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE623_C04_F07, mRNA sequence
Length = 404
Score = 87.7 bits (44), Expect = 1e-015
Identities = 65/72 (90%)
Strand = Plus / Plus
Query: 221 gttccccggcttcggcaccaccggcgacgagcagacgcgcaggcgggagctcgccgcctt 280
|||||||||||| |||||||||||||| || |||| ||| |||||||||||||||||||
Sbjct: 204 gttccccggctttggcaccaccggcgatgacaagacccgccggcgggagctcgccgcctt 263
Query: 281 cttcggccagac 292
|||||| |||||
Sbjct: 264 cttcgggcagac 275
>gb|CV761619.1|CV761619 FGAS056007 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 806
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 323 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 382
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 383 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 440
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 441 agaccaccgg 450
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 523 cccaccctactatggacggggacccat 549
>gb|CV761878.1|CV761878 FGAS056266 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 856
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 322 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 381
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 382 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 439
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 440 agaccaccgg 449
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 522 cccaccctactatggacggggacccat 548
>gb|CV762035.1|CV762035 FGAS056424 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 848
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 325 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 384
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 385 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 442
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 443 agaccaccgg 452
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 525 cccaccctactatggacggggacccat 551
>gb|CV767524.1|CV767524 FGAS061914 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 836
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 181 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 240
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 241 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 298
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 299 agaccaccgg 308
Score = 52.0 bits (26), Expect = 8e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 648 atcatcaacggcgggctagagtgcggcaagggcc 681
||||||||||||||||| |||||||||| |||||
Sbjct: 647 atcatcaacggcgggctcgagtgcggcatgggcc 680
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 381 cccaccctactatggacggggacccat 407
>gb|CV772244.1|CV772244 FGAS066637 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 851
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 336 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 395
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 396 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 453
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 454 agaccaccgg 463
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 535 cccaccctactatggacggggacccat 561
Score = 42.1 bits (21), Expect = 0.075
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 463 acctggtgggcgacccggacctggtggcgagagaccccgtggtagccttcaagacggcca 522
|||||||| || ||||||||||||| | | ||| | ||||| |||||||||| || |
Sbjct: 615 acctggtgagcaacccggacctggtctccacggacgcggtggtgtccttcaagaccgcaa 674
Query: 523 tctggttctggatgacg 539
| |||||||||||||||
Sbjct: 675 tgtggttctggatgacg 691
>gb|CV772635.1|CV772635 FGAS067030 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 886
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 182 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 241
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 242 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 299
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 300 agaccaccgg 309
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 382 cccaccctactatggacggggacccat 408
>gb|CV776756.1|CV776756 FGAS071160 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 849
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 315 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 374
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 375 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 432
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 433 agaccaccgg 442
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 515 cccaccctactatggacggggacccat 541
>gb|CV777547.1|CV777547 FGAS071953 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 826
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 296 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 355
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 356 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 413
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 414 agaccaccgg 423
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 496 cccaccctactatggacggggacccat 522
>gb|CV777819.1|CV777819 FGAS072226 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 819
Score = 85.7 bits (43), Expect = 6e-015
Identities = 108/127 (85%), Gaps = 2/127 (1%)
Strand = Plus / Plus
Query: 186 tacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccaccggc 245
||||| |||||||||||||||| |||||| ||| ||||| || |||||||||||||||
Sbjct: 322 tacacgtacgacgccttcatcgccgccgccggcaccttcccggggttcggcaccaccggc 381
Query: 246 gacgagca-gacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaaac 304
|| | | |||| | || || |||||||||||||||||||||||||| |||||||| ||
Sbjct: 382 agcgcggacgacgtgaag-cgcgagctcgccgccttcttcggccagacctcccacgagac 440
Query: 305 caccggt 311
|||||||
Sbjct: 441 caccggt 447
>gb|CV778500.1|CV778500 FGAS072908 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 852
Score = 85.7 bits (43), Expect = 6e-015
Identities = 111/130 (85%), Gaps = 4/130 (3%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 305 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 364
Query: 243 ggcgacgagcagacg-cg-caggcgggagctcgccgccttcttcggccagacgtcccacg 300
||| | || |||| || || ||| |||||||||||||||||||||||||| || ||||
Sbjct: 365 ggc--agcgccgacgacgtcaagcgcgagctcgccgccttcttcggccagacctcacacg 422
Query: 301 aaaccaccgg 310
| ||||||||
Sbjct: 423 agaccaccgg 432
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 505 cccaccctactatggacggggacccat 531
>gb|CD883826.1|CD883826 F1.114I23F010503 F1 Triticum aestivum cDNA clone F1114I23, mRNA
sequence
Length = 682
Score = 83.8 bits (42), Expect = 2e-014
Identities = 107/126 (84%), Gaps = 2/126 (1%)
Strand = Plus / Plus
Query: 186 tacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccaccggc 245
||||| |||||||||||||||| |||||| ||| ||||| || |||||||||||||||
Sbjct: 228 tacacgtacgacgccttcatcgccgccgccggcaccttcccggggttcggcaccaccggc 287
Query: 246 gacgagca-gacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaaac 304
|| | | |||| | || || |||||||||||||||||||||||||| |||||||| ||
Sbjct: 288 agcgcggacgacgtgaag-cgcgagctcgccgccttcttcggccagacctcccacgagac 346
Query: 305 caccgg 310
||||||
Sbjct: 347 caccgg 352
Score = 75.8 bits (38), Expect = 5e-012
Identities = 107/130 (82%)
Strand = Plus / Plus
Query: 438 ctcgccgggcaagcgctgaacctgaacctggtgggcgacccggacctggtggcgagagac 497
||||||||| |||||||||| ||| | ||||| || ||||| |||||||| ||| |||
Sbjct: 465 ctcgccgggaaagcgctgaaactggatctggtaagcaacccgaacctggtgtcgacggac 524
Query: 498 cccgtggtagccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccg 557
||| ||| |||||| ||||||||| ||||||||||||||| ||||| |||||||
Sbjct: 525 gccgaggtgtccttcaggacggccatgtggttctggatgacggcgcagggcaacaagccg 584
Query: 558 tcgtgccacg 567
||||||||||
Sbjct: 585 tcgtgccacg 594
>gb|CV770727.1|CV770727 FGAS065120 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 839
Score = 83.8 bits (42), Expect = 2e-014
Identities = 107/126 (84%), Gaps = 2/126 (1%)
Strand = Plus / Plus
Query: 186 tacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccaccggc 245
||||| |||||||||||||||| |||||| ||| ||||| || |||||||||||||||
Sbjct: 323 tacacgtacgacgccttcatcgccgccgccggcaccttcccggggttcggcaccaccggc 382
Query: 246 gacgagca-gacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaaac 304
|| | | |||| | || || |||||||||||||||||||||||||| |||||||| ||
Sbjct: 383 agcgcggacgacgtgaag-cgcgagctcgccgccttcttcggccagacctcccacgagac 441
Query: 305 caccgg 310
||||||
Sbjct: 442 caccgg 447
Score = 75.8 bits (38), Expect = 5e-012
Identities = 107/130 (82%)
Strand = Plus / Plus
Query: 438 ctcgccgggcaagcgctgaacctgaacctggtgggcgacccggacctggtggcgagagac 497
||||||||| |||||||||| ||| | ||||| || ||||| |||||||| ||| |||
Sbjct: 560 ctcgccgggaaagcgctgaaactggatctggtaagcaacccgaacctggtgtcgacggac 619
Query: 498 cccgtggtagccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccg 557
||| ||| |||||| ||||||||| ||||||||||||||| ||||| |||||||
Sbjct: 620 gccgaggtgtccttcaggacggccatgtggttctggatgacggcgcagggcaacaagccg 679
Query: 558 tcgtgccacg 567
||||||||||
Sbjct: 680 tcgtgccacg 689
>gb|CV776029.1|CV776029 FGAS070433 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 844
Score = 83.8 bits (42), Expect = 2e-014
Identities = 107/126 (84%), Gaps = 2/126 (1%)
Strand = Plus / Plus
Query: 186 tacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccaccggc 245
||||| |||||||||||||||| |||||| ||| ||||| || |||||||||||||||
Sbjct: 332 tacacgtacgacgccttcatcgccgccgccggcaccttcccggggttcggcaccaccggc 391
Query: 246 gacgagca-gacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaaac 304
|| | | |||| | || || |||||||||||||||||||||||||| |||||||| ||
Sbjct: 392 agcgcggacgacgtgaag-cgcgagctcgccgccttcttcggccagacctcccacgagac 450
Query: 305 caccgg 310
||||||
Sbjct: 451 caccgg 456
Score = 65.9 bits (33), Expect = 5e-009
Identities = 89/108 (82%)
Strand = Plus / Plus
Query: 438 ctcgccgggcaagcgctgaacctgaacctggtgggcgacccggacctggtggcgagagac 497
||||||||| ||||||||| ||| | ||||| || ||||| |||||||| ||| |||
Sbjct: 569 ctcgccgggaaagcgctganactggatctggtaagcaacccgaacctggtgtcgacggac 628
Query: 498 cccgtggtagccttcaagacggccatctggttctggatgacgccgcag 545
||| ||| |||||| ||||||||| ||||||||||||||| |||||
Sbjct: 629 gccgaggtgtccttcaggacggccatgtggttctggatgacggcgcag 676
>gb|BG263207.1|BG263207 WHE2339_C11_F21ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2339_C11_F21, mRNA sequence
Length = 480
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 45 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 104
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | |||||||||||||||||||| || |||||
Sbjct: 105 ggagacctggacacgcggaagcgggaggtggccgccttcttcggccagacctctcacgag 164
Query: 303 accaccgg 310
||||||||
Sbjct: 165 accaccgg 172
Score = 67.9 bits (34), Expect = 1e-009
Identities = 82/98 (83%)
Strand = Plus / Plus
Query: 477 ccggacctggtggcgagagaccccgtggtagccttcaagacggccatctggttctggatg 536
|||||||||||||| | ||||| ||| || ||||||||||| || ||||||||||||
Sbjct: 381 ccggacctggtggccacggacccgacggtggcgttcaagacggcgatatggttctggatg 440
Query: 537 acgccgcagtcgcccaagccgtcgtgccacgccgtgat 574
||| ||||||| ||||||||||||||| | ||||||
Sbjct: 441 acgacgcagtccaacaagccgtcgtgccatgacgtgat 478
>gb|CD454207.1|CD454207 WHE0995-0998_I19_I19ZT CS wheat pre-anthesis spike cDNA library
Triticum aestivum cDNA clone WHE0995-0998_I19_I19, mRNA
sequence
Length = 638
Score = 79.8 bits (40), Expect = 3e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacg 567
||||| |||||||| |||||| |||||||||| |||||||||||||||||| ||||||
Sbjct: 434 ccttccagacggccctctggtactggatgacggagcagtcgcccaagccgtcctgccaca 375
Query: 568 ccgtgatgaccggcgactggacgccgtccgccaccgaccgcgccgccgggaggctccccg 627
||| || ||| |||||| ||| | | | ||||| ||||||||| |||| ||||
Sbjct: 374 acgtcatcctgggcaactggaagcccacggacgccgacaacgccgccggccggctgcccg 315
Query: 628 gatatggcctcacctcgaacatcatcaacggcgggctagagtgcggcaagggccag 683
| || ||| ||| | | |||||||||||||||||| | |||||||||| |||||||
Sbjct: 314 gctacggcgtcatcacaaacatcatcaacggcggggtcgagtgcggcatgggccag 259
>gb|DR738078.1|DR738078 FGAS083295 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1136
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
||||||||||||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 379 ttctacacctacgacgccttcctggccgccgccggcgcgttcccggccttcggcaccacc 438
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 439 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 498
Query: 303 accaccgg 310
||||||||
Sbjct: 499 accaccgg 506
Score = 65.9 bits (33), Expect = 5e-009
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacgcc 569
||||||||||| || ||||||||||||||| ||||||| ||||||||||||||| | |
Sbjct: 748 ttcaagacggcgatatggttctggatgacgacgcagtccaacaagccgtcgtgccatgac 807
Query: 570 gtgat 574
|||||
Sbjct: 808 gtgat 812
>gb|BE406058.1|BE406058 WHE0405_h12_h12zB Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0405_h12_h12, mRNA
sequence
Length = 401
Score = 77.8 bits (39), Expect = 1e-012
Identities = 48/51 (94%)
Strand = Plus / Plus
Query: 525 tggttctggatgacgccgcagtcgcccaagccgtcgtgccacgccgtgatg 575
||||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 51 tggttctggatgacgccgcaggagcccaagccgtcgtgccacgacgtgatg 101
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 636 ctcacctcgaacatcatcaacggcgggctagagtgc 671
|||||| | |||||||||||||||||||| ||||||
Sbjct: 162 ctcaccaccaacatcatcaacggcgggctcgagtgc 197
>gb|CV777233.1|CV777233 FGAS071638 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 830
Score = 75.8 bits (38), Expect = 5e-012
Identities = 107/130 (82%)
Strand = Plus / Plus
Query: 438 ctcgccgggcaagcgctgaacctgaacctggtgggcgacccggacctggtggcgagagac 497
||||||||| |||||||||| ||| | ||||| || ||||| |||||||| ||| |||
Sbjct: 126 ctcgccgggaaagcgctgaaactggatctggtaagcaacccgaacctggtgtcgacggac 185
Query: 498 cccgtggtagccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccg 557
||| ||| |||||| ||||||||| ||||||||||||||| ||||| |||||||
Sbjct: 186 gccgaggtgtccttcaggacggccatgtggttctggatgacggcgcagggcaacaagccg 245
Query: 558 tcgtgccacg 567
||||||||||
Sbjct: 246 tcgtgccacg 255
>gb|AJ612643.1|AJ612643 AJ612643 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 07390R, mRNA
sequence
Length = 506
Score = 73.8 bits (37), Expect = 2e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 295 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 354
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | |||| ||||||||||||||| || |||||
Sbjct: 355 ggagacctggacacgcggaagcgggaggtggccgncttcttcggccagacctctcacgag 414
Query: 303 accaccgg 310
||||||||
Sbjct: 415 accaccgg 422
>gb|BE430003.1|BE430003 TAS006.A08R990616 ITEC TAS Wheat cDNA Library Triticum aestivum
cDNA clone TAS006.A08, mRNA sequence
Length = 508
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 299 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 358
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 359 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 418
Query: 303 accaccgg 310
||||||||
Sbjct: 419 accaccgg 426
>gb|CD884519.1|CD884519 F1.116O01R010628 F1 Triticum aestivum cDNA clone F1116O01, mRNA
sequence
Length = 539
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 245 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 304
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 305 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 364
Query: 303 accaccgg 310
||||||||
Sbjct: 365 accaccgg 372
>gb|AJ602452.1|AJ602452 AJ602452 T05 Triticum aestivum cDNA clone H05_T05_plate_9, mRNA
sequence
Length = 459
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 286 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 345
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 346 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 405
Query: 303 accaccgg 310
||||||||
Sbjct: 406 accaccgg 413
>gb|CN012430.1|CN012430 WHE3896_E12_I24ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3896_E12_I24,
mRNA sequence
Length = 678
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 310 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 369
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 370 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 429
Query: 303 accaccgg 310
||||||||
Sbjct: 430 accaccgg 437
>gb|CN012954.1|CN012954 WHE3955_A01_A01ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3955_A01_A01,
mRNA sequence
Length = 654
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 259 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 318
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 319 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 378
Query: 303 accaccgg 310
||||||||
Sbjct: 379 accaccgg 386
Score = 40.1 bits (20), Expect = 0.29
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatga 537
||||||||||| || |||||||||||||
Sbjct: 627 ttcaagacggcgatatggttctggatga 654
>gb|CV762827.1|CV762827 FGAS057216 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 854
Score = 71.9 bits (36), Expect = 8e-011
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 376 gagctcgccgccttcttcggccagacctcccacgagaccaccgg 419
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| || |||| || ||||| |||||||| ||||||
Sbjct: 292 ttctacacgtacgacgccttcatcgccgctgccaacaccttcccgggcttcggaaccacc 351
Query: 243 ggc 245
|||
Sbjct: 352 ggc 354
Score = 50.1 bits (25), Expect = 3e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgca 544
|||||| ||||||||| ||||||||||||||| ||||
Sbjct: 617 ccttcaggacggccatgtggttctggatgacggcgca 653
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 648 atcatcaacggcgggctagagtgcggcaagggccag 683
||||||||||||||||| ||||| |||| |||||||
Sbjct: 757 atcatcaacggcgggctcgagtgtggcatgggccag 792
>gb|DR738789.1|DR738789 FGAS084006 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1080
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 367 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 426
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 427 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 486
Query: 303 accaccgg 310
||||||||
Sbjct: 487 accaccgg 494
Score = 52.0 bits (26), Expect = 8e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcagtc 547
||||||||||| || ||||||||||||||| |||||||
Sbjct: 737 ttcaagacggcgatatggttctggatgacgacgcagtc 774
>gb|DR739394.1|DR739394 FGAS084611 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1128
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 355 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 414
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 415 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 474
Query: 303 accaccgg 310
||||||||
Sbjct: 475 accaccgg 482
Score = 65.9 bits (33), Expect = 5e-009
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacgcc 569
||||||||||| || ||||||||||||||| ||||||| ||||||||||||||| | |
Sbjct: 724 ttcaagacggcgatatggttctggatgacgacgcagtccaacaagccgtcgtgccatgac 783
Query: 570 gtgat 574
|||||
Sbjct: 784 gtgat 788
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds
Length = 1163
Score = 71.9 bits (36), Expect = 8e-011
Identities = 105/128 (82%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||| | | |||||| || |||||| | |||||||||||||
Sbjct: 312 ttctacacgtacgacgccttcttggccgccgccggcgcgttcccggccttcggcaccacc 371
Query: 243 ggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacgaa 302
|| ||| | | ||||| | ||||||| | || ||||||||||||||||| || |||||
Sbjct: 372 ggagacctggacacgcggaagcgggaggtggcggccttcttcggccagacctctcacgag 431
Query: 303 accaccgg 310
||||||||
Sbjct: 432 accaccgg 439
Score = 65.9 bits (33), Expect = 5e-009
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccacgcc 569
||||||||||| || ||||||||||||||| ||||||| ||||||||||||||| | |
Sbjct: 681 ttcaagacggcgatatggttctggatgacgacgcagtccaacaagccgtcgtgccatgac 740
Query: 570 gtgat 574
|||||
Sbjct: 741 gtgat 745
>gb|BE420363.1|BE420363 WWS05.G8R000101 ITEC WWS Wheat Scutellum Library Triticum aestivum
cDNA clone WWS05.G8, mRNA sequence
Length = 457
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 239 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 298
Query: 243 ggc 245
|||
Sbjct: 299 ggc 301
Score = 50.1 bits (25), Expect = 3e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 270 ctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
||||| ||||||||||||||||| || ||||| ||||||||
Sbjct: 326 ctcgctgccttcttcggccagacctcgcacgagaccaccgg 366
>gb|BE493038.1|BE493038 WHE0562_G01_N02ZE Triticum monococcum vegetative apex cDNA library
Triticum monococcum cDNA clone WHE0562_G01_N02, mRNA
sequence
Length = 628
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 148 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 207
Query: 243 ggc 245
|||
Sbjct: 208 ggc 210
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 232 gagctcgccgccttcttcggccagacctcacacgagaccaccgg 275
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 348 cccaccctactatggacggggacccat 374
>gb|BE638023.1|BE638023 WHE0995-0998_I19_I19ZS Wheat pre-anthesis spike cDNA library
Triticum aestivum cDNA clone WHE0995-0998_I19_I19, mRNA
sequence
Length = 461
Score = 69.9 bits (35), Expect = 3e-010
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccac 566
||||| |||||||| |||||| |||||||||| |||||||||||||||||| ||||||
Sbjct: 320 ccttccagacggccctctggtactggatgacggagcagtcgcccaagccgtcctgccac 378
Score = 56.0 bits (28), Expect = 5e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||| ||||||||||||||||| || ||||| ||||||||
Sbjct: 100 gagctcgcagccttcttcggccagacctcgcacgagaccaccgg 143
>gb|BJ260741.1|BJ260741 BJ260741 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh26k06 5', mRNA sequence
Length = 594
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 73 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 132
Query: 243 ggc 245
|||
Sbjct: 133 ggc 135
Score = 65.9 bits (33), Expect = 5e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 270 ctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 160 ctcgccgccttcttcggccagacctcccacgagaccaccgg 200
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgccac 566
|||||| ||||||||| ||||||||||||||| ||||| ||||||||||||||||
Sbjct: 398 ccttcaggacggccatgtggttctggatgacggcgcagggaaacaagccgtcgtgccac 456
>gb|BQ619862.1|BQ619862 TaLr1156B09F TaLr1 Triticum aestivum cDNA clone TaLr1156B09F, mRNA
sequence
Length = 690
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 216 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 275
Query: 243 ggc 245
|||
Sbjct: 276 ggc 278
Score = 56.0 bits (28), Expect = 5e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
||||||||| |||||||||||||||| || ||||| ||||||||
Sbjct: 300 gagctcgccaccttcttcggccagacctcacacgagaccaccgg 343
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 416 cccaccctactatggacggggacccat 442
Score = 40.1 bits (20), Expect = 0.29
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcag 545
|||| |||||| || ||||||||||||||| |||||
Sbjct: 543 ttcaggacggcgatgtggttctggatgacggcgcag 578
>gb|BQ620021.1|BQ620021 TaLr1137F07F TaLr1 Triticum aestivum cDNA clone TaLr1137F07F, mRNA
sequence
Length = 562
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 233 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 292
Query: 243 ggc 245
|||
Sbjct: 293 ggc 295
Score = 65.9 bits (33), Expect = 5e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 270 ctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 320 ctcgccgccttcttcggccagacctcccacgagaccaccgg 360
>gb|AL825263.1|AL825263 AL825263 p:335 Triticum aestivum cDNA clone E06_p335_plate_7, mRNA
sequence
Length = 435
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 224 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 283
Query: 243 ggc 245
|||
Sbjct: 284 ggc 286
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 308 gagctcgccgccttcttcggccagacctcacacgagaccaccgg 351
>gb|BQ802348.1|BQ802348 WHE2824_H11_P22ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2824_H11_P22, mRNA
sequence
Length = 773
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 221 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 280
Query: 243 ggc 245
|||
Sbjct: 281 ggc 283
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 305 gagctcgccgccttcttcggccagacctcacacgagaccaccgg 348
Score = 56.0 bits (28), Expect = 5e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 648 atcatcaacggcgggctagagtgcggcaagggccag 683
||||||||||||||||| |||||||||| |||||||
Sbjct: 686 atcatcaacggcgggctcgagtgcggcatgggccag 721
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 421 cccaccctactatggacggggacccat 447
Score = 40.1 bits (20), Expect = 0.29
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcag 545
|||| |||||| || ||||||||||||||| |||||
Sbjct: 548 ttcaggacggcgatgtggttctggatgacggcgcag 583
>gb|BQ805737.1|BQ805737 WHE3570_D11_H22ZS Wheat developing grains cDNA library Triticum
aestivum cDNA clone WHE3570_D11_H22, mRNA sequence
Length = 632
Score = 69.9 bits (35), Expect = 3e-010
Identities = 140/175 (80%)
Strand = Plus / Plus
Query: 182 cttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccac 241
|||||||||||||||||||||| ||| ||||||| || |||| ||||||||||||||
Sbjct: 340 cttctacacctacgacgccttcgtcgcggccgccggcgccttccggggcttcggcaccac 399
Query: 242 cggcgacgagcagacgcgcaggcgggagctcgccgccttcttcggccagacgtcccacga 301
||| | | | || || | ||| ||| | ||||||||| | | |||||| ||||||||
Sbjct: 400 gggcagcacggacacccggaagcgcgaggtggccgccttcctggcccagacctcccacga 459
Query: 302 aaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| |||||||| || ||||| ||| | || || ||||| ||||||
Sbjct: 460 gaccaccggtgggtgggcgacggcaccggacggagccttcgcgtggggctactgc 514
>gb|CD872819.1|CD872819 AZO2.121K08F010209 AZO2 Triticum aestivum cDNA clone AZO2121K08,
mRNA sequence
Length = 706
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 258 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 317
Query: 243 ggc 245
|||
Sbjct: 318 ggc 320
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 342 gagctcgccgccttcttcggccagacctcacacgagaccaccgg 385
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 458 cccaccctactatggacggggacccat 484
Score = 40.1 bits (20), Expect = 0.29
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 510 ttcaagacggccatctggttctggatgacgccgcag 545
|||| |||||| || ||||||||||||||| |||||
Sbjct: 585 ttcaggacggcgatgtggttctggatgacggcgcag 620
>gb|CD872820.1|CD872820 AZO2.121K08R010405 AZO2 Triticum aestivum cDNA clone AZO2121K08,
mRNA sequence
Length = 759
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Minus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 685 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 626
Query: 243 ggc 245
|||
Sbjct: 625 ggc 623
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 267 gagctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
|||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 601 gagctcgccgccttcttcggccagacctcacacgagaccaccgg 558
Score = 46.1 bits (23), Expect = 0.005
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 383 cccaccctactatggacgaggacccat 409
|||||||||||||||||| ||||||||
Sbjct: 485 cccaccctactatggacggggacccat 459
Score = 40.1 bits (20), Expect = 0.29
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 510 ttcaagacggccatctggttctggatgacgccgcag 545
|||| |||||| || ||||||||||||||| |||||
Sbjct: 358 ttcaggacggcgatgtggttctggatgacggcgcag 323
Score = 40.1 bits (20), Expect = 0.29
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 648 atcatcaacggcgggctagagtgcggca 675
||||||||||||||||| ||||| ||||
Sbjct: 220 atcatcaacggcgggctcgagtgtggca 193
>gb|CB307458.1|CB307458 HFIG443 Hessian fly infested cDNA library Triticum aestivum cDNA,
mRNA sequence
Length = 567
Score = 69.9 bits (35), Expect = 3e-010
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 183 ttctacacctacgacgccttcatcgaggccgccagcaagttccccggcttcggcaccacc 242
|||||||| |||||||||||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 242 ttctacacgtacgacgccttcatcgccgccgccaacaccttcccgggcttcggcaccacc 301
Query: 243 ggc 245
|||
Sbjct: 302 ggc 304
Score = 65.9 bits (33), Expect = 5e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 270 ctcgccgccttcttcggccagacgtcccacgaaaccaccgg 310
||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 329 ctcgccgccttcttcggccagacctcccacgagaccaccgg 369
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 297,259
Number of Sequences: 636343
Number of extensions: 297259
Number of successful extensions: 85634
Number of sequences better than 0.5: 313
Number of HSP's better than 0.5 without gapping: 312
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 84572
Number of HSP's gapped (non-prelim): 1016
length of query: 1027
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1007
effective length of database: 354,513,379
effective search space: 356994972653
effective search space used: 356994972653
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)