BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCS16e03.yg.2.1
(608 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL152970.1|CL152970 104_337_10780381_114_31367_013 Sorgh... 521 e-146
gb|AW746450.1|AW746450 WS1_53_E10.b1_A002 Water-stressed 1 ... 408 e-112
gb|AW287088.2|AW287088 LG1_265_D02.b2_A002 Light Grown 1 (L... 133 2e-029
gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library fro... 42 0.059
gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-respon... 42 0.059
gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from ... 40 0.23
gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-resp... 40 0.23
gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.23
gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-respo... 40 0.23
gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.23
>gb|CL152970.1|CL152970 104_337_10780381_114_31367_013 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10780381, DNA
sequence
Length = 482
Score = 521 bits (263), Expect = e-146
Identities = 335/359 (93%)
Strand = Plus / Plus
Query: 16 ggtacctagtaaccttggcacggaccggcctatgatctaccaccaatgcattgatccctt 75
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||
Sbjct: 124 ggtacttagtaaccttggcacggaccggtctatgatctaccaccaatgcattgatctctt 183
Query: 76 taaattctgacgatttattctcatttctgctggaatgggccctcgtaagaaccgcagtga 135
|||| ||||| |||||||||||||||| ||||| |||||||||||||| || |||||||
Sbjct: 184 taaactctgatgatttattctcatttccactggagtgggccctcgtaagcactgcagtga 243
Query: 136 aggtgaaagtagaaccaacttggggtttacttgcaaatccaatctctcccctcatgagtc 195
||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 244 aggtgaaagtacaaccgacttggggtttacttgcaaatccaatctctcccttcatgaggc 303
Query: 196 caaccaagcatttgctgatgcttaatccaatgccagtgcccccatggatgcgagcaatgg 255
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 304 cgaccaagcatttgctgatgcttaatccaataccagtgcccccatggatgcgagcaatgg 363
Query: 256 atggacctacttgcatgaaaggggtgaagacacgggactgagcatcgaacgggattccaa 315
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 364 atggacctacttgcatgaaaggggtgaagacacgggactgaccatcgggcgggattccaa 423
Query: 316 cacccgtatcttcaactgatattatcaagcttattgagtctgatgcgatgggtgcaaaa 374
|||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 424 cacccgtatcttcacctgatattatcaagcttattgactctgatgcaccgggtgcaaaa 482
>gb|AW746450.1|AW746450 WS1_53_E10.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 545
Score = 408 bits (206), Expect = e-112
Identities = 251/266 (94%)
Strand = Plus / Minus
Query: 16 ggtacctagtaaccttggcacggaccggcctatgatctaccaccaatgcattgatccctt 75
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||
Sbjct: 274 ggtacttagtaaccttggcacggaccggtctatgatctaccaccaatgcattgatctctt 215
Query: 76 taaattctgacgatttattctcatttctgctggaatgggccctcgtaagaaccgcagtga 135
|||| ||||| |||||||||||||||| ||||| |||||||||||||| || |||||||
Sbjct: 214 taaactctgatgatttattctcatttccactggagtgggccctcgtaagcactgcagtga 155
Query: 136 aggtgaaagtagaaccaacttggggtttacttgcaaatccaatctctcccctcatgagtc 195
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 154 aggtgaaagtagaaccgacttggggtttacttgcaaatccaatctctcccttcatgaggc 95
Query: 196 caaccaagcatttgctgatgcttaatccaatgccagtgcccccatggatgcgagcaatgg 255
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 94 cgaccaagcatttgctgatgcttaatccaataccagtgcccccatggatgcgagcaatgg 35
Query: 256 atggacctacttgcatgaaaggggtg 281
||||||||||||||||||||||||||
Sbjct: 34 atggacctacttgcatgaaaggggtg 9
>gb|AW287088.2|AW287088 LG1_265_D02.b2_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 447
Score = 133 bits (67), Expect = 2e-029
Identities = 82/87 (94%)
Strand = Plus / Minus
Query: 16 ggtacctagtaaccttggcacggaccggcctatgatctaccaccaatgcattgatccctt 75
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||
Sbjct: 97 ggtacttagtaaccttggcacggaccggtctatgatctaccaccaatgcattgatctctt 38
Query: 76 taaattctgacgatttattctcatttc 102
|||| ||||| ||||||||||||||||
Sbjct: 37 taaactctgatgatttattctcatttc 11
>gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone RUBISCO similar to
Ribulose 1,5-biphosphate carboxylase, mRNA sequence
Length = 638
Score = 42.1 bits (21), Expect = 0.059
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 225 gcggccgcccgggcaggtacc 245
>gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 112
Score = 42.1 bits (21), Expect = 0.059
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 2 gcggccgcccgggcaggtacc 22
>gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone THAU2 similar to
Thaumatin-like protein, mRNA sequence
Length = 747
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 204 gcggccgcccgggcaggtac 223
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 211 gcggccgcccgggcaggtac 192
>gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 282
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 32 gcggccgcccgggcaggtac 51
>gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 234
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtac 65
>gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 223
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 119 gcggccgcccgggcaggtac 100
>gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 172
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 21 gcggccgcccgggcaggtac 2
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 97,952
Number of Sequences: 832831
Number of extensions: 97952
Number of successful extensions: 25926
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25914
Number of HSP's gapped (non-prelim): 12
length of query: 608
length of database: 491,359,669
effective HSP length: 19
effective length of query: 589
effective length of database: 475,535,880
effective search space: 280090633320
effective search space used: 280090633320
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)