BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCH22b04.yg.2.1
(457 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW360973.1|CW360973 fsbb001f029e24f0 Sorghum methylation... 418 e-115
gb|CW360974.1|CW360974 fsbb001f029e24k0 Sorghum methylation... 418 e-115
gb|BI141662.1|BI141662 IP1_55_D04.b1_A002 Immature pannicle... 341 3e-092
gb|CW353450.1|CW353450 fsbb001f016d09f0 Sorghum methylation... 131 6e-029
gb|CW104740.1|CW104740 104_474_11012593_116_34450_015 Sorgh... 101 5e-020
gb|CF489474.1|CF489474 POL1_57_F11.g1_A002 Pollen Sorghum b... 82 5e-014
gb|CN147606.1|CN147606 WOUND1_50_F12.g1_A002 Wounded leaves... 66 3e-009
gb|CW492771.1|CW492771 fsbb001f283d16f0 Sorghum methylation... 58 7e-007
gb|CW311718.1|CW311718 104_801_11470377_148_36278_041 Sorgh... 52 5e-005
gb|BZ367354.1|BZ367354 id03h12.b1 WGS-SbicolorF (JM107 adap... 46 0.003
gb|BZ780956.1|BZ780956 ii22c09.g1 WGS-SbicolorF (DH5a methy... 46 0.003
gb|CW138021.1|CW138021 104_525_11119984_148_34873_054 Sorgh... 46 0.003
gb|CW446008.1|CW446008 fsbb001f171h07f0 Sorghum methylation... 46 0.003
gb|CL193321.1|CL193321 104_416_10940850_116_32270_065 Sorgh... 40 0.17
gb|CW249927.1|CW249927 104_711_11223106_148_35048_033 Sorgh... 40 0.17
gb|CW275588.1|CW275588 104_749_11405043_116_35386_016 Sorgh... 40 0.17
gb|BG051081.1|BG051081 FM1_56_A12.b1_A003 Floral-Induced Me... 40 0.17
>gb|CW360973.1|CW360973 fsbb001f029e24f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f029e24, DNA
sequence
Length = 835
Score = 418 bits (211), Expect = e-115
Identities = 238/247 (96%)
Strand = Plus / Minus
Query: 1 acacggagttactttgccatgaaggttatggataagacttctttggcaagtcggaagaag 60
||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 735 acacggagttactttgctatgaaggttatggataagacttctttggcgagtaggaagaag 676
Query: 61 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctacca 120
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 675 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggatcatccatttctacca 616
Query: 121 accctgtatactcactttgagacagacaagttttcatgcttggttatggaattctgccct 180
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 615 accctgtatactcactttgagacagataagttttcatgcttggttatggaattctgtcct 556
Query: 181 ggaggggatcttcacactcttcgccaaaggcagcctggaaaatatttttcagagcaagca 240
|||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 555 ggaggggaccttcatactcttcggcaaaggcagcctggaaaatatttttcagagcaagca 496
Query: 241 gcaaagt 247
|||||||
Sbjct: 495 gcaaagt 489
Score = 135 bits (68), Expect = 4e-030
Identities = 71/72 (98%)
Strand = Plus / Minus
Query: 246 gttctatgtagctgaggtgctccttgcattggaatacctgcatatgcttgggattatata 305
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72 gttctatgtagcagaggtgctccttgcattggaatacctgcatatgcttgggattatata 13
Query: 306 ccgtgatcttaa 317
||||||||||||
Sbjct: 12 ccgtgatcttaa 1
>gb|CW360974.1|CW360974 fsbb001f029e24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f029e24, DNA
sequence
Length = 763
Score = 418 bits (211), Expect = e-115
Identities = 238/247 (96%)
Strand = Plus / Plus
Query: 1 acacggagttactttgccatgaaggttatggataagacttctttggcaagtcggaagaag 60
||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 253 acacggagttactttgctatgaaggttatggataagacttctttggcgagtaggaagaag 312
Query: 61 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctacca 120
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 313 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggatcatccatttctacca 372
Query: 121 accctgtatactcactttgagacagacaagttttcatgcttggttatggaattctgccct 180
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 373 accctgtatactcactttgagacagataagttttcatgcttggttatggaattctgtcct 432
Query: 181 ggaggggatcttcacactcttcgccaaaggcagcctggaaaatatttttcagagcaagca 240
|||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 433 ggaggggaccttcatactcttcggcaaaggcagcctggaaaatatttttcagagcaagca 492
Query: 241 gcaaagt 247
|||||||
Sbjct: 493 gcaaagt 499
>gb|BI141662.1|BI141662 IP1_55_D04.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 415
Score = 341 bits (172), Expect = 3e-092
Identities = 199/208 (95%)
Strand = Plus / Plus
Query: 1 acacggagttactttgccatgaaggttatggataagacttctttggcaagtcggaagaag 60
||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 208 acacggagttactttgctatgaaggttatggataagacttctttggcgagtaggaagaag 267
Query: 61 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctacca 120
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 268 ctgcttcgagctcagaccgagcgggagatcctgcagtccctggatcatccatttctacca 327
Query: 121 accctgtatactcactttgagacagacaagttttcatgcttggttatggaattctgccct 180
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 328 accctgtatactcactttgagacagataagttttcatgcttggttatggaattctgtcct 387
Query: 181 ggaggggatcttcacactcttcgccaaa 208
|||||||| ||||| |||||||| ||||
Sbjct: 388 ggaggggaccttcatactcttcggcaaa 415
>gb|CW353450.1|CW353450 fsbb001f016d09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f016d09, DNA
sequence
Length = 730
Score = 131 bits (66), Expect = 6e-029
Identities = 81/86 (94%)
Strand = Plus / Plus
Query: 370 gatctatctcttcgctgttcagtgagcctaacggtgatcaagtccgcaaatcctggccta 429
||||| |||||||| |||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 3 gatctctctcttcgttgttcagtaagcctaacggtgatcaaatctgcaaatcctggccta 62
Query: 430 gatgcaatgcagaggaacaatgcagc 455
||||||||||||||||||||||||||
Sbjct: 63 gatgcaatgcagaggaacaatgcagc 88
>gb|CW104740.1|CW104740 104_474_11012593_116_34450_015 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11012593, DNA
sequence
Length = 708
Score = 101 bits (51), Expect = 5e-020
Identities = 117/139 (84%)
Strand = Plus / Minus
Query: 254 tagctgaggtgctccttgcattggaatacctgcatatgcttgggattatataccgtgatc 313
||||||| || ||||| ||| | |||||| |||| |||||||| || |||||||||||||
Sbjct: 284 tagctgaagtcctcctggcactagaatacttgcacatgcttggtatcatataccgtgatc 225
Query: 314 ttaaaccagagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttcgatc 373
| || || || |||||||| |||||||| ||||| ||||||||||| || |||||||| |
Sbjct: 224 tcaagcctgaaaatgtccttgttcgggaggatgggcacatcatgctctcagacttcgacc 165
Query: 374 tatctcttcgctgttcagt 392
| || ||||||||| ||||
Sbjct: 164 tctcccttcgctgtgcagt 146
Score = 99.6 bits (50), Expect = 2e-019
Identities = 146/178 (82%)
Strand = Plus / Minus
Query: 62 tgcttcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctaccaa 121
||||||||||||| || ||| |||||| |||| | |||||| ||||| || || || |
Sbjct: 635 tgcttcgagctcaaacagagaaggagattttgcaatgcctggatcatcccttccttccta 576
Query: 122 ccctgtatactcactttgagacagacaagttttcatgcttggttatggaattctgccctg 181
| || || |||||||||||||| || ||||| || ||| | |||||||| |||||||| |
Sbjct: 575 cactttacactcactttgagaccgataagttctcctgcctagttatggagttctgcccgg 516
Query: 182 gaggggatcttcacactcttcgccaaaggcagcctggaaaatatttttcagagcaagc 239
|||| || |||||||||||||| || ||||||||||| ||| | ||| ||||||||||
Sbjct: 515 gaggagaccttcacactcttcgacagaggcagcctggcaaacactttccagagcaagc 458
>gb|CF489474.1|CF489474 POL1_57_F11.g1_A002 Pollen Sorghum bicolor cDNA clone
POL1_57_F11_A002 5', mRNA sequence
Length = 794
Score = 81.8 bits (41), Expect = 5e-014
Identities = 242/309 (78%)
Strand = Plus / Plus
Query: 6 gagttactttgccatgaaggttatggataagacttctttggcaagtcggaagaagctgct 65
|||||| ||||| |||||||| ||||| ||| | || | |||||||| |||||| ||||
Sbjct: 486 gagttattttgcaatgaaggtcatggacaaggcatcacttgcaagtcgtaagaagttgct 545
Query: 66 tcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctaccaaccct 125
||| | ||||| || ||| ||| |||||| |||||| || ||||| || || || |
Sbjct: 546 tcggtcccagactgaaaaggacatcttgcagtgcctggatcacccattccttcctacatt 605
Query: 126 gtatactcactttgagacagacaagttttcatgcttggttatggaattctgccctggagg 185
|||||| ||||||||||| || || |||||||| |||||||||| || || ||||||||
Sbjct: 606 gtatacccactttgagaccgataaattttcatgtctggttatggagttttgtcctggagg 665
Query: 186 ggatcttcacactcttcgccaaaggcagcctggaaaatatttttcagagcaagcagcaaa 245
|| | || || || || |||||||| | ||| || |||||| |||| ||||| | ||
Sbjct: 666 agacatgcataccctgcgacaaaggcaacgtggcaagtattttccagaacaagcggtcaa 725
Query: 246 gttctatgtagctgaggtgctccttgcattggaatacctgcatatgcttgggattatata 305
||||||||| |||| | ||||| |||||||| |||||||| ||||| || || |||||
Sbjct: 726 attctatgtatctgaaattctcctagcattggagtacctgcacatgctcggtatcatata 785
Query: 306 ccgtgatct 314
|| |||||
Sbjct: 786 tcgggatct 794
>gb|CN147606.1|CN147606 WOUND1_50_F12.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_50_F12_A002 5', mRNA sequence
Length = 818
Score = 65.9 bits (33), Expect = 3e-009
Identities = 96/117 (82%)
Strand = Plus / Plus
Query: 198 tcttcgccaaaggcagcctggaaaatatttttcagagcaagcagcaaagttctatgtagc 257
|||||| ||||| || ||||||||| ||| |||||| |||||||| ||| ||||| ||
Sbjct: 141 tcttcgtcaaagacaacctggaaaaagctttccagagccagcagcaaggttttatgttgc 200
Query: 258 tgaggtgctccttgcattggaatacctgcatatgcttgggattatataccgtgatct 314
|| || |||||||| |||||||| || || ||||| ||| | ||||||||||||||
Sbjct: 201 agaagttctccttgctttggaatatcttcacatgctaggggtcatataccgtgatct 257
>gb|CW492771.1|CW492771 fsbb001f283d16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f283d16, DNA
sequence
Length = 352
Score = 58.0 bits (29), Expect = 7e-007
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 322 gagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttcgatctatctctt 381
||||| |||||||| | |||||||||||||||||||| || |||||||| || || |||
Sbjct: 5 gagaacgtcctcgtaagagaagatggccacatcatgctctccgacttcgacctctccctt 64
Query: 382 cgctg 386
|||||
Sbjct: 65 cgctg 69
>gb|CW311718.1|CW311718 104_801_11470377_148_36278_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470377, DNA
sequence
Length = 635
Score = 52.0 bits (26), Expect = 5e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 322 gagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttcga 371
|||||||||||||| || | || |||||||||||||| |||||||||||
Sbjct: 136 gagaatgtcctcgtgcgcggcgacggccacatcatgctctcggacttcga 185
>gb|BZ367354.1|BZ367354 id03h12.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone id03h12 5', DNA sequence
Length = 575
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 329 tcctcgttcgggaagatggccacatcatgct 359
||||||| ||||||||||||||||||||||
Sbjct: 91 tcctcgtgagggaagatggccacatcatgct 61
>gb|BZ780956.1|BZ780956 ii22c09.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ii22c09, DNA sequence
Length = 732
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 329 tcctcgttcgggaagatggccacatcatgct 359
||||||| ||||||||||||||||||||||
Sbjct: 528 tcctcgtgagggaagatggccacatcatgct 498
>gb|CW138021.1|CW138021 104_525_11119984_148_34873_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11119984, DNA
sequence
Length = 625
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 329 tcctcgttcgggaagatggccacatcatgct 359
||||||| ||||||||||||||||||||||
Sbjct: 109 tcctcgtgagggaagatggccacatcatgct 79
>gb|CW446008.1|CW446008 fsbb001f171h07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f171h07, DNA
sequence
Length = 660
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 329 tcctcgttcgggaagatggccacatcatgct 359
||||||| ||||||||||||||||||||||
Sbjct: 631 tcctcgtgagggaagatggccacatcatgct 601
>gb|CL193321.1|CL193321 104_416_10940850_116_32270_065 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10940850, DNA
sequence
Length = 592
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 175 tgccctggaggggatcttca 194
||||||||||||||||||||
Sbjct: 318 tgccctggaggggatcttca 299
>gb|CW249927.1|CW249927 104_711_11223106_148_35048_033 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11223106, DNA
sequence
Length = 733
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 175 tgccctggaggggatcttca 194
||||||||||||||||||||
Sbjct: 316 tgccctggaggggatcttca 335
>gb|CW275588.1|CW275588 104_749_11405043_116_35386_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11405043, DNA
sequence
Length = 604
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 175 tgccctggaggggatcttca 194
||||||||||||||||||||
Sbjct: 116 tgccctggaggggatcttca 135
>gb|BG051081.1|BG051081 FM1_56_A12.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 566
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 175 tgccctggaggggatcttca 194
||||||||||||||||||||
Sbjct: 412 tgccctggaggggatcttca 431
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 112,270
Number of Sequences: 832831
Number of extensions: 112270
Number of successful extensions: 29981
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29959
Number of HSP's gapped (non-prelim): 22
length of query: 457
length of database: 491,359,669
effective HSP length: 19
effective length of query: 438
effective length of database: 475,535,880
effective search space: 208284715440
effective search space used: 208284715440
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)