BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCG38e04.yg.2.1
(690 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW414651.1|CW414651 fsbb001f114g15k0 Sorghum methylation... 391 e-107
gb|CW513921.1|CW513921 115_5_10512125_1_30022 Sorghum unfil... 139 4e-031
gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorgh... 68 1e-009
gb|CW173113.1|CW173113 104_584_11156668_148_36547_006 Sorgh... 54 2e-005
gb|BM325000.1|BM325000 PIC1_38_E07.b1_A002 Pathogen-infecte... 54 2e-005
gb|CW473572.1|CW473572 fsbb001f229a03f0 Sorghum methylation... 52 7e-005
gb|CW256112.1|CW256112 104_721_11226607_148_35144_032 Sorgh... 44 0.017
gb|CN147848.1|CN147848 WOUND1_52_D08.g1_A002 Wounded leaves... 42 0.067
gb|CW209373.1|CW209373 104_639_11189208_116_36988_090 Sorgh... 40 0.26
gb|CW209374.1|CW209374 104_639_11189208_148_36987_090 Sorgh... 40 0.26
gb|CW265211.1|CW265211 104_734_11231740_148_35264_010 Sorgh... 40 0.26
gb|CN127234.1|CN127234 RHOH1_21_G03.g3_A002 Acid- and alkal... 40 0.26
>gb|CW414651.1|CW414651 fsbb001f114g15k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f114g15, DNA
sequence
Length = 636
Score = 391 bits (197), Expect = e-107
Identities = 398/465 (85%)
Strand = Plus / Minus
Query: 43 ggctcctgctctttttcccaccatgactcccagcttttctctggtgccacaccaatacct 102
|||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||
Sbjct: 465 ggctcctgctctttttcccaccatgactcccaacttttctctggtggcaccccaatacct 406
Query: 103 ccacgattgctgatccacttgtgccaatcagtccagtcatccacaatcttctgccactca 162
||||| || ||||||||||| | ||| |||||||||||||||||||| |||||||||||
Sbjct: 405 ccacggttactgatccacttattccagtcagtccagtcatccacaattttctgccactcg 346
Query: 163 aatccagaaggattgaacaggaatggtgcaaagagccaagtgcccaccatgaaccacatg 222
|| ||||||||||| ||||||||||| ||||||||||| ||| | ||||| |||||||||
Sbjct: 345 aacccagaaggattaaacaggaatggggcaaagagccaggtgacaaccataaaccacatg 286
Query: 223 gatacggtgatgaagatgtaagttatagcccctctatatgactgaccaaatatttcatac 282
|| | |||||||| ||||| | ||||| |||| |||||||| |||||||||||||||
Sbjct: 285 gaaattgtgatgaaaatgtacgcaatagctcctcggtatgactgcccaaatatttcatac 226
Query: 283 acaactagtagaatcatcagctcaaggcccttgacaaaatggctgcgggaataaagtcga 342
|||| || | ||||||||| || | |||||| |||||||| || || ||||| | ||||
Sbjct: 225 acaatgagcaaaatcatcagttcgatgcccttcacaaaatgacttcgtgaatacaatcga 166
Query: 343 tagttctcagcaaatttggcatggaacaccacaaacccacgtccagtggctctgtattcc 402
|||||||||||||||||||||||||| |||||||| ||||| || || ||||| |||||
Sbjct: 165 tagttctcagcaaatttggcatggaagaccacaaatccacgccctgtagctctatattca 106
Query: 403 gctcctccatggagtaacgtccttccgtagtagtgagtttttgttcccaacgagaatgtg 462
||||||||||| | | || ||||||||||||||||||| || || | |||||||||
Sbjct: 105 gctcctccatgtaacagtgtggttccgtagtagtgagttttggtcccaagagagaatgtg 46
Query: 463 aagaaaacagaggccaactgaagctgcatcagtataaaatcactc 507
||||| ||||| || ||||| |||||||| |||| ||| ||||||
Sbjct: 45 aagaacacagatgctaactggagctgcataagtacaaagtcactc 1
>gb|CW513921.1|CW513921 115_5_10512125_1_30022 Sorghum unfiltered library (LibID: 115)
Sorghum bicolor genomic clone 10512125, DNA sequence
Length = 639
Score = 139 bits (70), Expect = 4e-031
Identities = 84/90 (93%)
Strand = Plus / Minus
Query: 504 actcaatgcagttctgaatcctctctccaaaccgatttccatcatcatgggcagcgccat 563
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 639 actcaatgcagttctgaatcctctctccaaaccgatttccatcatcatgggtagcgccat 580
Query: 564 caaaaatccangnngcacaaaagacnctga 593
|||||| ||| | ||||||||||| ||||
Sbjct: 579 caaaaacccaagttgcacaaaagactctga 550
>gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220201, DNA
sequence
Length = 699
Score = 67.9 bits (34), Expect = 1e-009
Identities = 70/82 (85%)
Strand = Plus / Plus
Query: 427 ccgtagtagtgagtttttgttcccaacgagaatgtgaagaaaacagaggccaactgaagc 486
||||||||||| | ||||||||| | ||||||||||||||||| || |||||||| |
Sbjct: 71 ccgtagtagtgtgcttttgttccaagagagaatgtgaagaaaactgatgccaactgcaat 130
Query: 487 tgcatcagtataaaatcactca 508
||||| || |||||||||||||
Sbjct: 131 tgcatgaggataaaatcactca 152
>gb|CW173113.1|CW173113 104_584_11156668_148_36547_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11156668, DNA
sequence
Length = 628
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 126 ccaatcagtccagtcatccacaatcttctgccactcaaa 164
|||||| ||||||||||| ||| ||||||||||||||||
Sbjct: 311 ccaatctgtccagtcatcaacagtcttctgccactcaaa 273
>gb|BM325000.1|BM325000 PIC1_38_E07.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 558
Score = 54.0 bits (27), Expect = 2e-005
Identities = 79/95 (83%), Gaps = 1/95 (1%)
Strand = Plus / Minus
Query: 106 cgattgctgatccacttgtgccaatcagtccagtcatccacaatcttctgccactcaaat 165
||||||||||||||||| | |||||||| ||| ||||| ||||| || ||||||||||
Sbjct: 558 cgattgctgatccacttat-ccaatcagaccaatcatcaacaatttttgcccactcaaat 500
Query: 166 ccagaaggattgaacaggaatggtgcaaagagcca 200
|| || || ||||| || || |||||||| |||||
Sbjct: 499 ccggaggggttgaatagaaagggtgcaaatagcca 465
Score = 44.1 bits (22), Expect = 0.017
Identities = 61/74 (82%)
Strand = Plus / Minus
Query: 292 agaatcatcagctcaaggcccttgacaaaatggctgcgggaataaagtcgatagttctca 351
|||||||||||||||| || || ||||| |||||||| || || |||| ||| |||||
Sbjct: 373 agaatcatcagctcaatccctttaacaaagtggctgcgagagtagagtctataattctct 314
Query: 352 gcaaatttggcatg 365
||||| || |||||
Sbjct: 313 gcaaactttgcatg 300
>gb|CW473572.1|CW473572 fsbb001f229a03f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f229a03, DNA
sequence
Length = 141
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 154 tgccactcaaatccagaaggattgaacaggaatggtgcaaagagccaagt 203
|||||||||||||| || |||||||| |||||||| || || ||||||||
Sbjct: 15 tgccactcaaatcctgatggattgaagaggaatggagcgaatagccaagt 64
>gb|CW256112.1|CW256112 104_721_11226607_148_35144_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226607, DNA
sequence
Length = 678
Score = 44.1 bits (22), Expect = 0.017
Identities = 85/106 (80%)
Strand = Plus / Minus
Query: 59 cccaccatgactcccagcttttctctggtgccacaccaatacctccacgattgctgatcc 118
||||||| | |||||| |||| ||| ||||| | |||||||| || | ||||| ||||
Sbjct: 526 cccaccaagcctcccaactttgctcaggtgctaatccaataccacctctattgcccatcc 467
Query: 119 acttgtgccaatcagtccagtcatccacaatcttctgccactcaaa 164
|||| ||| ||| |||||||||| ||| |||| |||||||||||
Sbjct: 466 acttccaccagtcaatccagtcatcaacagtcttgtgccactcaaa 421
>gb|CN147848.1|CN147848 WOUND1_52_D08.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_52_D08_A002 5', mRNA sequence
Length = 731
Score = 42.1 bits (21), Expect = 0.067
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 316 acaaaatggctgcgggaataaagtcgatagttctcagcaaa 356
||||||||||| || | ||||| |||||||||||||||||
Sbjct: 69 acaaaatggcttcgagcataaatacgatagttctcagcaaa 29
>gb|CW209373.1|CW209373 104_639_11189208_116_36988_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189208, DNA
sequence
Length = 616
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 508 aatgcagttctgaatcctct 527
||||||||||||||||||||
Sbjct: 383 aatgcagttctgaatcctct 402
>gb|CW209374.1|CW209374 104_639_11189208_148_36987_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189208, DNA
sequence
Length = 634
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 508 aatgcagttctgaatcctct 527
||||||||||||||||||||
Sbjct: 612 aatgcagttctgaatcctct 593
>gb|CW265211.1|CW265211 104_734_11231740_148_35264_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11231740, DNA
sequence
Length = 708
Score = 40.1 bits (20), Expect = 0.26
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 60 ccaccatgactcccagcttttctctggt 87
|||||||||||||||||| || ||||||
Sbjct: 253 ccaccatgactcccagctcttttctggt 226
>gb|CN127234.1|CN127234 RHOH1_21_G03.g3_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_21_G03_A002 5', mRNA sequence
Length = 809
Score = 40.1 bits (20), Expect = 0.26
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 60 ccaccatgactcccagcttttctctggt 87
|||||||||||||||||| || ||||||
Sbjct: 266 ccaccatgactcccagctcttttctggt 239
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 148,627
Number of Sequences: 832831
Number of extensions: 148627
Number of successful extensions: 38416
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38396
Number of HSP's gapped (non-prelim): 19
length of query: 690
length of database: 491,359,669
effective HSP length: 19
effective length of query: 671
effective length of database: 475,535,880
effective search space: 319084575480
effective search space used: 319084575480
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)