BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAT2e04.yg.2.1
(424 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN127712.1|CN127712 RHOH1_24_D05.g3_A002 Acid- and alkal... 192 2e-047
gb|CW044337.1|CW044337 104_280_10508891_115_30242 Sorghum m... 52 4e-005
gb|CW098045.1|CW098045 104_464_11002794_116_34363_073 Sorgh... 52 4e-005
gb|AF466200.2| Sorghum bicolor putative protein kinase gene... 52 4e-005
gb|CW173784.1|CW173784 104_585_11157034_148_36551_037 Sorgh... 40 0.16
gb|CW486925.1|CW486925 fsbb001f252h17f0 Sorghum methylation... 40 0.16
gb|CB927845.1|CB927845 ABA1_34_E09.g1_A012 Abscisic acid-tr... 40 0.16
>gb|CN127712.1|CN127712 RHOH1_24_D05.g3_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_24_D05_A002 5', mRNA sequence
Length = 844
Score = 192 bits (97), Expect = 2e-047
Identities = 136/149 (91%)
Strand = Plus / Plus
Query: 276 tttggagacatagtcattctgccgttcatcgaccggtatgagctagtggttctgaaaacg 335
||||||||||||||||||||||| || || |||||||||||||| ||||||||||| ||
Sbjct: 2 tttggagacatagtcattctgccatttatggaccggtatgagctggtggttctgaagaca 61
Query: 336 gttgcgatatgtcaatacggggtgcacaatgtcactgcagattacatcatgaagtgcgac 395
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 62 gttgcgctatgtcaatacggggtgcaaaatgtcactgcagattacatcatgaagtgtgat 121
Query: 396 gatgacacctttgtgcggctggatatagt 424
|| |||||||||||| |||||||| ||||
Sbjct: 122 gacgacacctttgtgaggctggatgtagt 150
>gb|CW044337.1|CW044337 104_280_10508891_115_30242 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10508891, DNA
sequence
Length = 561
Score = 52.0 bits (26), Expect = 4e-005
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 255 ctgaagaaggaagcagagtattttggagacatagtcattctgccgttcatcgaccggtat 314
|||||||| |||||||| || ||||||||||| |||||| |||| || || || || |||
Sbjct: 113 ctgaagaaagaagcagaatactttggagacattgtcattttgccatttatagatcgctat 172
Query: 315 gagctagtggttct 328
||||| || |||||
Sbjct: 173 gagctggttgttct 186
>gb|CW098045.1|CW098045 104_464_11002794_116_34363_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11002794, DNA
sequence
Length = 593
Score = 52.0 bits (26), Expect = 4e-005
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 255 ctgaagaaggaagcagagtattttggagacatagtcattctgccgttcatcgaccggtat 314
|||||||| |||||||| || ||||||||||| |||||| |||| || || || || |||
Sbjct: 342 ctgaagaaagaagcagaatactttggagacattgtcattttgccatttatagatcgctat 401
Query: 315 gagctagtggttct 328
||||| || |||||
Sbjct: 402 gagctggttgttct 415
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2,
fertilization-independent endosperm proteins, hypothetical
protein, putative non-LTR retroelement reverse
transcriptase, OCL5 protein, tryptophan synthase
beta-subunit, hypothetical proteins, putative AP
endonuclease, putative RNA polymerase II complex component
SRB7, putative beta-1,3-glucanase, hypothetical protein,
TNP2-like protein, hypothetical protein, putative
phosphate/phosphoenolpyruvate translocator, putative
protein, hypothetical proteins, putative
galactosyltransferase family, hypothetical protein,
putative cytochrome P450 family, putative lipid transfer
protein, putative photoreceptor-interacting protein, and
hypothetical protein genes, complete cds; and hypothetical
protein gene, partial cds
Length = 202197
Score = 52.0 bits (26), Expect = 4e-005
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 255 ctgaagaaggaagcagagtattttggagacatagtcattctgccgttcatcgaccggtat 314
|||||||| |||||||| || ||||||||||| |||||| |||| || || || || |||
Sbjct: 170178 ctgaagaaagaagcagaatactttggagacattgtcattttgccatttatagatcgctat 170237
Query: 315 gagctagtggttct 328
||||| || |||||
Sbjct: 170238 gagctggttgttct 170251
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 379 acatcatgaagtgcgacgatgacacctttgtg 410
|||||||||| ||||||||||| || ||||||
Sbjct: 170619 acatcatgaaatgcgacgatgatacatttgtg 170650
>gb|CW173784.1|CW173784 104_585_11157034_148_36551_037 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11157034, DNA
sequence
Length = 683
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 379 acatcatgaagtgcgacgatgacacctttgtg 410
|||||||||| ||||||||||| || ||||||
Sbjct: 242 acatcatgaaatgcgacgatgatacatttgtg 273
>gb|CW486925.1|CW486925 fsbb001f252h17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f252h17, DNA
sequence
Length = 703
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 379 acatcatgaagtgcgacgatgacacctttgtg 410
|||||||||| ||||||||||| || ||||||
Sbjct: 36 acatcatgaaatgcgacgatgatacatttgtg 67
>gb|CB927845.1|CB927845 ABA1_34_E09.g1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_34_E09_A012 5', mRNA sequence
Length = 585
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 acgcaacagcgcttccaaag 20
||||||||||||||||||||
Sbjct: 384 acgcaacagcgcttccaaag 365
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 93,748
Number of Sequences: 832831
Number of extensions: 93748
Number of successful extensions: 24718
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24699
Number of HSP's gapped (non-prelim): 19
length of query: 424
length of database: 491,359,669
effective HSP length: 19
effective length of query: 405
effective length of database: 475,535,880
effective search space: 192592031400
effective search space used: 192592031400
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)