BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAS4c05.yg.2.1
(318 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW111186.1|CW111186 104_484_11104164_116_34532_042 Sorgh... 272 2e-071
gb|CW111187.1|CW111187 104_484_11104164_148_34528_042 Sorgh... 272 2e-071
gb|CW274351.1|CW274351 104_747_11404381_148_35370_059 Sorgh... 272 2e-071
gb|CW349038.1|CW349038 fsbb001f009l06f0 Sorghum methylation... 117 6e-025
gb|CL704815.2|CL704815 SP__Bb0029E23.r SP__Bb Sorghum propi... 52 3e-005
gb|CL188049.1|CL188049 104_404_10901323_114_32444_078 Sorgh... 42 0.030
gb|CW030122.1|CW030122 104_258_10500073_116_30404 Sorghum m... 42 0.030
gb|CW273083.1|CW273083 104_745_11403708_116_35718_040 Sorgh... 42 0.030
gb|CW275353.1|CW275353 104_748_11404918_148_35383_085 Sorgh... 42 0.030
gb|BG411856.1|BG411856 OV2_39_A04.g1_A002 Ovary 2 (OV2) Sor... 42 0.030
>gb|CW111186.1|CW111186 104_484_11104164_116_34532_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104164, DNA
sequence
Length = 653
Score = 272 bits (137), Expect = 2e-071
Identities = 178/195 (91%)
Strand = Plus / Plus
Query: 1 acacctcgctgccgctgccacagatgagggcgtcgaagtcggnngctgggatcttgccga 60
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 177 acacctcgctgccactgccacagatgagggcgtcgaagtcggtcgctgggatcttgccga 236
Query: 61 gctgcagaagctggagtgtctcggacaacggcatggcannngacagcgtgaaccctgaga 120
||| |||||||||||||||||||||||||||||| ||| ||||||| |||||||||||
Sbjct: 237 gcttcagaagctggagtgtctcggacaacggcatcgcagttgacagcgcgaaccctgaga 296
Query: 121 tcttgaacatctgggagtccgatcggactnnnctgaaaacttcctngatcacctgcanca 180
||||| |||||||||||||||| |||||| ||||||||||| | ||||||||||| ||
Sbjct: 297 tcttggacatctgggagtccgaccggactgctctgaaaacttcttggatcacctgcagca 356
Query: 181 tcttcttgctagcac 195
|||||||||||||||
Sbjct: 357 tcttcttgctagcac 371
>gb|CW111187.1|CW111187 104_484_11104164_148_34528_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104164, DNA
sequence
Length = 646
Score = 272 bits (137), Expect = 2e-071
Identities = 178/195 (91%)
Strand = Plus / Minus
Query: 1 acacctcgctgccgctgccacagatgagggcgtcgaagtcggnngctgggatcttgccga 60
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 613 acacctcgctgccactgccacagatgagggcgtcgaagtcggtcgctgggatcttgccga 554
Query: 61 gctgcagaagctggagtgtctcggacaacggcatggcannngacagcgtgaaccctgaga 120
||| |||||||||||||||||||||||||||||| ||| ||||||| |||||||||||
Sbjct: 553 gcttcagaagctggagtgtctcggacaacggcatcgcagttgacagcgcgaaccctgaga 494
Query: 121 tcttgaacatctgggagtccgatcggactnnnctgaaaacttcctngatcacctgcanca 180
||||| |||||||||||||||| |||||| ||||||||||| | ||||||||||| ||
Sbjct: 493 tcttggacatctgggagtccgaccggactgctctgaaaacttcttggatcacctgcagca 434
Query: 181 tcttcttgctagcac 195
|||||||||||||||
Sbjct: 433 tcttcttgctagcac 419
>gb|CW274351.1|CW274351 104_747_11404381_148_35370_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11404381, DNA
sequence
Length = 712
Score = 272 bits (137), Expect = 2e-071
Identities = 178/195 (91%)
Strand = Plus / Plus
Query: 1 acacctcgctgccgctgccacagatgagggcgtcgaagtcggnngctgggatcttgccga 60
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 331 acacctcgctgccactgccacagatgagggcgtcgaagtcggtcgctgggatcttgccga 390
Query: 61 gctgcagaagctggagtgtctcggacaacggcatggcannngacagcgtgaaccctgaga 120
||| |||||||||||||||||||||||||||||| ||| ||||||| |||||||||||
Sbjct: 391 gcttcagaagctggagtgtctcggacaacggcatcgcagttgacagcgcgaaccctgaga 450
Query: 121 tcttgaacatctgggagtccgatcggactnnnctgaaaacttcctngatcacctgcanca 180
||||| |||||||||||||||| |||||| ||||||||||| | ||||||||||| ||
Sbjct: 451 tcttggacatctgggagtccgaccggactgctctgaaaacttcttggatcacctgcagca 510
Query: 181 tcttcttgctagcac 195
|||||||||||||||
Sbjct: 511 tcttcttgctagcac 525
>gb|CW349038.1|CW349038 fsbb001f009l06f0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f009l06, DNA
sequence
Length = 741
Score = 117 bits (59), Expect = 6e-025
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 1 acacctcgctgccgctgccacagatgagggcgtcgaagtcggnngctgggatcttgccga 60
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 73 acacctcgctgccactgccacagatgagggcgtcgaagtcggtcgctgggatcttgccga 14
Query: 61 gctgcagaagctg 73
||| |||||||||
Sbjct: 13 gcttcagaagctg 1
>gb|CL704815.2|CL704815 SP__Bb0029E23.r SP__Bb Sorghum propinquum genomic clone
SP__Bb0029E23 3', DNA sequence
Length = 500
Score = 52.0 bits (26), Expect = 3e-005
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 167 gatcacctgcancatcttcttgctagcac 195
||||||||||| |||||||||||||||||
Sbjct: 494 gatcacctgcagcatcttcttgctagcac 466
>gb|CL188049.1|CL188049 104_404_10901323_114_32444_078 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10901323, DNA
sequence
Length = 687
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 56 gccgagctgcagaagctggag 76
|||||||||||||||||||||
Sbjct: 242 gccgagctgcagaagctggag 222
>gb|CW030122.1|CW030122 104_258_10500073_116_30404 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10500073,
DNA sequence
Length = 664
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 56 gccgagctgcagaagctggag 76
|||||||||||||||||||||
Sbjct: 55 gccgagctgcagaagctggag 35
>gb|CW273083.1|CW273083 104_745_11403708_116_35718_040 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11403708, DNA
sequence
Length = 684
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 56 gccgagctgcagaagctggag 76
|||||||||||||||||||||
Sbjct: 503 gccgagctgcagaagctggag 483
>gb|CW275353.1|CW275353 104_748_11404918_148_35383_085 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11404918, DNA
sequence
Length = 664
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 56 gccgagctgcagaagctggag 76
|||||||||||||||||||||
Sbjct: 414 gccgagctgcagaagctggag 434
>gb|BG411856.1|BG411856 OV2_39_A04.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 460
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 56 gccgagctgcagaagctggag 76
|||||||||||||||||||||
Sbjct: 146 gccgagctgcagaagctggag 166
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 46,581
Number of Sequences: 832831
Number of extensions: 46581
Number of successful extensions: 14285
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14271
Number of HSP's gapped (non-prelim): 14
length of query: 318
length of database: 491,359,669
effective HSP length: 19
effective length of query: 299
effective length of database: 475,535,880
effective search space: 142185228120
effective search space used: 142185228120
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)