BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN24c09.yg.2.1
(425 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX618063.1|CX618063 GABR1_37_B05.g1_A002 GA- or brassino... 385 e-105
gb|CW140470.1|CW140470 104_531_11135797_116_34926_063 Sorgh... 325 2e-087
gb|CF433027.1|CF433027 NIT1_20_E12.g1_A002 Nitrogen-deficie... 250 9e-065
gb|BF480979.1|BF480979 FM1_15_G12.g1_A003 Floral-Induced Me... 244 5e-063
gb|BG050984.1|BG050984 FM1_55_A02.b1_A003 Floral-Induced Me... 155 4e-036
gb|BE362654.1|BE362654 DG1_88_F12.b1_A002 Dark Grown 1 (DG1... 101 5e-020
gb|BG101839.1|BG101839 RHIZ2_23_A10.g1_A003 Rhizome2 (RHIZ2... 94 1e-017
gb|BG103131.1|BG103131 RHIZ2_18_E07.g1_A003 Rhizome2 (RHIZ2... 84 1e-014
gb|CN127278.1|CN127278 RHOH1_22_C03.b1_A002 Acid- and alkal... 84 1e-014
gb|CN128917.1|CN128917 RHOH1_32_H10.b1_A002 Acid- and alkal... 84 1e-014
gb|CL148485.1|CL148485 104_328_10593130_116_31783_254 Sorgh... 78 7e-013
gb|CL148486.1|CL148486 104_328_10593130_148_31782_254 Sorgh... 78 7e-013
gb|CW385345.1|CW385345 fsbb001f068m13k0 Sorghum methylation... 78 7e-013
gb|AW744882.1|AW744882 LG1_384_E04.b1_A002 Light Grown 1 (L... 78 7e-013
gb|BE918058.1|BE918058 OV1_1_D06.b1_A002 Ovary 1 (OV1) Sorg... 78 7e-013
gb|BE918108.1|BE918108 OV1_2_A10.b1_A002 Ovary 1 (OV1) Sorg... 78 7e-013
gb|BG048793.1|BG048793 OV1_23_B06.b1_A002 Ovary 1 (OV1) Sor... 78 7e-013
gb|CN129247.1|CN129247 RHOH1_34_G09.b3_A002 Acid- and alkal... 78 7e-013
gb|CW148394.1|CW148394 104_547_11141932_116_35015_016 Sorgh... 76 3e-012
gb|CW148395.1|CW148395 104_547_11141932_148_35011_016 Sorgh... 76 3e-012
gb|CW213542.1|CW213542 104_645_11191609_148_37039_013 Sorgh... 76 3e-012
gb|CD423905.1|CD423905 SA1_2_G12.b1_A002 Salicylic acid-tre... 76 3e-012
gb|CF433703.1|CF433703 NIT1_28_F11.g1_A002 Nitrogen-deficie... 74 1e-011
gb|BG240580.1|BG240580 OV1_31_F08.b1_A002 Ovary 1 (OV1) Sor... 68 7e-010
gb|CW164547.1|CW164547 104_572_11152044_148_36463_038 Sorgh... 64 1e-008
gb|CW224629.1|CW224629 104_662_11203928_148_37201_032 Sorgh... 64 1e-008
gb|CW296110.1|CW296110 104_777_11461315_148_35624_068 Sorgh... 64 1e-008
gb|CW430835.1|CW430835 fsbb001f144l18k0 Sorghum methylation... 64 1e-008
gb|CW496561.1|CW496561 fsbb001f288o02f0 Sorghum methylation... 64 1e-008
gb|CW235188.1|CW235188 104_690_11214849_116_37409_041 Sorgh... 62 4e-008
gb|CL167974.1|CL167974 104_365_10810478_114_31804_158 Sorgh... 56 3e-006
gb|CW031320.1|CW031320 104_259_10500738_116_30398 Sorghum m... 56 3e-006
gb|CW235189.1|CW235189 104_690_11214849_148_37413_041 Sorgh... 56 3e-006
gb|CW315001.1|CW315001 104_805_11472128_148_35822_018 Sorgh... 56 3e-006
gb|CW315969.1|CW315969 104_807_11472644_148_35845_076 Sorgh... 56 3e-006
gb|BE357339.1|BE357339 DG1_148_D12.g1_A002 Dark Grown 1 (DG... 56 3e-006
gb|BE357401.1|BE357401 DG1_15_D04.b2_A002 Dark Grown 1 (DG1... 56 3e-006
gb|BI141114.1|BI141114 IP1_43_D01.b1_A002 Immature pannicle... 56 3e-006
gb|CF430024.1|CF430024 PH1_25_C04.g1_A002 Phosphorous-defic... 56 3e-006
gb|CN132882.1|CN132882 OX1_8_F12.g1_A002 Oxidatively-stress... 54 1e-005
gb|BG465791.1|BG465791 RHIZ2_48_F08.b1_A003 Rhizome2 (RHIZ2... 50 2e-004
gb|BF481250.1|BF481250 FM1_17_E01.b1_A003 Floral-Induced Me... 48 7e-004
gb|BG948058.1|BG948058 IP1_8_G12.b1_A002 Immature pannicle ... 48 7e-004
gb|BI074863.1|BI074863 IP1_16_A11.b1_A002 Immature pannicle... 48 7e-004
gb|BI245956.1|BI245956 IP1_65_G03.b1_A002 Immature pannicle... 48 7e-004
gb|CW481819.1|CW481819 fsbb001f241j14k0 Sorghum methylation... 46 0.003
gb|CF072057.1|CF072057 FE1_20_C10.b1_A002 Iron-deficient se... 44 0.010
gb|CW417878.1|CW417878 fsbb001f121b11k0 Sorghum methylation... 42 0.040
gb|BM330327.1|BM330327 PIC1_50_E03.g1_A002 Pathogen-infecte... 42 0.040
gb|CF070973.1|CF070973 FE1_14_E09.g1_A002 Iron-deficient se... 42 0.040
gb|CF070999.1|CF070999 FE1_14_D09.g1_A002 Iron-deficient se... 42 0.040
gb|CN125914.1|CN125914 RHOH1_14_D01.b1_A002 Acid- and alkal... 42 0.040
gb|CL192038.1|CL192038 104_414_10939961_114_32247_071 Sorgh... 40 0.16
gb|CW413531.1|CW413531 fsbb001f112l18f0 Sorghum methylation... 40 0.16
gb|BI140990.1|BI140990 IP1_41_G10.b1_A002 Immature pannicle... 40 0.16
>gb|CX618063.1|CX618063 GABR1_37_B05.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_37_B05_A002 5', mRNA sequence
Length = 728
Score = 385 bits (194), Expect = e-105
Identities = 234/250 (93%)
Strand = Plus / Plus
Query: 155 tgaacaatgttgccagcctgtggttcatgtcactttttatctgcatttttgctacaagca 214
|||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 260 tgaataatgttgccagcctgtggttcatgtcactctttatttgcatttttgctacaagca 319
Query: 215 tcctnnnaatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttct 274
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 320 tcctagaaatgagatggagtggtgttggaattgatgattggtggaggaatgagcagttct 379
Query: 275 gggtcattggaggtgtgtcctcgcacctcttcgctgtgtttcagggacttctcnnggtca 334
||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||
Sbjct: 380 gggtcattggaggtgtgtcctcgcacctctttgctgtgttccagggacttctcaaggtca 439
Query: 335 tagctggtgttgatacaagctncactnngacatcaaagggtggagatgatgacgaattct 394
||||||||||||||||||||| |||| |||||||||||||||||||||||| || ||||
Sbjct: 440 tagctggtgttgatacaagcttcactgtgacatcaaagggtggagatgatgaggagttct 499
Query: 395 cagagctgta 404
||||||||||
Sbjct: 500 cagagctgta 509
Score = 87.7 bits (44), Expect = 8e-016
Identities = 47/48 (97%)
Strand = Plus / Plus
Query: 1 acattgcctgccatctgtttattgacggggaaatttatcactccagag 48
|||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 211 acattgcctgccatttgtttattgacggggaaatttatcactccagag 258
>gb|CW140470.1|CW140470 104_531_11135797_116_34926_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135797, DNA
sequence
Length = 540
Score = 325 bits (164), Expect = 2e-087
Identities = 239/266 (89%)
Strand = Plus / Plus
Query: 95 tatagttttgtttgttgtggaatgtctgaaccttatgttcactgtttcatctgctgcagc 154
|||||| |||| |||||||||||| ||||| ||||||| |||||||||||||||||||
Sbjct: 270 tatagtattgtatgttgtggaatgcctgaatcttatgtgcactgtttcatctgctgcact 329
Query: 155 tgaacaatgttgccagcctgtggttcatgtcactttttatctgcatttttgctacaagca 214
|||| |||||| ||||| |||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 330 tgaataatgttaccagcatgtggttcatgtcactctttatttgcatttttgctacaagca 389
Query: 215 tcctnnnaatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttct 274
| || ||||| ||||| ||||||||| |||||||||||||||||||||||||||||||
Sbjct: 390 tactacaaatgacatggactggtgttggaattgatgattggtggaggaatgagcagttct 449
Query: 275 gggtcattggaggtgtgtcctcgcacctcttcgctgtgtttcagggacttctcnnggtca 334
||||||||||||||||||||||||||||||| |||||||| || ||||||||| |||||
Sbjct: 450 gggtcattggaggtgtgtcctcgcacctctttgctgtgttccaaggacttctcaaggtca 509
Query: 335 tagctggtgttgatacaagctncact 360
|||| || ||||||||||||| ||||
Sbjct: 510 tagcaggagttgatacaagcttcact 535
Score = 89.7 bits (45), Expect = 2e-016
Identities = 51/53 (96%)
Strand = Plus / Plus
Query: 1 acattgcctgccatctgtttattgacggggaaatttatcactccagaggtaaa 53
|||||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 201 acattgcctgccatttgtttattgacgggaaaatttatcactccagaggtaaa 253
>gb|CF433027.1|CF433027 NIT1_20_E12.g1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_20_E12_A002 5', mRNA sequence
Length = 436
Score = 250 bits (126), Expect = 9e-065
Identities = 144/151 (95%)
Strand = Plus / Plus
Query: 155 tgaacaatgttgccagcctgtggttcatgtcactttttatctgcatttttgctacaagca 214
|||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 282 tgaataatgttgccagcctgtggttcatgtcactctttatttgcatttttgctacaagca 341
Query: 215 tcctnnnaatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttct 274
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 342 tcctagaaatgagatggagtggtgttggaattgatgattggtggaggaatgagcagttct 401
Query: 275 gggtcattggaggtgtgtcctcgcacctctt 305
|||||||||||||||||||||||||||||||
Sbjct: 402 gggtcattggaggtgtgtcctcgcacctctt 432
Score = 87.7 bits (44), Expect = 8e-016
Identities = 47/48 (97%)
Strand = Plus / Plus
Query: 1 acattgcctgccatctgtttattgacggggaaatttatcactccagag 48
|||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 233 acattgcctgccatttgtttattgacggggaaatttatcactccagag 280
>gb|BF480979.1|BF480979 FM1_15_G12.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 721
Score = 244 bits (123), Expect = 5e-063
Identities = 222/255 (87%), Gaps = 2/255 (0%)
Strand = Plus / Plus
Query: 152 agctgaacaatgttgccagcctgtggtt-catgtcactttttatctgcatttttgctaca 210
|||| ||||||||||||||| | ||||| ||||||||||||||||||||||||||||||
Sbjct: 10 agcttaacaatgttgccagc-tctggtttcatgtcactttttatctgcatttttgctacg 68
Query: 211 agcatcctnnnaatgagatggagtggtgttgggattgatgattggtggaggaatgagcag 270
|||||||| |||||||||||||||||| || || |||||||||||||| |||||||||
Sbjct: 69 agcatcctggaaatgagatggagtggtgtaggcatcgatgattggtggagaaatgagcag 128
Query: 271 ttctgggtcattggaggtgtgtcctcgcacctcttcgctgtgtttcagggacttctcnng 330
|| |||||||||||||||||||| || || ||||| |||||||| || ||||| ||| |
Sbjct: 129 ttttgggtcattggaggtgtgtcttcacatctctttgctgtgttccaaggactcctcaag 188
Query: 331 gtcatagctggtgttgatacaagctncactnngacatcaaagggtggagatgatgacgaa 390
|||||||||||||| || || |||| |||| |||||| ||||||||||| || || ||
Sbjct: 189 gtcatagctggtgtagacacgagcttcactgtgacatccaagggtggagacgacgaggag 248
Query: 391 ttctcagagctgtac 405
|||||||||||||||
Sbjct: 249 ttctcagagctgtac 263
>gb|BG050984.1|BG050984 FM1_55_A02.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 362
Score = 155 bits (78), Expect = 4e-036
Identities = 148/173 (85%)
Strand = Plus / Plus
Query: 233 gtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgt 292
||||||| || || |||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 9 gtggtgtaggcatcgatgattggtggagaaatgagcagttttgggtcattggaggtgtgt 68
Query: 293 cctcgcacctcttcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaa 352
| || || ||||| |||||||| || ||||| ||| ||||||||||||||| || || |
Sbjct: 69 cttcacatctctttgctgtgttccaaggactcctcaaggtcatagctggtgtagacacga 128
Query: 353 gctncactnngacatcaaagggtggagatgatgacgaattctcagagctgtac 405
||| |||| |||||| ||||||||||| || || || |||||||||||||||
Sbjct: 129 gcttcactgtgacatccaagggtggagacgacgaggagttctcagagctgtac 181
>gb|BE362654.1|BE362654 DG1_88_F12.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 548
Score = 101 bits (51), Expect = 5e-020
Identities = 117/140 (83%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctacaagcatcctnnnaatgagatggagt 234
||||||||| ||||||| ||||||||| || || ||||||| |||||||||||||
Sbjct: 401 tggttcatggcacttttcatctgcattgctgtcaccggcatccttgaaatgagatggagt 460
Query: 235 ggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcc 294
||||| | || ||||| |||||||| || |||||||||||||||||||||||||| |||
Sbjct: 461 ggtgtggccatcgatgactggtggagaaacgagcagttctgggtcattggaggtgtttcc 520
Query: 295 tcgcacctcttcgctgtgtt 314
| || |||||||| |||||
Sbjct: 521 gcacatctcttcgcggtgtt 540
Score = 50.1 bits (25), Expect = 2e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 4 ttgcctgccatctgtttattgacggggaaatttatcactccagag 48
||||||||||||||| | | ||||||||||||||||| ||||||
Sbjct: 335 ttgcctgccatctgtctgctcacggggaaatttatcacaccagag 379
>gb|BG101839.1|BG101839 RHIZ2_23_A10.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 647
Score = 93.7 bits (47), Expect = 1e-017
Identities = 98/116 (84%)
Strand = Plus / Plus
Query: 212 gcatcctnnnaatgagatggagtggtgttgggattgatgattggtggaggaatgagcagt 271
||||||| |||||||||||||||||| | || ||||| |||||||| || |||||||
Sbjct: 26 gcatccttgaaatgagatggagtggtgtggccatcgatgactggtggagaaacgagcagt 85
Query: 272 tctgggtcattggaggtgtgtcctcgcacctcttcgctgtgtttcagggacttctc 327
||||||||||||||||||| ||| | || |||||||| ||||| || || ||||||
Sbjct: 86 tctgggtcattggaggtgtttccgcacatctcttcgcggtgttccaaggccttctc 141
>gb|BG103131.1|BG103131 RHIZ2_18_E07.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 669
Score = 83.8 bits (42), Expect = 1e-014
Identities = 60/66 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| || ||||||||||||
Sbjct: 55 atgaggtggagtggtgttggaattgacgagtggtggaggaatgaacaattctgggtcatt 114
Query: 283 ggaggt 288
||||||
Sbjct: 115 ggaggt 120
>gb|CN127278.1|CN127278 RHOH1_22_C03.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_22_C03_A002 3', mRNA sequence
Length = 857
Score = 83.8 bits (42), Expect = 1e-014
Identities = 60/66 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| || ||||||||||||
Sbjct: 6 atgaggtggagtggtgttggaattgacgagtggtggaggaatgaacaattctgggtcatt 65
Query: 283 ggaggt 288
||||||
Sbjct: 66 ggaggt 71
>gb|CN128917.1|CN128917 RHOH1_32_H10.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_32_H10_A002 3', mRNA sequence
Length = 785
Score = 83.8 bits (42), Expect = 1e-014
Identities = 60/66 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| || ||||||||||||
Sbjct: 2 atgaggtggagtggtgttggaattgacgagtggtggaggaatgaacaattctgggtcatt 61
Query: 283 ggaggt 288
||||||
Sbjct: 62 ggaggt 67
>gb|CL148485.1|CL148485 104_328_10593130_116_31783_254 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10593130, DNA
sequence
Length = 591
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 123 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 181
>gb|CL148486.1|CL148486 104_328_10593130_148_31782_254 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10593130, DNA
sequence
Length = 638
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Minus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 622 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 564
>gb|CW385345.1|CW385345 fsbb001f068m13k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f068m13, DNA
sequence
Length = 659
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 89 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 147
>gb|AW744882.1|AW744882 LG1_384_E04.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 589
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 263 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 321
>gb|BE918058.1|BE918058 OV1_1_D06.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA sequence
Length = 610
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 327 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 385
>gb|BE918108.1|BE918108 OV1_2_A10.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA sequence
Length = 598
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 327 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 385
>gb|BG048793.1|BG048793 OV1_23_B06.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 420
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 343 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 401
>gb|CN129247.1|CN129247 RHOH1_34_G09.b3_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_34_G09_A002 3', mRNA sequence
Length = 774
Score = 77.8 bits (39), Expect = 7e-013
Identities = 54/59 (91%)
Strand = Plus / Plus
Query: 226 agatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 28 agatggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 86
>gb|CW148394.1|CW148394 104_547_11141932_116_35015_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11141932, DNA
sequence
Length = 668
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| ||||||||||| |||||||| ||||| |||
Sbjct: 455 atgaggtggagtggtgttggcattgatgaatggtggaggaacgagcagttttgggttatt 514
Query: 283 gg 284
||
Sbjct: 515 gg 516
>gb|CW148395.1|CW148395 104_547_11141932_148_35011_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11141932, DNA
sequence
Length = 621
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| ||||||||||| |||||||| ||||| |||
Sbjct: 547 atgaggtggagtggtgttggcattgatgaatggtggaggaacgagcagttttgggttatt 488
Query: 283 gg 284
||
Sbjct: 487 gg 486
>gb|CW213542.1|CW213542 104_645_11191609_148_37039_013 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11191609, DNA
sequence
Length = 289
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| ||||||||||| |||||||| ||||| |||
Sbjct: 144 atgaggtggagtggtgttggcattgatgaatggtggaggaacgagcagttttgggttatt 203
Query: 283 gg 284
||
Sbjct: 204 gg 205
>gb|CD423905.1|CD423905 SA1_2_G12.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_2_G12_A002 3', mRNA sequence
Length = 743
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| ||||||||||| |||||||| ||||| |||
Sbjct: 51 atgaggtggagtggtgttggcattgatgaatggtggaggaacgagcagttttgggttatt 110
Query: 283 gg 284
||
Sbjct: 111 gg 112
>gb|CF433703.1|CF433703 NIT1_28_F11.g1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_28_F11_A002 5', mRNA sequence
Length = 452
Score = 73.8 bits (37), Expect = 1e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 305 atggagtggtgttggcattgaagattggtggagaaatgagcagttttgggttattgg 361
>gb|BG240580.1|BG240580 OV1_31_F08.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 538
Score = 67.9 bits (34), Expect = 7e-010
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
|||||||||||||||| ||||| || |||||||| ||||| ||||| |||||||||||
Sbjct: 99 gatggagtggtgttggcattgaggactggtggagaaatgaacagttttgggtcattgg 156
>gb|CW164547.1|CW164547 104_572_11152044_148_36463_038 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152044, DNA
sequence
Length = 606
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcac 300
|||||||| || |||||| | || ||||||||||||||||| ||||| |||||| | |||
Sbjct: 436 gggattgaggactggtggcgcaacgagcagttctgggtcatcggaggcgtgtccgcccac 377
Query: 301 ctcttcgctgtgtttcaggg 320
|| ||||| ||||| |||||
Sbjct: 376 ctgttcgccgtgttccaggg 357
>gb|CW224629.1|CW224629 104_662_11203928_148_37201_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11203928, DNA
sequence
Length = 714
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcac 300
|||||||| || |||||| | || ||||||||||||||||| ||||| |||||| | |||
Sbjct: 433 gggattgaggactggtggcgcaacgagcagttctgggtcatcggaggcgtgtccgcccac 374
Query: 301 ctcttcgctgtgtttcaggg 320
|| ||||| ||||| |||||
Sbjct: 373 ctgttcgccgtgttccaggg 354
>gb|CW296110.1|CW296110 104_777_11461315_148_35624_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11461315, DNA
sequence
Length = 684
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcac 300
|||||||| || |||||| | || ||||||||||||||||| ||||| |||||| | |||
Sbjct: 176 gggattgaggactggtggcgcaacgagcagttctgggtcatcggaggcgtgtccgcccac 117
Query: 301 ctcttcgctgtgtttcaggg 320
|| ||||| ||||| |||||
Sbjct: 116 ctgttcgccgtgttccaggg 97
>gb|CW430835.1|CW430835 fsbb001f144l18k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f144l18, DNA
sequence
Length = 552
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcac 300
|||||||| || |||||| | || ||||||||||||||||| ||||| |||||| | |||
Sbjct: 296 gggattgaggactggtggcgcaacgagcagttctgggtcatcggaggcgtgtccgcccac 355
Query: 301 ctcttcgctgtgtttcaggg 320
|| ||||| ||||| |||||
Sbjct: 356 ctgttcgccgtgttccaggg 375
>gb|CW496561.1|CW496561 fsbb001f288o02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f288o02, DNA
sequence
Length = 628
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcac 300
|||||||| || |||||| | || ||||||||||||||||| ||||| |||||| | |||
Sbjct: 131 gggattgaggactggtggcgcaacgagcagttctgggtcatcggaggcgtgtccgcccac 72
Query: 301 ctcttcgctgtgtttcaggg 320
|| ||||| ||||| |||||
Sbjct: 71 ctgttcgccgtgttccaggg 52
>gb|CW235188.1|CW235188 104_690_11214849_116_37409_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214849, DNA
sequence
Length = 601
Score = 61.9 bits (31), Expect = 4e-008
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgctgt 311
||||||||||| ||||||||||||||||| || || ||||| |||| |||||||||||
Sbjct: 528 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgctgt 470
>gb|CL167974.1|CL167974 104_365_10810478_114_31804_158 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810478, DNA
sequence
Length = 777
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 128 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 183
>gb|CW031320.1|CW031320 104_259_10500738_116_30398 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10500738, DNA
sequence
Length = 854
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 609 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 554
>gb|CW235189.1|CW235189 104_690_11214849_148_37413_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214849, DNA
sequence
Length = 686
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 334 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 389
>gb|CW315001.1|CW315001 104_805_11472128_148_35822_018 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11472128, DNA
sequence
Length = 685
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 88 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 143
>gb|CW315969.1|CW315969 104_807_11472644_148_35845_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11472644, DNA
sequence
Length = 726
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 503 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 558
>gb|BE357339.1|BE357339 DG1_148_D12.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 505
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 126 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 181
>gb|BE357401.1|BE357401 DG1_15_D04.b2_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 552
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 485 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 540
>gb|BI141114.1|BI141114 IP1_43_D01.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 412
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 290 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 345
>gb|CF430024.1|CF430024 PH1_25_C04.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_25_C04_A002 5', mRNA sequence
Length = 789
Score = 56.0 bits (28), Expect = 3e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgc 308
||||||||||| ||||||||||||||||| || || ||||| |||| ||||||||
Sbjct: 565 tggtggaggaacgagcagttctgggtcatcggcggcgtgtcggcgcatctcttcgc 620
>gb|CN132882.1|CN132882 OX1_8_F12.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_8_F12_A002 5', mRNA sequence
Length = 704
Score = 54.0 bits (27), Expect = 1e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 265 gagcagttctgggtcattggaggtgtgtcctcgcacctcttcgctgtgtttcagggactt 324
|||||||||||||||||||||||||| ||| | || |||||| | ||||| || || |||
Sbjct: 362 gagcagttctgggtcattggaggtgtttccgcacatctcttcacggtgttccaaggcctt 421
Query: 325 ctc 327
|||
Sbjct: 422 ctc 424
Score = 50.1 bits (25), Expect = 2e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 4 ttgcctgccatctgtttattgacggggaaatttatcactccagag 48
||||||||||||||| | | ||||||||||||||||| ||||||
Sbjct: 206 ttgcctgccatctgtctgctcacggggaaatttatcacaccagag 250
Score = 48.1 bits (24), Expect = 7e-004
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctacaagcatcctnnnaatgagatggagt 234
||||||||| ||||||| ||||||||| || || ||||||| |||||||||||||
Sbjct: 272 tggttcatggcacttttcatctgcattgctgtcaccggcatccttgaaatgagatggagt 331
Query: 235 ggtgt 239
|||||
Sbjct: 332 ggtgt 336
>gb|BG465791.1|BG465791 RHIZ2_48_F08.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 614
Score = 50.1 bits (25), Expect = 2e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 4 ttgcctgccatctgtttattgacggggaaatttatcactccagag 48
||||||||||||||| | | ||||||||||||||||| ||||||
Sbjct: 499 ttgcctgccatctgtctgctcacggggaaatttatcacaccagag 543
>gb|BF481250.1|BF481250 FM1_17_E01.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 412
Score = 48.1 bits (24), Expect = 7e-004
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 353 gctncactnngacatcaaagggtggagatgatgacgaattctcagagctgtac 405
||| |||| |||||| ||||||||||| || || || |||||||||||||||
Sbjct: 8 gcttcactgtgacatccaagggtggagacgacgaggagttctcagagctgtac 60
>gb|BG948058.1|BG948058 IP1_8_G12.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 597
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgctgtg 312
|||||| |||| |||||||||||||| || || || ||||| ||||||| ||||| |||
Sbjct: 158 tggtggcggaacgagcagttctgggtgatcggcggcgtgtcggcgcacctgttcgccgtg 217
Query: 313 tttcaggg 320
|| |||||
Sbjct: 218 ttccaggg 225
>gb|BI074863.1|BI074863 IP1_16_A11.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 497
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgctgtg 312
|||||| |||| |||||||||||||| || || || ||||| ||||||| ||||| |||
Sbjct: 158 tggtggcggaacgagcagttctgggtgatcggcggcgtgtcggcgcacctgttcgccgtg 217
Query: 313 tttcaggg 320
|| |||||
Sbjct: 218 ttccaggg 225
>gb|BI245956.1|BI245956 IP1_65_G03.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 495
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttcgctgtg 312
|||||| |||| |||||||||||||| || || || ||||| ||||||| ||||| |||
Sbjct: 323 tggtggcggaacgagcagttctgggtgatcggcggcgtgtcggcgcacctgttcgccgtg 382
Query: 313 tttcaggg 320
|| |||||
Sbjct: 383 ttccaggg 390
>gb|CW481819.1|CW481819 fsbb001f241j14k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f241j14, DNA
sequence
Length = 573
Score = 46.1 bits (23), Expect = 0.003
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctctt 305
|||||||||||||| ||||| || || ||||| ||||| ||||| || || ||||||||
Sbjct: 413 gatgattggtggagaaatgaacaattttgggttattggcggtgtctcatcacacctctt 355
>gb|CF072057.1|CF072057 FE1_20_C10.b1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_20_C10_A002 3', mRNA sequence
Length = 666
Score = 44.1 bits (22), Expect = 0.010
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattgg 284
||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 1 gatgaatggtggaggaacgagcagttttgggttattgg 38
>gb|CW417878.1|CW417878 fsbb001f121b11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f121b11, DNA
sequence
Length = 777
Score = 42.1 bits (21), Expect = 0.040
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 71 tttgttgtttgagaaaaacaa 91
|||||||||||||||||||||
Sbjct: 356 tttgttgtttgagaaaaacaa 336
>gb|BM330327.1|BM330327 PIC1_50_E03.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 561
Score = 42.1 bits (21), Expect = 0.040
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 71 tttgttgtttgagaaaaacaa 91
|||||||||||||||||||||
Sbjct: 514 tttgttgtttgagaaaaacaa 534
>gb|CF070973.1|CF070973 FE1_14_E09.g1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_14_E09_A002 5', mRNA sequence
Length = 730
Score = 42.1 bits (21), Expect = 0.040
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 71 tttgttgtttgagaaaaacaa 91
|||||||||||||||||||||
Sbjct: 73 tttgttgtttgagaaaaacaa 53
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 124,174
Number of Sequences: 832831
Number of extensions: 124174
Number of successful extensions: 35663
Number of sequences better than 0.5: 55
Number of HSP's better than 0.5 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35591
Number of HSP's gapped (non-prelim): 71
length of query: 425
length of database: 491,359,669
effective HSP length: 19
effective length of query: 406
effective length of database: 475,535,880
effective search space: 193067567280
effective search space used: 193067567280
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)