BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF31c07.yg.2.3
         (732 letters)

Database: Sorghum_nucl_with_EST.fasta 
           832,831 sequences; 491,359,669 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF756186.1|CF756186  DSAF1_4_C09.b1_A011 Drought-stressed...    40   0.28 
>gb|CF756186.1|CF756186 DSAF1_4_C09.b1_A011 Drought-stressed after flowering Sorghum
           bicolor cDNA clone DSAF1_4_C09_A011 5', mRNA sequence
          Length = 435

 Score = 40.1 bits (20), Expect = 0.28
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 401 atggattggatcattcacctcgatactgatgagttg 436
           |||||||||||||| || || || ||||||||||||
Sbjct: 378 atggattggatcatacatctagacactgatgagttg 413
  Database: Sorghum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:54 PM
  Number of letters in database: 491,359,669
  Number of sequences in database:  832,831
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 160,419
Number of Sequences: 832831
Number of extensions: 160419
Number of successful extensions: 43170
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43169
Number of HSP's gapped (non-prelim): 1
length of query: 732
length of database: 491,359,669
effective HSP length: 20
effective length of query: 712
effective length of database: 474,703,049
effective search space: 337988570888
effective search space used: 337988570888
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)