BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF31c07.yg.2.1
(352 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL703926.2|CL703926 SP__Bb0008E01.r SP__Bb Sorghum propi... 248 3e-064
gb|CD224243.1|CD224243 CCC1_32_E02.g1_A007 Callus culture/c... 107 7e-022
gb|CD424932.1|CD424932 SA1_9_C03.g1_A002 Salicylic acid-tre... 58 6e-007
gb|CW218062.1|CW218062 104_651_11195994_116_37071_071 Sorgh... 38 0.52
gb|BZ342624.1|BZ342624 ic85c02.g1 WGS-SbicolorF (JM107 adap... 34 8.1
gb|BZ346861.1|BZ346861 hv99d04.b1 WGS-SbicolorF (JM107 adap... 34 8.1
gb|BZ422970.1|BZ422970 hz32f11.g1 WGS-SbicolorF (DH5a methy... 34 8.1
gb|BZ628823.1|BZ628823 ih62d12.g1 WGS-SbicolorF (DH5a methy... 34 8.1
gb|CC059688.1|CC059688 ii26d08.b1 WGS-SbicolorF (DH5a methy... 34 8.1
gb|BZ692351.1|BZ692351 SP__Ba0019M23.r SP__Ba Sorghum propi... 34 8.1
gb|CL178029.1|CL178029 104_385_10894266_116_31914_330 Sorgh... 34 8.1
gb|CL179159.1|CL179159 104_388_10895120_116_31910_032 Sorgh... 34 8.1
gb|CL179226.1|CL179226 104_388_10895165_116_31910_077 Sorgh... 34 8.1
gb|CL183635.1|CL183635 104_396_10898298_114_31923_138 Sorgh... 34 8.1
gb|CL183636.1|CL183636 104_396_10898298_116_31924_138 Sorgh... 34 8.1
gb|CW025264.1|CW025264 104_226_10488089_114_30497 Sorghum m... 34 8.1
gb|CW074331.1|CW074331 104_346_10803260_114_31375_236 Sorgh... 34 8.1
gb|CW074332.1|CW074332 104_346_10803260_116_31376_236 Sorgh... 34 8.1
gb|CW075301.1|CW075301 104_357_10807329_114_31812_081 Sorgh... 34 8.1
gb|CW075302.1|CW075302 104_357_10807329_116_31813_081 Sorgh... 34 8.1
gb|CW075397.1|CW075397 104_357_10807617_116_31813_369 Sorgh... 34 8.1
gb|CW075817.1|CW075817 104_362_10809240_114_31798_072 Sorgh... 34 8.1
gb|CW075818.1|CW075818 104_362_10809240_116_31799_072 Sorgh... 34 8.1
gb|CW075991.1|CW075991 104_364_10810070_114_31802_134 Sorgh... 34 8.1
gb|CW076873.1|CW076873 104_375_10890218_116_31797_122 Sorgh... 34 8.1
gb|CW077025.1|CW077025 104_377_10890869_116_31793_005 Sorgh... 34 8.1
gb|CW077026.1|CW077026 104_377_10890869_148_31792_005 Sorgh... 34 8.1
gb|CW078198.1|CW078198 104_390_10895885_116_31930_029 Sorgh... 34 8.1
gb|CW078199.1|CW078199 104_390_10895885_148_31929_029 Sorgh... 34 8.1
gb|CW080076.1|CW080076 104_406_10902243_116_32471_006 Sorgh... 34 8.1
gb|CW080092.1|CW080092 104_406_10902325_116_32473_051 Sorgh... 34 8.1
gb|CW080375.1|CW080375 104_410_10906620_114_32533_048 Sorgh... 34 8.1
gb|CW080376.1|CW080376 104_410_10906620_116_32537_048 Sorgh... 34 8.1
gb|CW081422.1|CW081422 104_419_10941761_114_32292_075 Sorgh... 34 8.1
gb|CW082848.1|CW082848 104_425_10944016_116_32355_062 Sorgh... 34 8.1
gb|CW092793.1|CW092793 104_455_10999388_114_33048_072 Sorgh... 34 8.1
gb|CW108304.1|CW108304 104_478_11097072_116_34488_082 Sorgh... 34 8.1
gb|CW112684.1|CW112684 104_486_11105024_116_34548_022 Sorgh... 34 8.1
gb|CW113889.1|CW113889 104_488_11105696_116_34560_026 Sorgh... 34 8.1
gb|CW113890.1|CW113890 104_488_11105696_148_34564_026 Sorgh... 34 8.1
gb|CW117248.1|CW117248 104_493_11107559_116_34614_092 Sorgh... 34 8.1
gb|CW117249.1|CW117249 104_493_11107559_148_34610_092 Sorgh... 34 8.1
gb|CW118155.1|CW118155 104_494_11108050_116_34620_039 Sorgh... 34 8.1
gb|CW121529.1|CW121529 104_499_11109955_148_34657_072 Sorgh... 34 8.1
gb|CW121968.1|CW121968 104_500_11110271_116_34667_092 Sorgh... 34 8.1
gb|CW123696.1|CW123696 104_503_11111354_116_34698_013 Sorgh... 34 8.1
gb|CW125497.1|CW125497 104_505_11112359_116_34713_084 Sorgh... 34 8.1
gb|CW128256.1|CW128256 104_509_11113905_148_34750_035 Sorgh... 34 8.1
gb|CW129758.1|CW129758 104_512_11114739_116_34768_016 Sorgh... 34 8.1
gb|CW131716.1|CW131716 104_514_11115821_116_34786_019 Sorgh... 34 8.1
gb|CW136045.1|CW136045 104_520_11118171_116_34838_002 Sorgh... 34 8.1
gb|CW136046.1|CW136046 104_520_11118171_148_34834_002 Sorgh... 34 8.1
gb|CW139124.1|CW139124 104_529_11135070_116_34907_029 Sorgh... 34 8.1
gb|CW139125.1|CW139125 104_529_11135070_148_34911_029 Sorgh... 34 8.1
gb|CW140866.1|CW140866 104_531_11136007_148_34920_022 Sorgh... 34 8.1
gb|CW141915.1|CW141915 104_533_11136566_116_34939_063 Sorgh... 34 8.1
gb|CW147805.1|CW147805 104_542_11140080_148_35007_094 Sorgh... 34 8.1
gb|CW174881.1|CW174881 104_587_11157642_116_36573_077 Sorgh... 34 8.1
gb|CW178648.1|CW178648 104_592_11159678_148_36619_055 Sorgh... 34 8.1
gb|CW181658.1|CW181658 104_596_11163629_116_36651_019 Sorgh... 34 8.1
gb|CW187146.1|CW187146 104_605_11166939_116_36717_010 Sorgh... 34 8.1
gb|CW193730.1|CW193730 104_616_11179722_116_36784_069 Sorgh... 34 8.1
gb|CW193731.1|CW193731 104_616_11179722_148_36783_069 Sorgh... 34 8.1
gb|CW194568.1|CW194568 104_617_11180165_148_36789_017 Sorgh... 34 8.1
gb|CW196319.1|CW196319 104_620_11181107_148_36814_044 Sorgh... 34 8.1
gb|CW196585.1|CW196585 104_620_11181242_116_36816_005 Sorgh... 34 8.1
gb|CW200548.1|CW200548 104_626_11184113_116_36865_077 Sorgh... 34 8.1
gb|CW208803.1|CW208803 104_638_11188884_148_36983_040 Sorgh... 34 8.1
gb|CW208973.1|CW208973 104_638_11188978_116_36984_035 Sorgh... 34 8.1
gb|CW208974.1|CW208974 104_638_11188978_148_36983_035 Sorgh... 34 8.1
gb|CW211073.1|CW211073 104_641_11190121_148_37007_003 Sorgh... 34 8.1
gb|CW227433.1|CW227433 104_665_11205416_116_37226_018 Sorgh... 34 8.1
gb|CW235259.1|CW235259 104_690_11214886_116_37408_087 Sorgh... 34 8.1
gb|CW238076.1|CW238076 104_694_11216527_116_37395_020 Sorgh... 34 8.1
gb|CW238077.1|CW238077 104_694_11216527_148_37400_020 Sorgh... 34 8.1
gb|CW249845.1|CW249845 104_711_11223064_116_35044_052 Sorgh... 34 8.1
gb|CW250744.1|CW250744 104_713_11223555_148_35058_014 Sorgh... 34 8.1
gb|CW256535.1|CW256535 104_721_11226844_148_35145_006 Sorgh... 34 8.1
gb|CW258851.1|CW258851 104_724_11228102_116_35165_049 Sorgh... 34 8.1
gb|CW258852.1|CW258852 104_724_11228102_148_35169_049 Sorgh... 34 8.1
gb|CW260807.1|CW260807 104_727_11229167_116_35197_086 Sorgh... 34 8.1
gb|CW272305.1|CW272305 104_744_11403373_116_35346_053 Sorgh... 34 8.1
gb|CW272306.1|CW272306 104_744_11403373_116_36221_053 Sorgh... 34 8.1
gb|CW281873.1|CW281873 104_757_11408410_116_35462_035 Sorgh... 34 8.1
gb|CW281874.1|CW281874 104_757_11408410_148_35458_035 Sorgh... 34 8.1
gb|CW282589.1|CW282589 104_758_11408791_116_35465_020 Sorgh... 34 8.1
gb|CW284550.1|CW284550 104_761_11409849_116_35489_039 Sorgh... 34 8.1
gb|CW284551.1|CW284551 104_761_11409849_148_35493_039 Sorgh... 34 8.1
gb|CW288002.1|CW288002 104_766_11411718_116_35530_025 Sorgh... 34 8.1
gb|CW288282.1|CW288282 104_766_11411868_116_35530_036 Sorgh... 34 8.1
gb|CW288283.1|CW288283 104_766_11411868_148_35534_036 Sorgh... 34 8.1
gb|CW293843.1|CW293843 104_774_11414873_148_35772_071 Sorgh... 34 8.1
gb|CW315703.1|CW315703 104_806_11472504_116_35824_082 Sorgh... 34 8.1
gb|CW319205.1|CW319205 104_811_11474360_148_35883_020 Sorgh... 34 8.1
gb|CW330208.1|CW330208 104_827_11480253_116_36007_095 Sorgh... 34 8.1
gb|CW330209.1|CW330209 104_827_11480253_148_36008_095 Sorgh... 34 8.1
gb|CW330210.1|CW330210 104_827_11480254_116_36010_095 Sorgh... 34 8.1
gb|CW330211.1|CW330211 104_827_11480254_148_36009_095 Sorgh... 34 8.1
gb|CW331204.1|CW331204 104_828_11480784_116_36026_090 Sorgh... 34 8.1
gb|CW331205.1|CW331205 104_828_11480784_148_36025_090 Sorgh... 34 8.1
gb|CW331208.1|CW331208 104_828_11480786_116_36022_007 Sorgh... 34 8.1
gb|CW331209.1|CW331209 104_828_11480786_148_36021_007 Sorgh... 34 8.1
gb|CW337623.1|CW337623 104_837_11484274_116_36121_039 Sorgh... 34 8.1
gb|CW337624.1|CW337624 104_837_11484274_148_36120_039 Sorgh... 34 8.1
gb|CW338071.1|CW338071 104_838_11484547_148_36123_076 Sorgh... 34 8.1
gb|CW338576.1|CW338576 104_839_11484820_116_36133_016 Sorgh... 34 8.1
gb|CW338577.1|CW338577 104_839_11484820_148_36132_016 Sorgh... 34 8.1
gb|CW343308.1|CW343308 104_845_11487351_116_36185_056 Sorgh... 34 8.1
gb|CW346944.1|CW346944 fsbb001f006k11k0 Sorghum methylation... 34 8.1
gb|CW359276.1|CW359276 fsbb001f026n08f0 Sorghum methylation... 34 8.1
gb|CW359277.1|CW359277 fsbb001f026n08k0 Sorghum methylation... 34 8.1
gb|CW359830.1|CW359830 fsbb001f027k04k0 Sorghum methylation... 34 8.1
gb|CW360657.1|CW360657 fsbb001f028n16f0 Sorghum methylation... 34 8.1
gb|CW363112.1|CW363112 fsbb001f034h22k0 Sorghum methylation... 34 8.1
gb|CW363665.1|CW363665 fsbb001f035g01k0 Sorghum methylation... 34 8.1
gb|CW365442.1|CW365442 fsbb001f037p18f0 Sorghum methylation... 34 8.1
gb|CW366860.1|CW366860 fsbb001f040a15f0 Sorghum methylation... 34 8.1
gb|CW367514.1|CW367514 fsbb001f041a16k0 Sorghum methylation... 34 8.1
gb|CW368997.1|CW368997 fsbb001f043d09f0 Sorghum methylation... 34 8.1
gb|CW372248.1|CW372248 fsbb001f048b08f0 Sorghum methylation... 34 8.1
gb|CW372249.1|CW372249 fsbb001f048b08k0 Sorghum methylation... 34 8.1
gb|CW372692.1|CW372692 fsbb001f048l09k0 Sorghum methylation... 34 8.1
gb|CW373853.1|CW373853 fsbb001f050h01f0 Sorghum methylation... 34 8.1
gb|CW375420.1|CW375420 fsbb001f052m12f0 Sorghum methylation... 34 8.1
gb|CW375421.1|CW375421 fsbb001f052m12k0 Sorghum methylation... 34 8.1
gb|CW376369.1|CW376369 fsbb001f054d16f0 Sorghum methylation... 34 8.1
gb|CW377887.1|CW377887 fsbb001f056g14f0 Sorghum methylation... 34 8.1
gb|CW377888.1|CW377888 fsbb001f056g14k0 Sorghum methylation... 34 8.1
gb|CW378128.1|CW378128 fsbb001f056m03k0 Sorghum methylation... 34 8.1
gb|CW378230.1|CW378230 fsbb001f056o11k0 Sorghum methylation... 34 8.1
gb|CW378986.1|CW378986 fsbb001f058a07f0 Sorghum methylation... 34 8.1
gb|CW381970.1|CW381970 fsbb001f063j24k0 Sorghum methylation... 34 8.1
gb|CW392095.1|CW392095 fsbb001f078i22k0 Sorghum methylation... 34 8.1
gb|CW406687.1|CW406687 fsbb001f099n02k0 Sorghum methylation... 34 8.1
gb|CW415707.1|CW415707 fsbb001f115o23k0 Sorghum methylation... 34 8.1
gb|CW419595.1|CW419595 fsbb001f124i09k0 Sorghum methylation... 34 8.1
gb|CW422912.1|CW422912 fsbb001f132h09f0 Sorghum methylation... 34 8.1
gb|CW434289.1|CW434289 fsbb001f149o19f0 Sorghum methylation... 34 8.1
gb|CW439360.1|CW439360 fsbb001f157h11k0 Sorghum methylation... 34 8.1
gb|CW445117.1|CW445117 fsbb001f170a23k0 Sorghum methylation... 34 8.1
gb|CW446223.1|CW446223 fsbb001f171m08k0 Sorghum methylation... 34 8.1
gb|CW448101.1|CW448101 fsbb001f181i24k0 Sorghum methylation... 34 8.1
gb|CW451690.1|CW451690 fsbb001f191o01k0 Sorghum methylation... 34 8.1
gb|CW453653.1|CW453653 fsbb001f197l22k0 Sorghum methylation... 34 8.1
gb|CW457738.1|CW457738 fsbb001f203k24k0 Sorghum methylation... 34 8.1
gb|CW477540.1|CW477540 fsbb001f234o16f0 Sorghum methylation... 34 8.1
gb|CW477541.1|CW477541 fsbb001f234o16k0 Sorghum methylation... 34 8.1
gb|CW487549.1|CW487549 fsbb001f253h07k0 Sorghum methylation... 34 8.1
gb|CW487621.1|CW487621 fsbb001f253j04f0 Sorghum methylation... 34 8.1
gb|CW491427.1|CW491427 fsbb001f281e15f0 Sorghum methylation... 34 8.1
gb|CW786159.1|CW786159 SP__Ba0019M23.r SP__Ba Sorghum propi... 34 8.1
gb|CW789136.1|CW789136 SP__Ba0054E24.f SP__Ba Sorghum propi... 34 8.1
gb|CL700225.2|CL700225 SP__Ba0058H21.r SP__Ba Sorghum propi... 34 8.1
gb|BI211199.1|BI211199 IP1_57_A09.b1_A002 Immature pannicle... 34 8.1
gb|CF073291.1|CF073291 FE1_22_B10.b1_A002 Iron-deficient se... 34 8.1
>gb|CL703926.2|CL703926 SP__Bb0008E01.r SP__Bb Sorghum propinquum genomic clone
SP__Bb0008E01 3', DNA sequence
Length = 727
Score = 248 bits (125), Expect = 3e-064
Identities = 143/150 (95%)
Strand = Plus / Minus
Query: 1 agatctgtatcacgggaagcacatctgctggcctacaccagattcttccatggttgtatt 60
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 641 agatctgtatcacgggaagcacatctgctggcctacaccagattctcccatggttgtatt 582
Query: 61 atcacaatgtcattggtgtttcacatttctttctattagttgaaggagaggctgcaaagc 120
||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 581 atcacaaggtcattggtgtttcacatttctttctctttgttgaaggagaggctgcaaagc 522
Query: 121 cagctnnnacctctgttcttgaatctattc 150
||||| ||||||||||||||||||||||
Sbjct: 521 cagctgtcacctctgttcttgaatctattc 492
>gb|CD224243.1|CD224243 CCC1_32_E02.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_32_E02_A007 5', mRNA sequence
Length = 537
Score = 107 bits (54), Expect = 7e-022
Identities = 60/62 (96%)
Strand = Plus / Plus
Query: 1 agatctgtatcacgggaagcacatctgctggcctacaccagattcttccatggttgtatt 60
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 476 agatctgtatcacgggaagcacatctgctgggctacaccagattctcccatggttgtatt 535
Query: 61 at 62
||
Sbjct: 536 at 537
>gb|CD424932.1|CD424932 SA1_9_C03.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_9_C03_A002 5', mRNA sequence
Length = 492
Score = 58.0 bits (29), Expect = 6e-007
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1 agatctgtatcacgggaagcacatctgct 29
|||||||||||||||||||||||||||||
Sbjct: 464 agatctgtatcacgggaagcacatctgct 492
>gb|CW218062.1|CW218062 104_651_11195994_116_37071_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195994, DNA
sequence
Length = 659
Score = 38.2 bits (19), Expect = 0.52
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 70 tcattggtgtttcacattt 88
|||||||||||||||||||
Sbjct: 108 tcattggtgtttcacattt 126
>gb|BZ342624.1|BZ342624 ic85c02.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic85c02 5', DNA sequence
Length = 514
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 324 atcacaatgtcattggt 308
>gb|BZ346861.1|BZ346861 hv99d04.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hv99d04 5', DNA sequence
Length = 523
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 299 atcacaatgtcattggt 283
>gb|BZ422970.1|BZ422970 hz32f11.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone hz32f11 5', DNA sequence
Length = 771
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 355 atcacaatgtcattggt 339
>gb|BZ628823.1|BZ628823 ih62d12.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ih62d12 5', DNA sequence
Length = 729
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 304 atcacaatgtcattggt 288
>gb|CC059688.1|CC059688 ii26d08.b1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ii26d08, DNA sequence
Length = 545
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 478 atcacaatgtcattggt 494
>gb|BZ692351.1|BZ692351 SP__Ba0019M23.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0019M23 3', DNA sequence
Length = 1091
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 581 atcacaatgtcattggt 597
>gb|CL178029.1|CL178029 104_385_10894266_116_31914_330 Sorghum methylation-filtered
library (LibID: 104) Sorghum bicolor genomic clone
10894266, DNA sequence
Length = 653
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 49 ccagattcttccatggt 33
>gb|CL179159.1|CL179159 104_388_10895120_116_31910_032 Sorghum methylation-filtered
library (LibID: 104) Sorghum bicolor genomic clone
10895120, DNA sequence
Length = 607
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 79 ccagattcttccatggt 95
>gb|CL179226.1|CL179226 104_388_10895165_116_31910_077 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10895165, DNA
sequence
Length = 694
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ttcacatttctttctat 96
|||||||||||||||||
Sbjct: 666 ttcacatttctttctat 682
>gb|CL183635.1|CL183635 104_396_10898298_114_31923_138 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10898298, DNA
sequence
Length = 766
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 459 ccagattcttccatggt 443
>gb|CL183636.1|CL183636 104_396_10898298_116_31924_138 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10898298, DNA
sequence
Length = 720
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 638 ccagattcttccatggt 654
>gb|CW025264.1|CW025264 104_226_10488089_114_30497 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10488089, DNA
sequence
Length = 626
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 595 atcacaatgtcattggt 611
>gb|CW074331.1|CW074331 104_346_10803260_114_31375_236 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803260, DNA
sequence
Length = 758
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 509 atcacaatgtcattggt 525
>gb|CW074332.1|CW074332 104_346_10803260_116_31376_236 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803260, DNA
sequence
Length = 734
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 609 atcacaatgtcattggt 593
>gb|CW075301.1|CW075301 104_357_10807329_114_31812_081 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10807329, DNA
sequence
Length = 704
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 530 atcacaatgtcattggt 514
>gb|CW075302.1|CW075302 104_357_10807329_116_31813_081 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10807329, DNA
sequence
Length = 718
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 295 atcacaatgtcattggt 311
>gb|CW075397.1|CW075397 104_357_10807617_116_31813_369 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10807617, DNA
sequence
Length = 729
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 282 atcacaatgtcattggt 266
>gb|CW075817.1|CW075817 104_362_10809240_114_31798_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809240, DNA
sequence
Length = 715
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 657 atcacaatgtcattggt 673
>gb|CW075818.1|CW075818 104_362_10809240_116_31799_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809240, DNA
sequence
Length = 698
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 423 atcacaatgtcattggt 407
>gb|CW075991.1|CW075991 104_364_10810070_114_31802_134 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810070, DNA
sequence
Length = 759
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 185 atcacaatgtcattggt 169
>gb|CW076873.1|CW076873 104_375_10890218_116_31797_122 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10890218, DNA
sequence
Length = 718
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 84 atcacaatgtcattggt 100
>gb|CW077025.1|CW077025 104_377_10890869_116_31793_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10890869, DNA
sequence
Length = 737
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 549 atcacaatgtcattggt 565
>gb|CW077026.1|CW077026 104_377_10890869_148_31792_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10890869, DNA
sequence
Length = 745
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 392 atcacaatgtcattggt 376
>gb|CW078198.1|CW078198 104_390_10895885_116_31930_029 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
10895885, DNA sequence
Length = 736
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 97 atcacaatgtcattggt 81
>gb|CW078199.1|CW078199 104_390_10895885_148_31929_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10895885, DNA
sequence
Length = 725
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 693 atcacaatgtcattggt 709
>gb|CW080076.1|CW080076 104_406_10902243_116_32471_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10902243, DNA
sequence
Length = 656
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 313 ggtgtttcacatttctt 297
>gb|CW080092.1|CW080092 104_406_10902325_116_32473_051 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10902325, DNA
sequence
Length = 676
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 250 atcacaatgtcattggt 234
>gb|CW080375.1|CW080375 104_410_10906620_114_32533_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906620, DNA
sequence
Length = 770
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 662 atcacaatgtcattggt 678
>gb|CW080376.1|CW080376 104_410_10906620_116_32537_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906620, DNA
sequence
Length = 703
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 451 atcacaatgtcattggt 435
>gb|CW081422.1|CW081422 104_419_10941761_114_32292_075 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10941761, DNA
sequence
Length = 386
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 107 ggtgtttcacatttctt 123
>gb|CW082848.1|CW082848 104_425_10944016_116_32355_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10944016, DNA
sequence
Length = 730
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 387 atcacaatgtcattggt 371
>gb|CW092793.1|CW092793 104_455_10999388_114_33048_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10999388, DNA
sequence
Length = 739
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 183 atcacaatgtcattggt 167
>gb|CW108304.1|CW108304 104_478_11097072_116_34488_082 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11097072, DNA sequence
Length = 74
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 59 atcacaatgtcattggt 43
>gb|CW112684.1|CW112684 104_486_11105024_116_34548_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105024, DNA
sequence
Length = 627
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 133 atcacaatgtcattggt 117
>gb|CW113889.1|CW113889 104_488_11105696_116_34560_026 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105696, DNA
sequence
Length = 691
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 404 ggtgtttcacatttctt 420
>gb|CW113890.1|CW113890 104_488_11105696_148_34564_026 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105696, DNA
sequence
Length = 675
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 538 ggtgtttcacatttctt 522
>gb|CW117248.1|CW117248 104_493_11107559_116_34614_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11107559, DNA
sequence
Length = 656
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 253 atcacaatgtcattggt 237
>gb|CW117249.1|CW117249 104_493_11107559_148_34610_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11107559, DNA
sequence
Length = 615
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 479 atcacaatgtcattggt 495
>gb|CW118155.1|CW118155 104_494_11108050_116_34620_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11108050, DNA
sequence
Length = 656
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 545 atcacaatgtcattggt 529
>gb|CW121529.1|CW121529 104_499_11109955_148_34657_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11109955, DNA
sequence
Length = 558
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 398 atcacaatgtcattggt 414
>gb|CW121968.1|CW121968 104_500_11110271_116_34667_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11110271, DNA
sequence
Length = 629
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 209 atcacaatgtcattggt 193
>gb|CW123696.1|CW123696 104_503_11111354_116_34698_013 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11111354, DNA sequence
Length = 384
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 77 atcacaatgtcattggt 61
>gb|CW125497.1|CW125497 104_505_11112359_116_34713_084 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112359, DNA
sequence
Length = 642
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 239 atcacaatgtcattggt 255
>gb|CW128256.1|CW128256 104_509_11113905_148_34750_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11113905, DNA
sequence
Length = 619
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 152 atcacaatgtcattggt 136
>gb|CW129758.1|CW129758 104_512_11114739_116_34768_016 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11114739, DNA sequence
Length = 433
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 21 atcacaatgtcattggt 5
>gb|CW131716.1|CW131716 104_514_11115821_116_34786_019 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11115821, DNA sequence
Length = 649
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 23 ccagattcttccatggt 7
>gb|CW136045.1|CW136045 104_520_11118171_116_34838_002 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11118171, DNA
sequence
Length = 709
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 482 atcacaatgtcattggt 466
>gb|CW136046.1|CW136046 104_520_11118171_148_34834_002 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11118171, DNA
sequence
Length = 638
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 268 atcacaatgtcattggt 284
>gb|CW139124.1|CW139124 104_529_11135070_116_34907_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135070, DNA
sequence
Length = 649
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 300 atcacaatgtcattggt 284
>gb|CW139125.1|CW139125 104_529_11135070_148_34911_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135070, DNA
sequence
Length = 670
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 519 atcacaatgtcattggt 535
>gb|CW140866.1|CW140866 104_531_11136007_148_34920_022 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11136007, DNA sequence
Length = 692
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 56 atcacaatgtcattggt 72
>gb|CW141915.1|CW141915 104_533_11136566_116_34939_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11136566, DNA
sequence
Length = 688
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 195 atcacaatgtcattggt 179
>gb|CW147805.1|CW147805 104_542_11140080_148_35007_094 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11140080, DNA sequence
Length = 617
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 52 atcacaatgtcattggt 68
>gb|CW174881.1|CW174881 104_587_11157642_116_36573_077 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11157642, DNA
sequence
Length = 177
Score = 34.2 bits (17), Expect = 8.1
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 34 tacaccagattcttccatggt 54
|||||||||||||| ||||||
Sbjct: 171 tacaccagattcttgcatggt 151
>gb|CW178648.1|CW178648 104_592_11159678_148_36619_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11159678, DNA
sequence
Length = 721
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 302 atcacaatgtcattggt 286
>gb|CW181658.1|CW181658 104_596_11163629_116_36651_019 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11163629, DNA sequence
Length = 621
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 83 atcacaatgtcattggt 99
>gb|CW187146.1|CW187146 104_605_11166939_116_36717_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11166939, DNA
sequence
Length = 763
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 382 atcacaatgtcattggt 366
>gb|CW193730.1|CW193730 104_616_11179722_116_36784_069 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179722, DNA
sequence
Length = 732
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 407 atcacaatgtcattggt 391
>gb|CW193731.1|CW193731 104_616_11179722_148_36783_069 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179722, DNA
sequence
Length = 642
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 378 atcacaatgtcattggt 394
>gb|CW194568.1|CW194568 104_617_11180165_148_36789_017 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11180165, DNA
sequence
Length = 736
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 521 atcacaatgtcattggt 537
>gb|CW196319.1|CW196319 104_620_11181107_148_36814_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11181107, DNA
sequence
Length = 719
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 326 atcacaatgtcattggt 342
>gb|CW196585.1|CW196585 104_620_11181242_116_36816_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11181242, DNA
sequence
Length = 697
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 103 atcacaatgtcattggt 87
>gb|CW200548.1|CW200548 104_626_11184113_116_36865_077 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11184113, DNA sequence
Length = 607
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 21 atcacaatgtcattggt 5
>gb|CW208803.1|CW208803 104_638_11188884_148_36983_040 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188884, DNA
sequence
Length = 331
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 291 atcacaatgtcattggt 307
>gb|CW208973.1|CW208973 104_638_11188978_116_36984_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188978, DNA
sequence
Length = 641
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 611 atcacaatgtcattggt 595
>gb|CW208974.1|CW208974 104_638_11188978_148_36983_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188978, DNA
sequence
Length = 661
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 291 atcacaatgtcattggt 307
>gb|CW211073.1|CW211073 104_641_11190121_148_37007_003 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11190121, DNA
sequence
Length = 670
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 217 atcacaatgtcattggt 201
>gb|CW227433.1|CW227433 104_665_11205416_116_37226_018 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11205416, DNA
sequence
Length = 682
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 48 ccatggttgtattatca 64
|||||||||||||||||
Sbjct: 488 ccatggttgtattatca 504
>gb|CW235259.1|CW235259 104_690_11214886_116_37408_087 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11214886, DNA sequence
Length = 601
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 84 atcacaatgtcattggt 68
>gb|CW238076.1|CW238076 104_694_11216527_116_37395_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216527, DNA
sequence
Length = 685
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 430 ggtgtttcacatttctt 446
>gb|CW238077.1|CW238077 104_694_11216527_148_37400_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216527, DNA
sequence
Length = 746
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 671 ggtgtttcacatttctt 655
>gb|CW249845.1|CW249845 104_711_11223064_116_35044_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11223064, DNA
sequence
Length = 718
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 441 atcacaatgtcattggt 425
>gb|CW250744.1|CW250744 104_713_11223555_148_35058_014 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11223555, DNA
sequence
Length = 718
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 136 ttcttgaatctattcag 152
|||||||||||||||||
Sbjct: 215 ttcttgaatctattcag 199
>gb|CW256535.1|CW256535 104_721_11226844_148_35145_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226844, DNA
sequence
Length = 728
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 214 atcacaatgtcattggt 230
>gb|CW258851.1|CW258851 104_724_11228102_116_35165_049 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11228102, DNA
sequence
Length = 668
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 471 atcacaatgtcattggt 455
>gb|CW258852.1|CW258852 104_724_11228102_148_35169_049 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11228102, DNA
sequence
Length = 562
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 427 atcacaatgtcattggt 443
>gb|CW260807.1|CW260807 104_727_11229167_116_35197_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229167, DNA
sequence
Length = 647
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 440 atcacaatgtcattggt 424
>gb|CW272305.1|CW272305 104_744_11403373_116_35346_053 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11403373, DNA sequence
Length = 652
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 78 atcacaatgtcattggt 62
>gb|CW272306.1|CW272306 104_744_11403373_116_36221_053 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11403373, DNA sequence
Length = 757
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 78 atcacaatgtcattggt 62
>gb|CW281873.1|CW281873 104_757_11408410_116_35462_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408410, DNA
sequence
Length = 554
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 277 atcacaatgtcattggt 261
>gb|CW281874.1|CW281874 104_757_11408410_148_35458_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408410, DNA
sequence
Length = 621
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 485 atcacaatgtcattggt 501
>gb|CW282589.1|CW282589 104_758_11408791_116_35465_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408791, DNA
sequence
Length = 651
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 107 atcacaatgtcattggt 91
>gb|CW284550.1|CW284550 104_761_11409849_116_35489_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11409849, DNA
sequence
Length = 622
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 591 atcacaatgtcattggt 607
>gb|CW284551.1|CW284551 104_761_11409849_148_35493_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11409849, DNA
sequence
Length = 656
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 358 atcacaatgtcattggt 342
>gb|CW288002.1|CW288002 104_766_11411718_116_35530_025 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11411718, DNA sequence
Length = 615
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 92 atcacaatgtcattggt 76
>gb|CW288282.1|CW288282 104_766_11411868_116_35530_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11411868, DNA
sequence
Length = 696
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 312 atcacaatgtcattggt 328
>gb|CW288283.1|CW288283 104_766_11411868_148_35534_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11411868, DNA
sequence
Length = 695
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 510 atcacaatgtcattggt 494
>gb|CW293843.1|CW293843 104_774_11414873_148_35772_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11414873, DNA
sequence
Length = 710
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 111 atcacaatgtcattggt 127
>gb|CW315703.1|CW315703 104_806_11472504_116_35824_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11472504, DNA
sequence
Length = 639
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 525 atcacaatgtcattggt 509
>gb|CW319205.1|CW319205 104_811_11474360_148_35883_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11474360, DNA
sequence
Length = 724
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 484 atcacaatgtcattggt 500
>gb|CW330208.1|CW330208 104_827_11480253_116_36007_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480253, DNA
sequence
Length = 529
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 493 atcacaatgtcattggt 477
>gb|CW330209.1|CW330209 104_827_11480253_148_36008_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480253, DNA
sequence
Length = 764
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 491 atcacaatgtcattggt 507
>gb|CW330210.1|CW330210 104_827_11480254_116_36010_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480254, DNA
sequence
Length = 716
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 493 atcacaatgtcattggt 477
>gb|CW330211.1|CW330211 104_827_11480254_148_36009_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480254, DNA
sequence
Length = 646
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 491 atcacaatgtcattggt 507
>gb|CW331204.1|CW331204 104_828_11480784_116_36026_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480784, DNA
sequence
Length = 699
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 284 atcacaatgtcattggt 268
>gb|CW331205.1|CW331205 104_828_11480784_148_36025_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480784, DNA
sequence
Length = 715
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 593 atcacaatgtcattggt 609
>gb|CW331208.1|CW331208 104_828_11480786_116_36022_007 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480786, DNA
sequence
Length = 650
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 552 atcacaatgtcattggt 568
>gb|CW331209.1|CW331209 104_828_11480786_148_36021_007 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11480786, DNA
sequence
Length = 492
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 443 atcacaatgtcattggt 427
>gb|CW337623.1|CW337623 104_837_11484274_116_36121_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484274, DNA
sequence
Length = 652
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 517 atcacaatgtcattggt 501
>gb|CW337624.1|CW337624 104_837_11484274_148_36120_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484274, DNA
sequence
Length = 550
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 151 atcacaatgtcattggt 167
>gb|CW338071.1|CW338071 104_838_11484547_148_36123_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484547, DNA
sequence
Length = 704
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tgtttcacatttctttc 93
|||||||||||||||||
Sbjct: 128 tgtttcacatttctttc 112
>gb|CW338576.1|CW338576 104_839_11484820_116_36133_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484820, DNA
sequence
Length = 645
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 251 atcacaatgtcattggt 235
>gb|CW338577.1|CW338577 104_839_11484820_148_36132_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484820, DNA
sequence
Length = 672
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 549 atcacaatgtcattggt 565
>gb|CW343308.1|CW343308 104_845_11487351_116_36185_056 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11487351, DNA
sequence
Length = 647
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 108 atcacaatgtcattggt 92
>gb|CW346944.1|CW346944 fsbb001f006k11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f006k11, DNA
sequence
Length = 819
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 393 atcacaatgtcattggt 409
>gb|CW359276.1|CW359276 fsbb001f026n08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f026n08, DNA
sequence
Length = 711
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 136 ttcttgaatctattcag 152
|||||||||||||||||
Sbjct: 611 ttcttgaatctattcag 627
>gb|CW359277.1|CW359277 fsbb001f026n08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f026n08, DNA
sequence
Length = 745
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 136 ttcttgaatctattcag 152
|||||||||||||||||
Sbjct: 569 ttcttgaatctattcag 553
>gb|CW359830.1|CW359830 fsbb001f027k04k0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f027k04, DNA
sequence
Length = 713
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 39 atcacaatgtcattggt 55
>gb|CW360657.1|CW360657 fsbb001f028n16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f028n16, DNA
sequence
Length = 685
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 347 ggtgtttcacatttctt 363
>gb|CW363112.1|CW363112 fsbb001f034h22k0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f034h22, DNA
sequence
Length = 452
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 80 ttcacatttctttctat 96
|||||||||||||||||
Sbjct: 58 ttcacatttctttctat 42
>gb|CW363665.1|CW363665 fsbb001f035g01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f035g01, DNA
sequence
Length = 216
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 199 atcacaatgtcattggt 183
>gb|CW365442.1|CW365442 fsbb001f037p18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f037p18, DNA
sequence
Length = 735
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 309 atcacaatgtcattggt 325
>gb|CW366860.1|CW366860 fsbb001f040a15f0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f040a15, DNA
sequence
Length = 669
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 38 atcacaatgtcattggt 22
>gb|CW367514.1|CW367514 fsbb001f041a16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f041a16, DNA
sequence
Length = 682
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 125 atcacaatgtcattggt 109
>gb|CW368997.1|CW368997 fsbb001f043d09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f043d09, DNA
sequence
Length = 494
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 284 atcacaatgtcattggt 300
>gb|CW372248.1|CW372248 fsbb001f048b08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f048b08, DNA
sequence
Length = 748
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 670 atcacaatgtcattggt 686
>gb|CW372249.1|CW372249 fsbb001f048b08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f048b08, DNA
sequence
Length = 744
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 543 atcacaatgtcattggt 527
>gb|CW372692.1|CW372692 fsbb001f048l09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f048l09, DNA
sequence
Length = 742
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 228 atcacaatgtcattggt 212
>gb|CW373853.1|CW373853 fsbb001f050h01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f050h01, DNA
sequence
Length = 453
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 235 atcacaatgtcattggt 219
>gb|CW375420.1|CW375420 fsbb001f052m12f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f052m12, DNA
sequence
Length = 720
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 466 atcacaatgtcattggt 482
>gb|CW375421.1|CW375421 fsbb001f052m12k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f052m12, DNA
sequence
Length = 737
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 290 atcacaatgtcattggt 274
>gb|CW376369.1|CW376369 fsbb001f054d16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f054d16, DNA
sequence
Length = 641
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 212 atcacaatgtcattggt 228
>gb|CW377887.1|CW377887 fsbb001f056g14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f056g14, DNA
sequence
Length = 733
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 702 atcacaatgtcattggt 718
>gb|CW377888.1|CW377888 fsbb001f056g14k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f056g14, DNA
sequence
Length = 788
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 209 atcacaatgtcattggt 193
>gb|CW378128.1|CW378128 fsbb001f056m03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f056m03, DNA
sequence
Length = 787
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 444 atcacaatgtcattggt 428
>gb|CW378230.1|CW378230 fsbb001f056o11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f056o11, DNA
sequence
Length = 708
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 599 atcacaatgtcattggt 583
>gb|CW378986.1|CW378986 fsbb001f058a07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f058a07, DNA
sequence
Length = 803
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 683 atcacaatgtcattggt 699
>gb|CW381970.1|CW381970 fsbb001f063j24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f063j24, DNA
sequence
Length = 645
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 439 atcacaatgtcattggt 423
>gb|CW392095.1|CW392095 fsbb001f078i22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f078i22, DNA
sequence
Length = 645
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ttcacatttctttctat 96
|||||||||||||||||
Sbjct: 392 ttcacatttctttctat 408
>gb|CW406687.1|CW406687 fsbb001f099n02k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f099n02, DNA
sequence
Length = 759
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 77 tgtttcacatttctttc 93
|||||||||||||||||
Sbjct: 585 tgtttcacatttctttc 601
>gb|CW415707.1|CW415707 fsbb001f115o23k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f115o23, DNA
sequence
Length = 747
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 292 atcacaatgtcattggt 276
>gb|CW419595.1|CW419595 fsbb001f124i09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f124i09, DNA
sequence
Length = 645
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 315 atcacaatgtcattggt 299
>gb|CW422912.1|CW422912 fsbb001f132h09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f132h09, DNA
sequence
Length = 715
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 131 atcacaatgtcattggt 147
>gb|CW434289.1|CW434289 fsbb001f149o19f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f149o19, DNA
sequence
Length = 696
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 75 ggtgtttcacatttctt 91
|||||||||||||||||
Sbjct: 383 ggtgtttcacatttctt 399
>gb|CW439360.1|CW439360 fsbb001f157h11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f157h11, DNA
sequence
Length = 772
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 50 atggttgtattatcaca 66
|||||||||||||||||
Sbjct: 374 atggttgtattatcaca 390
>gb|CW445117.1|CW445117 fsbb001f170a23k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f170a23, DNA
sequence
Length = 533
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 80 ttcacatttctttctat 96
|||||||||||||||||
Sbjct: 279 ttcacatttctttctat 263
>gb|CW446223.1|CW446223 fsbb001f171m08k0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f171m08, DNA
sequence
Length = 612
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 38 ccagattcttccatggt 54
|||||||||||||||||
Sbjct: 42 ccagattcttccatggt 58
>gb|CW448101.1|CW448101 fsbb001f181i24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f181i24, DNA
sequence
Length = 668
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 503 atcacaatgtcattggt 487
>gb|CW451690.1|CW451690 fsbb001f191o01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f191o01, DNA
sequence
Length = 658
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 533 atcacaatgtcattggt 517
>gb|CW453653.1|CW453653 fsbb001f197l22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f197l22, DNA
sequence
Length = 759
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 440 atcacaatgtcattggt 424
>gb|CW457738.1|CW457738 fsbb001f203k24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f203k24, DNA
sequence
Length = 690
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 172 atcacaatgtcattggt 156
>gb|CW477540.1|CW477540 fsbb001f234o16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f234o16, DNA
sequence
Length = 713
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 680 atcacaatgtcattggt 696
>gb|CW477541.1|CW477541 fsbb001f234o16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f234o16, DNA
sequence
Length = 735
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 392 atcacaatgtcattggt 376
>gb|CW487549.1|CW487549 fsbb001f253h07k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f253h07, DNA
sequence
Length = 730
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 277 atcacaatgtcattggt 261
>gb|CW487621.1|CW487621 fsbb001f253j04f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f253j04, DNA
sequence
Length = 692
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 124 atcacaatgtcattggt 140
>gb|CW491427.1|CW491427 fsbb001f281e15f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f281e15, DNA
sequence
Length = 690
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 158 atcacaatgtcattggt 142
>gb|CW786159.1|CW786159 SP__Ba0019M23.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0019M23 3', DNA sequence
Length = 913
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 577 atcacaatgtcattggt 593
>gb|CW789136.1|CW789136 SP__Ba0054E24.f SP__Ba Sorghum propinquum genomic clone
SP__Ba0054E24 5', DNA sequence
Length = 796
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 563 atcacaatgtcattggt 547
>gb|CL700225.2|CL700225 SP__Ba0058H21.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0058H21 3', DNA sequence
Length = 687
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 atcacaatgtcattggt 77
|||||||||||||||||
Sbjct: 577 atcacaatgtcattggt 593
>gb|BI211199.1|BI211199 IP1_57_A09.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 432
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 67 atgtcattggtgtttca 83
|||||||||||||||||
Sbjct: 406 atgtcattggtgtttca 422
>gb|CF073291.1|CF073291 FE1_22_B10.b1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_22_B10_A002 3', mRNA sequence
Length = 394
Score = 34.2 bits (17), Expect = 8.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 9 atcacgggaagcacatc 25
|||||||||||||||||
Sbjct: 122 atcacgggaagcacatc 106
Database: Sorghum_nucl_with_EST.fasta
Posted date: May 2, 2006 3:37 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 48,903
Number of Sequences: 832831
Number of extensions: 48903
Number of successful extensions: 12672
Number of sequences better than 10.0: 155
Number of HSP's better than 10.0 without gapping: 155
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12500
Number of HSP's gapped (non-prelim): 172
length of query: 352
length of database: 491,359,669
effective HSP length: 19
effective length of query: 333
effective length of database: 475,535,880
effective search space: 158353448040
effective search space used: 158353448040
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)