BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF14f01.yg.2.1
(319 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL158360.1|CL158360 104_347_10803488_114_31377_080 Sorgh... 167 8e-040
gb|CL158361.1|CL158361 104_347_10803488_116_31378_080 Sorgh... 167 8e-040
gb|CW052847.1|CW052847 104_292_10515652_114_30286 Sorghum m... 38 0.47
>gb|CL158360.1|CL158360 104_347_10803488_114_31377_080 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803488, DNA
sequence
Length = 727
Score = 167 bits (84), Expect = 8e-040
Identities = 90/93 (96%)
Strand = Plus / Minus
Query: 21 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 530
Query: 81 atgccatgacttatccannngcttggtattgcc 113
||||||||||||||||| |||||||||||||
Sbjct: 529 atgccatgacttatccagtggcttggtattgcc 497
Score = 61.9 bits (31), Expect = 3e-008
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 129 cccagctgttagaatggatnnnggatcccacagctcnnnatcctcattc 177
||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 481 cccagctgttagaatggatgtaggatcccacagctcgccatcctcattc 433
>gb|CL158361.1|CL158361 104_347_10803488_116_31378_080 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803488, DNA
sequence
Length = 731
Score = 167 bits (84), Expect = 8e-040
Identities = 90/93 (96%)
Strand = Plus / Plus
Query: 21 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 306
Query: 81 atgccatgacttatccannngcttggtattgcc 113
||||||||||||||||| |||||||||||||
Sbjct: 307 atgccatgacttatccagtggcttggtattgcc 339
Score = 61.9 bits (31), Expect = 3e-008
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 129 cccagctgttagaatggatnnnggatcccacagctcnnnatcctcattc 177
||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 355 cccagctgttagaatggatgtaggatcccacagctcgccatcctcattc 403
>gb|CW052847.1|CW052847 104_292_10515652_114_30286 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515652, DNA
sequence
Length = 750
Score = 38.2 bits (19), Expect = 0.47
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 260 atgcacaggcattgggatt 278
|||||||||||||||||||
Sbjct: 696 atgcacaggcattgggatt 714
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 36,350
Number of Sequences: 832831
Number of extensions: 36350
Number of successful extensions: 8975
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8970
Number of HSP's gapped (non-prelim): 5
length of query: 319
length of database: 491,359,669
effective HSP length: 19
effective length of query: 300
effective length of database: 475,535,880
effective search space: 142660764000
effective search space used: 142660764000
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)