BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF11h01.xg.2.1
(328 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL158360.1|CL158360 104_347_10803488_114_31377_080 Sorgh... 295 1e-078
gb|CL158361.1|CL158361 104_347_10803488_116_31378_080 Sorgh... 295 1e-078
gb|CF675663.1|CF675663 MtN3 Subtractive cDNA library from s... 46 0.002
gb|DR831467.1|DR831467 MM71 Sorghum bicolor greenbug-respon... 46 0.002
gb|DV162814.1|DV162814 P1-N10 Sorghum bicolor greenbug-resp... 46 0.002
gb|DV162815.1|DV162815 P3-J15 Sorghum bicolor greenbug-resp... 46 0.002
gb|DR831427.1|DR831427 MT54 Sorghum bicolor greenbug-respon... 44 0.008
gb|DR831556.2|DR831556 MT75 Sorghum bicolor greenbug-respon... 44 0.008
gb|DR831428.1|DR831428 MM77 Sorghum bicolor greenbug-respon... 40 0.12
gb|CW052847.1|CW052847 104_292_10515652_114_30286 Sorghum m... 38 0.48
gb|CW144377.1|CW144377 104_536_11137911_148_34962_056 Sorgh... 38 0.48
gb|CF487333.1|CF487333 POL1_43_D11.b1_A002 Pollen Sorghum b... 38 0.48
>gb|CL158360.1|CL158360 104_347_10803488_114_31377_080 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803488, DNA
sequence
Length = 727
Score = 295 bits (149), Expect = 1e-078
Identities = 155/157 (98%)
Strand = Plus / Minus
Query: 3 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 62
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 530
Query: 63 atgccatgacttatccagtggcttggtattgccgtaaaaggacatcagcccagctgttag 122
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 529 atgccatgacttatccagtggcttggtattgccatagaaggacatcagcccagctgttag 470
Query: 123 aatggatgtaggatcccacagctcgccatcctcattc 159
|||||||||||||||||||||||||||||||||||||
Sbjct: 469 aatggatgtaggatcccacagctcgccatcctcattc 433
>gb|CL158361.1|CL158361 104_347_10803488_116_31378_080 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803488, DNA
sequence
Length = 731
Score = 295 bits (149), Expect = 1e-078
Identities = 155/157 (98%)
Strand = Plus / Plus
Query: 3 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 62
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 306
Query: 63 atgccatgacttatccagtggcttggtattgccgtaaaaggacatcagcccagctgttag 122
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 307 atgccatgacttatccagtggcttggtattgccatagaaggacatcagcccagctgttag 366
Query: 123 aatggatgtaggatcccacagctcgccatcctcattc 159
|||||||||||||||||||||||||||||||||||||
Sbjct: 367 aatggatgtaggatcccacagctcgccatcctcattc 403
>gb|CF675663.1|CF675663 MtN3 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone MtN3 similar to
MtN3-like protein, mRNA sequence
Length = 194
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 306 gtacctcggccgcgaccacgcta 328
|||||||||||||||||||||||
Sbjct: 143 gtacctcggccgcgaccacgcta 165
>gb|DR831467.1|DR831467 MM71 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 751
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 306 gtacctcggccgcgaccacgcta 328
|||||||||||||||||||||||
Sbjct: 127 gtacctcggccgcgaccacgcta 105
>gb|DV162814.1|DV162814 P1-N10 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 198
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 306 gtacctcggccgcgaccacgcta 328
|||||||||||||||||||||||
Sbjct: 95 gtacctcggccgcgaccacgcta 117
>gb|DV162815.1|DV162815 P3-J15 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 229
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 306 gtacctcggccgcgaccacgcta 328
|||||||||||||||||||||||
Sbjct: 40 gtacctcggccgcgaccacgcta 18
>gb|DR831427.1|DR831427 MT54 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 199
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 306 gtacctcggccgcgaccacgct 327
||||||||||||||||||||||
Sbjct: 22 gtacctcggccgcgaccacgct 1
>gb|DR831556.2|DR831556 MT75 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 309
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 306 gtacctcggccgcgaccacgct 327
||||||||||||||||||||||
Sbjct: 205 gtacctcggccgcgaccacgct 226
>gb|DR831428.1|DR831428 MM77 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 299
Score = 40.1 bits (20), Expect = 0.12
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 306 gtacctcggccgcgaccacg 325
||||||||||||||||||||
Sbjct: 22 gtacctcggccgcgaccacg 3
>gb|CW052847.1|CW052847 104_292_10515652_114_30286 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515652, DNA
sequence
Length = 750
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 242 atgcacaggcattgggatt 260
|||||||||||||||||||
Sbjct: 696 atgcacaggcattgggatt 714
>gb|CW144377.1|CW144377 104_536_11137911_148_34962_056 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11137911, DNA
sequence
Length = 622
Score = 38.2 bits (19), Expect = 0.48
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 61 acatgccatgacttatccagtgg 83
|||||||||||||| ||||||||
Sbjct: 372 acatgccatgacttgtccagtgg 350
>gb|CF487333.1|CF487333 POL1_43_D11.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_43_D11_A002 3', mRNA sequence
Length = 661
Score = 38.2 bits (19), Expect = 0.48
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 61 acatgccatgacttatccagtgg 83
|||||||||||||| ||||||||
Sbjct: 231 acatgccatgacttgtccagtgg 209
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 67,511
Number of Sequences: 832831
Number of extensions: 67511
Number of successful extensions: 17567
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17555
Number of HSP's gapped (non-prelim): 12
length of query: 328
length of database: 491,359,669
effective HSP length: 19
effective length of query: 309
effective length of database: 475,535,880
effective search space: 146940586920
effective search space used: 146940586920
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)