BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE20c02.yg.2.1
(696 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF587276.1|BF587276 FM1_34_D09.b1_A003 Floral-Induced Me... 460 e-128
gb|CW299014.1|CW299014 104_781_11462882_116_35659_001 Sorgh... 299 2e-079
gb|CW299015.1|CW299015 104_781_11462882_148_35655_001 Sorgh... 299 2e-079
gb|BG050964.1|BG050964 FM1_54_E04.b1_A003 Floral-Induced Me... 159 4e-037
gb|BM324257.1|BM324257 PIC1_26_B11.b1_A002 Pathogen-infecte... 105 5e-021
gb|BI075368.1|BI075368 IP1_19_F12.b1_A002 Immature pannicle... 92 8e-017
gb|CW053211.1|CW053211 104_293_10515837_114_30184 Sorghum m... 72 8e-011
gb|BZ367054.1|BZ367054 id02b04.g1 WGS-SbicolorF (JM107 adap... 68 1e-009
gb|CL165780.1|CL165780 104_361_10808896_114_31820_112 Sorgh... 68 1e-009
gb|CW053338.1|CW053338 104_293_10515908_114_30185 Sorghum m... 64 2e-008
gb|BZ367053.1|BZ367053 id02b04.b1 WGS-SbicolorF (JM107 adap... 56 4e-006
gb|CL165781.1|CL165781 104_361_10808896_116_31821_112 Sorgh... 56 4e-006
gb|CW092082.1|CW092082 104_454_10998932_116_33041_074 Sorgh... 56 4e-006
gb|CW241422.1|CW241422 104_700_11218762_148_37541_037 Sorgh... 56 4e-006
gb|CW304526.1|CW304526 104_789_11465829_116_35701_087 Sorgh... 56 4e-006
gb|AW922447.1|AW922447 DG1_19_F09.g1_A002 Dark Grown 1 (DG1... 56 4e-006
gb|BF177056.1|BF177056 EM1_3_A09.g1_A002 Embryo 1 (EM1) Sor... 56 4e-006
gb|BF177065.1|BF177065 EM1_3_B09.g1_A002 Embryo 1 (EM1) Sor... 56 4e-006
gb|BF481476.1|BF481476 FM1_19_F05.g1_A003 Floral-Induced Me... 56 4e-006
gb|BF704987.1|BF704987 RHIZ2_1_A02.g1_A003 Rhizome2 (RHIZ2)... 56 4e-006
gb|BG239805.1|BG239805 OV1_29_C04.g1_A002 Ovary 1 (OV1) Sor... 56 4e-006
gb|BG412484.1|BG412484 OV2_34_H07.g1_A002 Ovary 2 (OV2) Sor... 56 4e-006
gb|BG412794.1|BG412794 OV2_34_H07.b1_A002 Ovary 2 (OV2) Sor... 56 4e-006
gb|BG412795.1|BG412795 OV2_34_H08.b1_A002 Ovary 2 (OV2) Sor... 56 4e-006
gb|BG948068.1|BG948068 IP1_9_A05.g1_A002 Immature pannicle ... 56 4e-006
gb|BI074347.1|BI074347 IP1_14_E12.g1_A002 Immature pannicle... 56 4e-006
gb|BI075107.1|BI075107 IP1_19_F12.g1_A002 Immature pannicle... 56 4e-006
gb|BI075135.1|BI075135 IP1_19_D09.g1_A002 Immature pannicle... 56 4e-006
gb|CW164218.1|CW164218 104_572_11151871_116_36465_030 Sorgh... 52 7e-005
gb|CW188764.1|CW188764 104_608_11173219_116_36729_068 Sorgh... 50 3e-004
gb|CW053212.1|CW053212 104_293_10515837_115_30191 Sorghum m... 48 0.001
gb|CW053339.1|CW053339 104_293_10515908_115_30191 Sorghum m... 48 0.001
gb|CW116495.1|CW116495 104_492_11107149_116_34608_093 Sorgh... 48 0.001
gb|BG356885.1|BG356885 OV2_11_C02.g1_A002 Ovary 2 (OV2) Sor... 48 0.001
gb|BM328758.1|BM328758 PIC1_26_B11.g1_A002 Pathogen-infecte... 48 0.001
gb|CD431007.1|CD431007 ETH1_6_B01.b1_A002 Ethylene-treated ... 48 0.001
gb|BI075510.1|BI075510 IP1_21_D08.g1_A002 Immature pannicle... 44 0.017
gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from ... 42 0.067
gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library fro... 40 0.26
gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-respon... 40 0.26
gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-resp... 40 0.26
gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.26
gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-respo... 40 0.26
gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.26
>gb|BF587276.1|BF587276 FM1_34_D09.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 503
Score = 460 bits (232), Expect = e-128
Identities = 301/330 (91%)
Strand = Plus / Minus
Query: 321 attaatggatcaagaaaccaaccaatatggaagtccctggccctttgcgctgctttttga 380
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 503 attaatggatcaagaaaccaaccaatatggaagtccctggccctttgcgctgctgcttga 444
Query: 381 tcttcagttgagtttgtaaaaggttcataccagttgaagtcaagaactatcccgaccttg 440
|||||||||||||| |||| ||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 443 tcttcagttgagttggtaagaggttcataccagttgaagtctagaactatcccaaccttg 384
Query: 441 cctttctgagttgcctggtatttattgcggtatcttgcaactgcagtagcatgagatagg 500
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 383 cctttctgagttgcctggtatttattgcggtatcttgcaacagcagtagcatgagataag 324
Query: 501 agaatgttatgaacaacaatgtaaggttctgtcgatgagttcncacnngcagtgcattgt 560
|| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||
Sbjct: 323 aggatgttatgaacaacaatgtaaggttctgtcgatgagttcccaccggcagtgcattgt 264
Query: 561 gtgcaccnnnnaggggggnnaagccctttatcataaccaannaatgctactatccttggc 620
||||||| ||||||| || ||||||||||||||||| |||| |||||||||||||
Sbjct: 263 gtgcaccgattaggggggtcaatccctttatcataaccaaggaatgatactatccttggc 204
Query: 621 tcatntaatnnnnnccagtncttgactcga 650
|||| |||| ||||| ||||||||||
Sbjct: 203 tcatttaatgtgaaccagttcttgactcga 174
>gb|CW299014.1|CW299014 104_781_11462882_116_35659_001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11462882, DNA
sequence
Length = 662
Score = 299 bits (151), Expect = 2e-079
Identities = 199/215 (92%)
Strand = Plus / Plus
Query: 125 atattggacgccccagtcggacgagtagctcggtggtccctgcggaggagtttgttgatc 184
|||||| || |||||||| ||||||||||| |||||||| ||| ||| |||||||||||
Sbjct: 320 atattgaacaccccagtcagacgagtagcttggtggtccttgctgagtagtttgttgatt 379
Query: 185 tgcaatgtagtatgtagtatattgattgatcccgaaatagtctgatgagcccttgactag 244
|| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 tgaaatgtagtttgttgtatattgattgatcccgaaatagtctgatgagcccttgactag 439
Query: 245 cttggcctgttcaggtgtgaaacttggtagccggtctttcacaatgtcttgcattatctt 304
||| ||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||
Sbjct: 440 cttagcctgttcaggtgtgaaacttggtagccgatctttcacaatgtcctgcattgtctt 499
Query: 305 tggatattgcccatttattaatggatcaagaaacc 339
||||||||| |||||||||||||||||||||||||
Sbjct: 500 tggatattgtccatttattaatggatcaagaaacc 534
Score = 99.6 bits (50), Expect = 3e-019
Identities = 65/70 (92%)
Strand = Plus / Plus
Query: 16 ggtacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagcc 75
|||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||
Sbjct: 15 ggtacttttcctttaggtaggtgacgactccatacatgcccgttgggacgatgtaaagcc 74
Query: 76 aaattgagtg 85
| | ||||||
Sbjct: 75 agactgagtg 84
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 341 accaatatggaagtccctggccctttgcgctgctttttgatctt 384
|||||||||||| ||||||||||||||||||||| ||||||||
Sbjct: 619 accaatatggaaatccctggccctttgcgctgctgcttgatctt 662
>gb|CW299015.1|CW299015 104_781_11462882_148_35655_001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11462882, DNA
sequence
Length = 710
Score = 299 bits (151), Expect = 2e-079
Identities = 199/215 (92%)
Strand = Plus / Minus
Query: 125 atattggacgccccagtcggacgagtagctcggtggtccctgcggaggagtttgttgatc 184
|||||| || |||||||| ||||||||||| |||||||| ||| ||| |||||||||||
Sbjct: 439 atattgaacaccccagtcagacgagtagcttggtggtccttgctgagtagtttgttgatt 380
Query: 185 tgcaatgtagtatgtagtatattgattgatcccgaaatagtctgatgagcccttgactag 244
|| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tgaaatgtagtttgttgtatattgattgatcccgaaatagtctgatgagcccttgactag 320
Query: 245 cttggcctgttcaggtgtgaaacttggtagccggtctttcacaatgtcttgcattatctt 304
||| ||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||
Sbjct: 319 cttagcctgttcaggtgtgaaacttggtagccgatctttcacaatgtcctgcattgtctt 260
Query: 305 tggatattgcccatttattaatggatcaagaaacc 339
||||||||| |||||||||||||||||||||||||
Sbjct: 259 tggatattgtccatttattaatggatcaagaaacc 225
Score = 174 bits (88), Expect = 7e-042
Identities = 112/120 (93%)
Strand = Plus / Minus
Query: 337 accaaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttg 396
|||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||| |
Sbjct: 144 accaaccaatatggaaatccctggccctttgcgctgctgcttgatcttcggttgagttgg 85
Query: 397 taaaaggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcct 456
||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 84 taagaggttcataccagttgaagtctagaactatcccaaccttgcctttctgagttgcct 25
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 50 catgcccgatgggacgatgtaaagccaaattgagtg 85
|||||||| |||||||||||||||||| | ||||||
Sbjct: 710 catgcccgttgggacgatgtaaagccagactgagtg 675
>gb|BG050964.1|BG050964 FM1_54_E04.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 447
Score = 159 bits (80), Expect = 4e-037
Identities = 251/308 (81%)
Strand = Plus / Minus
Query: 222 tagtctgatgagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtct 281
||||||| ||||||||||| | || || || ||||| ||||| || ||||||| |||
Sbjct: 322 tagtctgccgagcccttgaccaatttagcttgctcaggagtgaacctgggtagcctctct 263
Query: 282 ttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaaccaa 341
||||||| ||||||||||| | |||||| || |||||||| |||||||||| ||||||
Sbjct: 262 ttcacaagatcttgcattatttgtggataatgtccatttatcaatggatcaacaaaccag 203
Query: 342 ccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttgtaaaa 401
||||| ||||||||||| || ||||| |||||| || || |||| ||||||||||| |
Sbjct: 202 ccaatgtggaagtccctagctctttgggctgctgcctggtcatcaggtgagtttgtaaga 143
Query: 402 ggttcataccagttgaagtcaagaactatcccgaccttgcctttctgagttgcctggtat 461
| |||||||||||||||||| || || || || ||||| || ||||| | ||||| |||
Sbjct: 142 gcttcataccagttgaagtccaggacaattccaaccttacccttctgggcagcctgatat 83
Query: 462 ttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatg 521
|| | ||||||||||||||||||| |||||| | | ||||| |||||| |||||||
Sbjct: 82 tttgtacggtatcttgcaactgcagcagcatgtgccaagagaaaattatgagcaacaata 23
Query: 522 taaggttc 529
||||||||
Sbjct: 22 taaggttc 15
>gb|BM324257.1|BM324257 PIC1_26_B11.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 487
Score = 105 bits (53), Expect = 5e-021
Identities = 125/149 (83%)
Strand = Plus / Minus
Query: 381 tcttcagttgagtttgtaaaaggttcataccagttgaagtcaagaactatcccgaccttg 440
||||||||||||||||| | |||||| ||||| |||||||| |||||||| || |||||
Sbjct: 482 tcttcagttgagtttgtgagaggttcgtaccaattgaagtccagaactattccaaccttt 423
Query: 441 cctttctgagttgcctggtatttattgcggtatcttgcaactgcagtagcatgagatagg 500
|||||||||| ||||| || ||||| ||||||||||| || |||| |||||| || | |
Sbjct: 422 cctttctgagcagcctgatacttattacggtatcttgccaccgcagcagcatgtgacaag 363
Query: 501 agaatgttatgaacaacaatgtaaggttc 529
|||| |||||| |||| || ||||||||
Sbjct: 362 agaaaattatgagcaacgatataaggttc 334
Score = 50.1 bits (25), Expect = 3e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 590 atcataaccaannaatgctactatccttggctcat 624
||||||||||| | ||||||||||||||||||||
Sbjct: 273 atcataaccaagtagtgctactatccttggctcat 239
>gb|BI075368.1|BI075368 IP1_19_F12.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 620
Score = 91.7 bits (46), Expect = 8e-017
Identities = 121/146 (82%)
Strand = Plus / Minus
Query: 222 tagtctgatgagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtct 281
||||||| ||||||||||| | || || || ||||| ||||| || ||||||| |||
Sbjct: 158 tagtctgccgagcccttgaccaatttagcttgctcaggagtgaacctgggtagcctctct 99
Query: 282 ttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaaccaa 341
||||||| ||||||||||| | |||||| || |||||||| |||||||||| ||||||
Sbjct: 98 ttcacaagatcttgcattatttgtggataatgtccatttatcaatggatcaacaaaccag 39
Query: 342 ccaatatggaagtccctggccctttg 367
||||| ||||||||||| || |||||
Sbjct: 38 ccaatgtggaagtccctagctctttg 13
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 594 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 535
>gb|CW053211.1|CW053211 104_293_10515837_114_30184 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515837, DNA
sequence
Length = 664
Score = 71.9 bits (36), Expect = 8e-011
Identities = 60/68 (88%)
Strand = Plus / Minus
Query: 383 ttcagttgagtttgtaaaaggttcataccagttgaagtcaagaactatcccgaccttgcc 442
||||||||||||||| | |||||| ||||| |||||||| |||||||| || ||||| ||
Sbjct: 664 ttcagttgagtttgtgagaggttcgtaccaattgaagtccagaactattccaacctttcc 605
Query: 443 tttctgag 450
||||||||
Sbjct: 604 tttctgag 597
Score = 50.1 bits (25), Expect = 3e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 590 atcataaccaannaatgctactatccttggctcat 624
||||||||||| | ||||||||||||||||||||
Sbjct: 74 atcataaccaagtagtgctactatccttggctcat 40
Score = 40.1 bits (20), Expect = 0.26
Identities = 56/68 (82%)
Strand = Plus / Minus
Query: 462 ttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatg 521
||||| ||||||||||| || |||| |||||| || | ||||| |||||| |||| ||
Sbjct: 202 ttattacggtatcttgccaccgcagcagcatgtgacaagagaaaattatgagcaacgata 143
Query: 522 taaggttc 529
||||||||
Sbjct: 142 taaggttc 135
>gb|BZ367054.1|BZ367054 id02b04.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone id02b04 5', DNA sequence
Length = 617
Score = 67.9 bits (34), Expect = 1e-009
Identities = 97/118 (82%)
Strand = Plus / Minus
Query: 222 tagtctgatgagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtct 281
||||||| ||||||||||| | || || || ||||| ||||| || ||||||| |||
Sbjct: 277 tagtctgccgagcccttgaccaatttagcttgctcaggagtgaacctgggtagcctctct 218
Query: 282 ttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaacc 339
||||||| ||||||||||| | |||||| || |||||||| |||||||||| |||||
Sbjct: 217 ttcacaagatcttgcattatttgtggataatgtccatttatcaatggatcaacaaacc 160
Score = 46.1 bits (23), Expect = 0.004
Identities = 53/63 (84%)
Strand = Plus / Minus
Query: 337 accaaccaatatggaagtccctggccctttgcgctgctttttgatcttcagttgagtttg 396
|||| ||||| ||||||||||| || ||||| |||||| ||| || |||| ||||||||
Sbjct: 70 accagccaatgtggaagtccctagctctttgggctgctgcttggtcatcaggtgagtttg 11
Query: 397 taa 399
|||
Sbjct: 10 taa 8
>gb|CL165780.1|CL165780 104_361_10808896_114_31820_112 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10808896, DNA
sequence
Length = 682
Score = 67.9 bits (34), Expect = 1e-009
Identities = 97/118 (82%)
Strand = Plus / Minus
Query: 222 tagtctgatgagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtct 281
||||||| ||||||||||| | || || || ||||| ||||| || ||||||| |||
Sbjct: 257 tagtctgccgagcccttgaccaatttagcttgctcaggagtgaacctgggtagcctctct 198
Query: 282 ttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaacc 339
||||||| ||||||||||| | |||||| || |||||||| |||||||||| |||||
Sbjct: 197 ttcacaagatcttgcattatttgtggataatgtccatttatcaatggatcaacaaacc 140
Score = 48.1 bits (24), Expect = 0.001
Identities = 42/48 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 681 aggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 634
>gb|CW053338.1|CW053338 104_293_10515908_114_30185 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515908, DNA
sequence
Length = 660
Score = 63.9 bits (32), Expect = 2e-008
Identities = 56/64 (87%)
Strand = Plus / Minus
Query: 387 gttgagtttgtaaaaggttcataccagttgaagtcaagaactatcccgaccttgcctttc 446
||||||||||| | |||||| ||||| |||||||| |||||||| || ||||| ||||||
Sbjct: 660 gttgagtttgtgagaggttcgtaccaattgaagtccagaactattccaacctttcctttc 601
Query: 447 tgag 450
||||
Sbjct: 600 tgag 597
Score = 50.1 bits (25), Expect = 3e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 590 atcataaccaannaatgctactatccttggctcat 624
||||||||||| | ||||||||||||||||||||
Sbjct: 74 atcataaccaagtagtgctactatccttggctcat 40
Score = 40.1 bits (20), Expect = 0.26
Identities = 56/68 (82%)
Strand = Plus / Minus
Query: 462 ttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatg 521
||||| ||||||||||| || |||| |||||| || | ||||| |||||| |||| ||
Sbjct: 202 ttattacggtatcttgccaccgcagcagcatgtgacaagagaaaattatgagcaacgata 143
Query: 522 taaggttc 529
||||||||
Sbjct: 142 taaggttc 135
>gb|BZ367053.1|BZ367053 id02b04.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone id02b04 5', DNA sequence
Length = 619
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 406 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 465
>gb|CL165781.1|CL165781 104_361_10808896_116_31821_112 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10808896, DNA
sequence
Length = 574
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 115 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 174
>gb|CW092082.1|CW092082 104_454_10998932_116_33041_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10998932, DNA
sequence
Length = 670
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 308 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 249
>gb|CW241422.1|CW241422 104_700_11218762_148_37541_037 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218762, DNA
sequence
Length = 644
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 453 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 512
>gb|CW304526.1|CW304526 104_789_11465829_116_35701_087 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11465829, DNA
sequence
Length = 610
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 437 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 378
>gb|AW922447.1|AW922447 DG1_19_F09.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 634
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 145 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 86
>gb|BF177056.1|BF177056 EM1_3_A09.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 636
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| |||||||||||||||||||||||
Sbjct: 151 ccatacatccccgatgggacgatgtaaagcca 120
>gb|BF177065.1|BF177065 EM1_3_B09.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 620
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| |||||||||||||||||||||||
Sbjct: 187 ccatacatccccgatgggacgatgtaaagcca 156
>gb|BF481476.1|BF481476 FM1_19_F05.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 500
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 78 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 19
>gb|BF704987.1|BF704987 RHIZ2_1_A02.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA,
mRNA sequence
Length = 479
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 87 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 28
>gb|BG239805.1|BG239805 OV1_29_C04.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 526
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 73 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 14
>gb|BG412484.1|BG412484 OV2_34_H07.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 654
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 66 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 7
>gb|BG412794.1|BG412794 OV2_34_H07.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 562
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 293 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 234
Score = 42.1 bits (21), Expect = 0.067
Identities = 72/89 (80%)
Strand = Plus / Minus
Query: 222 tagtctgatgagcccttgactagcttggcctgttcaggtgtgaaacttggtagccggtct 281
||||||| ||||||||||| | || || || ||||| ||||| || ||||||| |||
Sbjct: 89 tagtctgccgagcccttgaccaatttagcttgctcaggagtgaacctgggtagcctctct 30
Query: 282 ttcacaatgtcttgcattatctttggata 310
||||||| ||||||||||| | ||||||
Sbjct: 29 ttcacaagatcttgcattatttgtggata 1
>gb|BG412795.1|BG412795 OV2_34_H08.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 492
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 293 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 234
>gb|BG948068.1|BG948068 IP1_9_A05.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 636
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 155 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 96
>gb|BI074347.1|BI074347 IP1_14_E12.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor
cDNA, mRNA sequence
Length = 576
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 60 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 1
>gb|BI075107.1|BI075107 IP1_19_F12.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor
cDNA, mRNA sequence
Length = 592
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 66 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 7
>gb|BI075135.1|BI075135 IP1_19_D09.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor
cDNA, mRNA sequence
Length = 553
Score = 56.0 bits (28), Expect = 4e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 68 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 9
>gb|CW164218.1|CW164218 104_572_11151871_116_36465_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11151871, DNA
sequence
Length = 758
Score = 52.0 bits (26), Expect = 7e-005
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 468 cggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatgtaaggt 527
||||||||||||||||||| |||||| | | ||||| |||||| ||||||| ||||||
Sbjct: 123 cggtatcttgcaactgcagcagcatgtgccaagagaaaattatgagcaacaatataaggt 182
Query: 528 tc 529
||
Sbjct: 183 tc 184
>gb|CW188764.1|CW188764 104_608_11173219_116_36729_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11173219, DNA
sequence
Length = 632
Score = 50.1 bits (25), Expect = 3e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 590 atcataaccaannaatgctactatccttggctcat 624
||||||||||| | ||||||||||||||||||||
Sbjct: 534 atcataaccaagtagtgctactatccttggctcat 568
Score = 40.1 bits (20), Expect = 0.26
Identities = 56/68 (82%)
Strand = Plus / Plus
Query: 462 ttattgcggtatcttgcaactgcagtagcatgagataggagaatgttatgaacaacaatg 521
||||| ||||||||||| || |||| |||||| || | ||||| |||||| |||| ||
Sbjct: 406 ttattacggtatcttgccaccgcagcagcatgtgacaagagaaaattatgagcaacgata 465
Query: 522 taaggttc 529
||||||||
Sbjct: 466 taaggttc 473
>gb|CW053212.1|CW053212 104_293_10515837_115_30191 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515837, DNA
sequence
Length = 585
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| ||||||||||| |||||||||||
Sbjct: 544 ccatacatccccgatgggacaatgtaaagcca 575
>gb|CW053339.1|CW053339 104_293_10515908_115_30191 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515908, DNA
sequence
Length = 582
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| ||||||||||| |||||||||||
Sbjct: 544 ccatacatccccgatgggacaatgtaaagcca 575
>gb|CW116495.1|CW116495 104_492_11107149_116_34608_093 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11107149, DNA
sequence
Length = 436
Score = 48.1 bits (24), Expect = 0.001
Identities = 42/48 (87%)
Strand = Plus / Minus
Query: 30 aggtagttcacgactccatacatgcccgatgggacgatgtaaagccaa 77
||||||||||| ||||||||| |||| ||||||||||||||||||
Sbjct: 212 aggtagttcacacatccatacatccccgtcgggacgatgtaaagccaa 165
>gb|BG356885.1|BG356885 OV2_11_C02.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 545
Score = 48.1 bits (24), Expect = 0.001
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaaag 73
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||||
Sbjct: 56 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaaag 1
>gb|BM328758.1|BM328758 PIC1_26_B11.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 538
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| ||||||||||| |||||||||||
Sbjct: 48 ccatacatccccgatgggacaatgtaaagcca 17
>gb|CD431007.1|CD431007 ETH1_6_B01.b1_A002 Ethylene-treated seedlings Sorghum bicolor
cDNA clone ETH1_6_B01_A002 3', mRNA sequence
Length = 609
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 45 ccatacatgcccgatgggacgatgtaaagcca 76
|||||||| ||||||||||| |||||||||||
Sbjct: 99 ccatacatccccgatgggacaatgtaaagcca 68
>gb|BI075510.1|BI075510 IP1_21_D08.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor
cDNA, mRNA sequence
Length = 539
Score = 44.1 bits (22), Expect = 0.017
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 18 tacttttcctttaggtagttcacgactccatacatgcccgatgggacgatgtaa 71
||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||
Sbjct: 54 tacttctccttgaggtagttcacacatccatacatccccgtcgggacgatgtaa 1
>gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone THAU2 similar to
Thaumatin-like protein, mRNA sequence
Length = 747
Score = 42.1 bits (21), Expect = 0.067
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtact 21
|||||||||||||||||||||
Sbjct: 211 gcggccgcccgggcaggtact 191
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 204 gcggccgcccgggcaggtac 223
>gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone RUBISCO similar to
Ribulose 1,5-biphosphate carboxylase, mRNA sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 225 gcggccgcccgggcaggtac 244
>gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 112
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 2 gcggccgcccgggcaggtac 21
>gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 282
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 32 gcggccgcccgggcaggtac 51
>gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 234
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtac 65
>gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 223
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 119 gcggccgcccgggcaggtac 100
>gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 172
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 21 gcggccgcccgggcaggtac 2
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 124,606
Number of Sequences: 832831
Number of extensions: 124606
Number of successful extensions: 33566
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33499
Number of HSP's gapped (non-prelim): 67
length of query: 696
length of database: 491,359,669
effective HSP length: 20
effective length of query: 676
effective length of database: 474,703,049
effective search space: 320899261124
effective search space used: 320899261124
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)