BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5705280.3.1
(980 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW345046.1|CW345046 104_848_11488281_148_36206_047 Sorgh... 234 1e-059
gb|CL177792.1|CL177792 104_385_10894083_116_31914_147 Sorgh... 127 2e-027
gb|CW055906.1|CW055906 104_297_10517394_114_30172 Sorghum m... 123 3e-026
gb|AW672145.1|AW672145 LG1_357_A10.b1_A002 Light Grown 1 (L... 111 1e-022
gb|CL177793.1|CL177793 104_385_10894083_148_31913_147 Sorgh... 88 2e-015
gb|CW303573.1|CW303573 104_788_11465310_148_35698_029 Sorgh... 56 6e-006
gb|CW360370.1|CW360370 fsbb001f028g20f0 Sorghum methylation... 54 3e-005
gb|CW345045.1|CW345045 104_848_11488281_116_36205_047 Sorgh... 50 4e-004
gb|CW197544.1|CW197544 104_621_11181743_116_36821_082 Sorgh... 38 1.5
gb|CW218470.1|CW218470 104_652_11196207_148_37529_062 Sorgh... 38 1.5
gb|CW338081.1|CW338081 104_838_11484553_148_36127_011 Sorgh... 38 1.5
gb|CW458820.1|CW458820 fsbb001f205e15f0 Sorghum methylation... 38 1.5
gb|CL699195.2|CL699195 SP__Ba0043E05.f SP__Ba Sorghum propi... 38 1.5
gb|BZ691957.1|BZ691957 SP__Ba0014M03.r SP__Ba Sorghum propi... 36 5.9
gb|CW099303.1|CW099303 104_466_11003477_148_34376_027 Sorgh... 36 5.9
gb|CW145291.1|CW145291 104_537_11138390_116_34975_051 Sorgh... 36 5.9
gb|CW145292.1|CW145292 104_537_11138390_148_34971_051 Sorgh... 36 5.9
gb|CW209235.1|CW209235 104_639_11189125_116_36989_061 Sorgh... 36 5.9
gb|CW224982.1|CW224982 104_662_11204109_116_37203_089 Sorgh... 36 5.9
gb|CW256622.1|CW256622 104_721_11226890_148_35145_003 Sorgh... 36 5.9
gb|CW302547.1|CW302547 104_786_11464777_116_35664_003 Sorgh... 36 5.9
gb|CW316565.1|CW316565 104_808_11472959_116_35853_096 Sorgh... 36 5.9
gb|CW324142.1|CW324142 104_818_11477000_116_35903_022 Sorgh... 36 5.9
gb|CW324143.1|CW324143 104_818_11477000_148_35907_022 Sorgh... 36 5.9
gb|CW405880.1|CW405880 fsbb001f098k01k0 Sorghum methylation... 36 5.9
gb|CW409795.1|CW409795 fsbb001f104e02f0 Sorghum methylation... 36 5.9
gb|CW413801.1|CW413801 fsbb001f113c06f0 Sorghum methylation... 36 5.9
gb|CW450674.1|CW450674 fsbb001f189g21k0 Sorghum methylation... 36 5.9
gb|CW474440.1|CW474440 fsbb001f230e19f0 Sorghum methylation... 36 5.9
gb|CW475986.1|CW475986 fsbb001f232k02f0 Sorghum methylation... 36 5.9
gb|CW498758.1|CW498758 fsbb001f293c15k0 Sorghum methylation... 36 5.9
gb|BM324590.1|BM324590 PIC1_33_B03.b1_A002 Pathogen-infecte... 36 5.9
gb|CD206213.1|CD206213 HS1_21_H07.b1_A012 Heat-shocked seed... 36 5.9
gb|CD431174.1|CD431174 ETH1_7_E07.b1_A002 Ethylene-treated ... 36 5.9
gb|CN142793.1|CN142793 WOUND1_12_F05.b1_A002 Wounded leaves... 36 5.9
>gb|CW345046.1|CW345046 104_848_11488281_148_36206_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488281, DNA
sequence
Length = 696
Score = 234 bits (118), Expect = 1e-059
Identities = 289/345 (83%), Gaps = 12/345 (3%)
Strand = Plus / Minus
Query: 60 tggtccgttgctgtccatcggaaacagcatgcttgggattcttgacatctcgttgcttga 119
|||||||| |||| |||| || |||||| || ||||||||||||||||||| ||||| ||
Sbjct: 340 tggtccgtcgctgcccattgggaacagcgtgtttgggattcttgacatctcattgctgga 281
Query: 120 tggtcttgtgagcatattggctagtgctagttctcagcagtgcataggagggacggcgaa 179
|||| |||||| |||| |||||||| || ||||||||||||| |||| |||
Sbjct: 280 tggttttgtgaccatagcagctagtgccagctctcagcagtgca----aggg-----gaa 230
Query: 180 ctctagcgttaaccttgaggggaccgtcttcacattctcagacacaaggaacaagttcac 239
||||||| ||| ||||||||| ||| ||||||||| |||||| ||||| |||||||||||
Sbjct: 229 ctctagctttacccttgagggtaccatcttcacatactcagatacaagaaacaagttcac 170
Query: 240 agctctgggttgtaacgtggtggccatgcttttgaatggcagca---cggggtatagcgg 296
|||||||||||||||||||||||||||||| ||||||||||| | ||||||| |||
Sbjct: 169 agctctgggttgtaacgtggtggccatgctgttgaatggcagtagtggtgggtataccgg 110
Query: 297 tggctgtgcttccttttgctctagtggaaataacatcatcgacggctcatgctctggggt 356
||||||||||||||||||||||| | |||| ||| | | || || |||||||| ||
Sbjct: 109 tggctgtgcttccttttgctctaccaaagataatatcgttaatggttcgtgctctggtgt 50
Query: 357 ggcttgctgccaagcgccggttcccaaagggctaaagaagctgga 401
||||||||||||||| ||||| || ||||||||||||||| ||||
Sbjct: 49 ggcttgctgccaagctccggtgccgaaagggctaaagaagatgga 5
>gb|CL177792.1|CL177792 104_385_10894083_116_31914_147 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894083, DNA
sequence
Length = 689
Score = 127 bits (64), Expect = 2e-027
Identities = 153/182 (84%), Gaps = 3/182 (1%)
Strand = Plus / Minus
Query: 538 cctcaataccgacatgttgtgctcgagtggtctgtgaacggcagcagctgtgaagaggcg 597
||||||||||||| ||||||||| ||||||||| | | || ||||||||||||||||
Sbjct: 425 cctcaataccgacctgttgtgcttgagtggtctatagatggtggcagctgtgaagaggca 366
Query: 598 aaactgtccgg---atcatacgcctgcgcagagaatgcctactgctacaactcatcaaac 654
|||| |||| ||| || |||||| |||||| ||||||||||||||||| ||||
Sbjct: 365 aaacagtcctccacatcgtatgcctgccgggagaatacctactgctacaactcaccaaat 306
Query: 655 ggaatcggttaccgctgcaattgctccagtggattcgaggggaacccatacctgcaaggg 714
||||| ||||||||||||||||||||| |||||| |||||||||||||||||| ||||
Sbjct: 305 ggaattggttaccgctgcaattgctccgatggatttcaggggaacccatacctgccaggg 246
Query: 715 cc 716
||
Sbjct: 245 cc 244
Score = 95.6 bits (48), Expect = 7e-018
Identities = 137/166 (82%), Gaps = 3/166 (1%)
Strand = Plus / Minus
Query: 253 aacgtggtggccatgcttttgaatggcagcacggg---gtatagcggtggctgtgcttcc 309
||||||||||||||||| ||||||||||| | || ||||| ||||||||||||||||
Sbjct: 689 aacgtggtggccatgctgttgaatggcagtagtggtgggtataccggtggctgtgcttcc 630
Query: 310 ttttgctctagtggaaataacatcatcgacggctcatgctctggggtggcttgctgccaa 369
|||||||||| | |||| ||| | | || || || ||||| |||||||||||||||
Sbjct: 629 ttttgctctaccaaagataatatcgttaatggttcgtgttctggtgtggcttgctgccaa 570
Query: 370 gcgccggttcccaaagggctaaagaagctggacttagagttcagta 415
|| ||||| || ||||||||||||||| |||| |||| |||||||
Sbjct: 569 gctccggtgccgaaagggctaaagaagatggagctagaattcagta 524
Score = 67.9 bits (34), Expect = 2e-009
Identities = 76/90 (84%)
Strand = Plus / Minus
Query: 729 agatattaatgaatgcatcaccagaaatccgtgcaccaataggtgctcaaacacaatagg 788
||||||| ||||||||| |||||||||||||||||| ||| |||| ||||||| |
Sbjct: 90 agatattgatgaatgcaccaccagaaatccgtgcacacataagtgcgtcaacacaaaacc 31
Query: 789 tggtttccagtgcacgtgcccagcagggat 818
||||||||| |||| |||||| ||||||||
Sbjct: 30 tggtttccactgcaggtgccccgcagggat 1
>gb|CW055906.1|CW055906 104_297_10517394_114_30172 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10517394, DNA
sequence
Length = 339
Score = 123 bits (62), Expect = 3e-026
Identities = 119/138 (86%)
Strand = Plus / Minus
Query: 729 agatattaatgaatgcatcaccagaaatccgtgcaccaataggtgctcaaacacaatagg 788
||||||| ||||||||| |||||||||||||||||| ||| |||| ||||||| |
Sbjct: 339 agatattgatgaatgcaccaccagaaatccgtgcacacataagtgcgtcaacacaaaacc 280
Query: 789 tggtttccagtgcacgtgcccagcagggatgagcggcgacggcctcaaggaaggaagtgg 848
||||||||| |||| |||||| ||||||||||||||||| ||| |||| || ||||||||
Sbjct: 279 tggtttccactgcaggtgccccgcagggatgagcggcgatggcttcaaagagggaagtgg 220
Query: 849 ttgcaatggagtaagcac 866
||||||||||||| ||||
Sbjct: 219 ttgcaatggagtaggcac 202
Score = 99.6 bits (50), Expect = 5e-019
Identities = 71/78 (91%)
Strand = Plus / Minus
Query: 893 tagctctgctagtgcttctcctcatccttggcttctggactcactggcttggtaagaaga 952
|||||||||||||||||||| | || ||||| |||||||| || ||||||| ||||||||
Sbjct: 83 tagctctgctagtgcttctctttattcttggtttctggacccattggcttgttaagaaga 24
Query: 953 ggaaacttgcaaagacaa 970
||||||||||||||||||
Sbjct: 23 ggaaacttgcaaagacaa 6
>gb|AW672145.1|AW672145 LG1_357_A10.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 561
Score = 111 bits (56), Expect = 1e-022
Identities = 125/148 (84%)
Strand = Plus / Plus
Query: 823 ggcgacggcctcaaggaaggaagtggttgcaatggagtaagcacactagtgattgcaata 882
||||| ||| |||| || ||||||||||||||||||||| |||| ||| ||||| |
Sbjct: 1 ggcgatggcttcaaagagggaagtggttgcaatggagtaggcacgctaacaattgccgga 60
Query: 883 gttgcaggattagctctgctagtgcttctcctcatccttggcttctggactcactggctt 942
|| | ||| |||||||||||||||||||| | || ||||| |||||||| || ||||||
Sbjct: 61 gtcacgggactagctctgctagtgcttctctttattcttggtttctggacccattggctt 120
Query: 943 ggtaagaagaggaaacttgcaaagacaa 970
| ||||||||||||||||||||||||||
Sbjct: 121 gttaagaagaggaaacttgcaaagacaa 148
>gb|CL177793.1|CL177793 104_385_10894083_148_31913_147 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894083, DNA
sequence
Length = 729
Score = 87.7 bits (44), Expect = 2e-015
Identities = 89/104 (85%)
Strand = Plus / Plus
Query: 60 tggtccgttgctgtccatcggaaacagcatgcttgggattcttgacatctcgttgcttga 119
|||||||| |||| |||| || |||||| || ||||||||||||||||||| ||||| ||
Sbjct: 580 tggtccgtcgctgcccattgggaacagcgtgtttgggattcttgacatctcattgctgga 639
Query: 120 tggtcttgtgagcatattggctagtgctagttctcagcagtgca 163
|||| |||||| |||| |||||||| || |||||||||||||
Sbjct: 640 tggttttgtgaccatagcagctagtgccagctctcagcagtgca 683
>gb|CW303573.1|CW303573 104_788_11465310_148_35698_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11465310, DNA
sequence
Length = 553
Score = 56.0 bits (28), Expect = 6e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 664 taccgctgcaattgctccagtggattcgaggggaacccatacct 707
||||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 403 taccgctgcaattgctccaagggatacgaggggaacccctacct 446
>gb|CW360370.1|CW360370 fsbb001f028g20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f028g20, DNA
sequence
Length = 624
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 664 taccgctgcaattgctccagtggattcgaggggaacccatacc 706
||||||||||||||||||| |||| |||||||||||| ||||
Sbjct: 43 taccgctgcaattgctccaagggatacgaggggaacccctacc 1
>gb|CW345045.1|CW345045 104_848_11488281_116_36205_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488281, DNA
sequence
Length = 717
Score = 50.1 bits (25), Expect = 4e-004
Identities = 50/57 (87%), Gaps = 1/57 (1%)
Strand = Plus / Plus
Query: 60 tggtccgttgctgtccatcggaaacagcatgcttgggattcttgacatctcgttgct 116
|||||||| |||| |||| |||| |||| || ||||||||||||||||||| |||||
Sbjct: 660 tggtccgtcgctgcccatgggaa-cagcgtgtttgggattcttgacatctcattgct 715
>gb|CW197544.1|CW197544 104_621_11181743_116_36821_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11181743, DNA
sequence
Length = 697
Score = 38.2 bits (19), Expect = 1.5
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 301 tgtgcttccttttgctcta 319
|||||||||||||||||||
Sbjct: 145 tgtgcttccttttgctcta 127
>gb|CW218470.1|CW218470 104_652_11196207_148_37529_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11196207, DNA
sequence
Length = 514
Score = 38.2 bits (19), Expect = 1.5
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 786 aggtggtttccagtgcacg 804
|||||||||||||||||||
Sbjct: 182 aggtggtttccagtgcacg 200
>gb|CW338081.1|CW338081 104_838_11484553_148_36127_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484553, DNA
sequence
Length = 656
Score = 38.2 bits (19), Expect = 1.5
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 301 tgtgcttccttttgctcta 319
|||||||||||||||||||
Sbjct: 341 tgtgcttccttttgctcta 323
>gb|CW458820.1|CW458820 fsbb001f205e15f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f205e15, DNA
sequence
Length = 497
Score = 38.2 bits (19), Expect = 1.5
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 301 tgtgcttccttttgctcta 319
|||||||||||||||||||
Sbjct: 165 tgtgcttccttttgctcta 147
>gb|CL699195.2|CL699195 SP__Ba0043E05.f SP__Ba Sorghum propinquum genomic clone
SP__Ba0043E05 5', DNA sequence
Length = 591
Score = 38.2 bits (19), Expect = 1.5
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 664 taccgctgcaattgctccagtgg 686
||||||||||| |||||||||||
Sbjct: 371 taccgctgcaaatgctccagtgg 349
>gb|BZ691957.1|BZ691957 SP__Ba0014M03.r SP__Ba Sorghum propinquum genomic clone SP__Ba0014M03
3', DNA sequence
Length = 1242
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 734 ttaatgaatgcatcacca 751
||||||||||||||||||
Sbjct: 1216 ttaatgaatgcatcacca 1199
>gb|CW099303.1|CW099303 104_466_11003477_148_34376_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11003477, DNA
sequence
Length = 641
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 221 acacaaggaacaagttca 238
||||||||||||||||||
Sbjct: 67 acacaaggaacaagttca 84
>gb|CW145291.1|CW145291 104_537_11138390_116_34975_051 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11138390, DNA
sequence
Length = 591
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 809 cagcagggatgagcggcg 826
||||||||||||||||||
Sbjct: 392 cagcagggatgagcggcg 409
>gb|CW145292.1|CW145292 104_537_11138390_148_34971_051 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11138390, DNA
sequence
Length = 612
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 809 cagcagggatgagcggcg 826
||||||||||||||||||
Sbjct: 587 cagcagggatgagcggcg 570
>gb|CW209235.1|CW209235 104_639_11189125_116_36989_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189125, DNA
sequence
Length = 692
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 221 acacaaggaacaagttca 238
||||||||||||||||||
Sbjct: 141 acacaaggaacaagttca 158
>gb|CW224982.1|CW224982 104_662_11204109_116_37203_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11204109, DNA
sequence
Length = 662
Score = 36.2 bits (18), Expect = 5.9
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 469 gccttcgtcgtggagcaggatt 490
|||||||||| |||||||||||
Sbjct: 493 gccttcgtcgcggagcaggatt 472
>gb|CW256622.1|CW256622 104_721_11226890_148_35145_003 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226890, DNA
sequence
Length = 693
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 719 atggatgcacagatatta 736
||||||||||||||||||
Sbjct: 224 atggatgcacagatatta 241
>gb|CW302547.1|CW302547 104_786_11464777_116_35664_003 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11464777, DNA
sequence
Length = 640
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 269 cttgcaaagacaaggcaa 252
>gb|CW316565.1|CW316565 104_808_11472959_116_35853_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11472959, DNA
sequence
Length = 720
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 327 cttgcaaagacaaggcaa 344
>gb|CW324142.1|CW324142 104_818_11477000_116_35903_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477000, DNA
sequence
Length = 625
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 78 cggaaacagcatgcttgg 95
||||||||||||||||||
Sbjct: 533 cggaaacagcatgcttgg 516
>gb|CW324143.1|CW324143 104_818_11477000_148_35907_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477000, DNA
sequence
Length = 674
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 78 cggaaacagcatgcttgg 95
||||||||||||||||||
Sbjct: 611 cggaaacagcatgcttgg 628
>gb|CW405880.1|CW405880 fsbb001f098k01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f098k01, DNA
sequence
Length = 662
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 809 cagcagggatgagcggcg 826
||||||||||||||||||
Sbjct: 149 cagcagggatgagcggcg 132
>gb|CW409795.1|CW409795 fsbb001f104e02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f104e02, DNA
sequence
Length = 339
Score = 36.2 bits (18), Expect = 5.9
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 99 tcttgacatctcgttgcttgat 120
||||||| ||||||||||||||
Sbjct: 317 tcttgacttctcgttgcttgat 338
>gb|CW413801.1|CW413801 fsbb001f113c06f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f113c06, DNA
sequence
Length = 678
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 482 agcaggattcatatgtgt 499
||||||||||||||||||
Sbjct: 376 agcaggattcatatgtgt 393
>gb|CW450674.1|CW450674 fsbb001f189g21k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f189g21, DNA
sequence
Length = 770
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 221 acacaaggaacaagttca 238
||||||||||||||||||
Sbjct: 171 acacaaggaacaagttca 154
>gb|CW474440.1|CW474440 fsbb001f230e19f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f230e19, DNA
sequence
Length = 519
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 333 cttgcaaagacaaggcaa 316
>gb|CW475986.1|CW475986 fsbb001f232k02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f232k02, DNA
sequence
Length = 674
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 337 cttgcaaagacaaggcaa 320
>gb|CW498758.1|CW498758 fsbb001f293c15k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f293c15, DNA
sequence
Length = 620
Score = 36.2 bits (18), Expect = 5.9
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 469 gccttcgtcgtggagcaggatt 490
|||||||||| |||||||||||
Sbjct: 474 gccttcgtcgcggagcaggatt 453
>gb|BM324590.1|BM324590 PIC1_33_B03.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 526
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 719 atggatgcacagatatta 736
||||||||||||||||||
Sbjct: 226 atggatgcacagatatta 209
>gb|CD206213.1|CD206213 HS1_21_H07.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_21_H07_A012 3', mRNA sequence
Length = 619
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 211 cttgcaaagacaaggcaa 228
>gb|CD431174.1|CD431174 ETH1_7_E07.b1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_7_E07_A002 3', mRNA sequence
Length = 685
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 208 cttgcaaagacaaggcaa 225
>gb|CN142793.1|CN142793 WOUND1_12_F05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_12_F05_A002 3', mRNA sequence
Length = 724
Score = 36.2 bits (18), Expect = 5.9
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 958 cttgcaaagacaaggcaa 975
||||||||||||||||||
Sbjct: 287 cttgcaaagacaaggcaa 304
Database: Sorghum_nucl_with_EST.fasta
Posted date: May 2, 2006 3:37 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 250,611
Number of Sequences: 832831
Number of extensions: 250611
Number of successful extensions: 66446
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66392
Number of HSP's gapped (non-prelim): 52
length of query: 980
length of database: 491,359,669
effective HSP length: 20
effective length of query: 960
effective length of database: 474,703,049
effective search space: 455714927040
effective search space used: 455714927040
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)