BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4695478.2.1
(1201 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE359158.1|BE359158 DG1_39_C02.b1_A002 Dark Grown 1 (DG1... 232 6e-059
gb|CD206423.1|CD206423 HS1_22_G03.g1_A012 Heat-shocked seed... 212 6e-053
gb|BE363053.1|BE363053 DG1_9_D02.b1_A002 Dark Grown 1 (DG1)... 182 5e-044
gb|CD213428.1|CD213428 HS1_40_A07.g1_A012 Heat-shocked seed... 182 5e-044
gb|CB925013.1|CB925013 ABA1_29_B06.g1_A012 Abscisic acid-tr... 176 3e-042
gb|CF428507.1|CF428507 PH1_15_D07.g1_A002 Phosphorous-defic... 176 3e-042
gb|CD206390.1|CD206390 HS1_22_H01.g1_A012 Heat-shocked seed... 167 3e-039
gb|CW139361.1|CW139361 104_529_11135198_116_34905_055 Sorgh... 115 1e-023
gb|CW168295.1|CW168295 104_577_11154068_116_36494_066 Sorgh... 115 1e-023
gb|CW192938.1|CW192938 104_615_11179297_116_36769_005 Sorgh... 115 1e-023
gb|CW403430.1|CW403430 fsbb001f095c10k0 Sorghum methylation... 115 1e-023
gb|CW185512.1|CW185512 104_603_11166099_148_36698_012 Sorgh... 113 4e-023
gb|AW923197.1|AW923197 DG1_50_E07.b1_A002 Dark Grown 1 (DG1... 113 4e-023
gb|BE357273.1|BE357273 DG1_148_D02.b1_A002 Dark Grown 1 (DG... 113 4e-023
gb|BZ349735.1|BZ349735 hr45b01.g1 WGS-SbicolorF (JM107 adap... 101 1e-019
gb|CW139362.1|CW139362 104_529_11135198_148_34909_055 Sorgh... 101 1e-019
gb|CW168296.1|CW168296 104_577_11154068_148_36493_066 Sorgh... 101 1e-019
gb|CW403429.1|CW403429 fsbb001f095c10f0 Sorghum methylation... 101 1e-019
gb|CW194134.1|CW194134 104_617_11179939_116_36785_076 Sorgh... 98 2e-018
gb|CW194135.1|CW194135 104_617_11179939_148_36789_076 Sorgh... 98 2e-018
gb|CW062665.1|CW062665 104_308_10521466_1_30092 Sorghum met... 84 3e-014
gb|CN132335.1|CN132335 OX1_5_C03.g1_A002 Oxidatively-stress... 84 3e-014
gb|CW340854.1|CW340854 104_842_11486016_116_36172_096 Sorgh... 80 5e-013
gb|CW340855.1|CW340855 104_842_11486016_148_36171_096 Sorgh... 80 5e-013
gb|CW491338.1|CW491338 fsbb001f281c16k0 Sorghum methylation... 80 5e-013
gb|CW304703.1|CW304703 104_789_11465922_116_35702_067 Sorgh... 78 2e-012
gb|BZ366510.1|BZ366510 ic97e06.b1 WGS-SbicolorF (JM107 adap... 74 3e-011
gb|CW093956.1|CW093956 104_457_11000061_148_37478_091 Sorgh... 74 3e-011
gb|CW101233.1|CW101233 104_469_11004532_116_34405_016 Sorgh... 74 3e-011
gb|CN124236.1|CN124236 RHOH1_3_B09.g1_A002 Acid- and alkali... 74 3e-011
gb|CN128033.1|CN128033 RHOH1_26_C10.g1_A002 Acid- and alkal... 74 3e-011
gb|CL162494.1|CL162494 104_354_10806443_114_31830_347 Sorgh... 68 2e-009
gb|BE363139.1|BE363139 DG1_9_D02.g1_A002 Dark Grown 1 (DG1)... 66 8e-009
gb|CW261808.1|CW261808 104_729_11229713_148_35203_077 Sorgh... 64 3e-008
gb|BE359210.1|BE359210 DG1_39_C02.g1_A002 Dark Grown 1 (DG1... 64 3e-008
gb|CB924988.1|CB924988 ABA1_29_B06.b1_A012 Abscisic acid-tr... 64 3e-008
gb|CD213339.1|CD213339 HS1_40_A07.b1_A012 Heat-shocked seed... 64 3e-008
gb|BZ345693.1|BZ345693 ht56a04.b1 WGS-SbicolorF (JM107 adap... 62 1e-007
gb|CW098263.1|CW098263 104_464_11002911_148_34364_052 Sorgh... 62 1e-007
gb|CW202059.1|CW202059 104_628_11184893_116_37086_029 Sorgh... 62 1e-007
gb|CW217859.1|CW217859 104_651_11195875_148_37457_076 Sorgh... 62 1e-007
gb|CW266537.1|CW266537 104_736_11232481_116_35281_009 Sorgh... 62 1e-007
gb|AW671852.1|AW671852 LG1_352_C05.b1_A002 Light Grown 1 (L... 62 1e-007
gb|CL180568.1|CL180568 104_390_10896117_116_31930_261 Sorgh... 60 5e-007
gb|CW202060.1|CW202060 104_628_11184893_148_37085_029 Sorgh... 60 5e-007
gb|CD461540.1|CD461540 SA1_32_D01.g2_A002 Salicylic acid-tr... 60 5e-007
gb|CW093955.1|CW093955 104_457_11000061_116_37477_091 Sorgh... 58 2e-006
gb|CD205252.1|CD205252 HS1_13_D05.b1_A012 Heat-shocked seed... 56 8e-006
gb|CN135147.1|CN135147 OX1_30_G11.g1_A002 Oxidatively-stres... 56 8e-006
gb|CN132257.1|CN132257 OX1_5_C03.b1_A002 Oxidatively-stress... 54 3e-005
gb|CW142692.1|CW142692 104_534_11137002_116_34951_077 Sorgh... 50 5e-004
gb|CW142693.1|CW142693 104_534_11137002_148_34947_077 Sorgh... 50 5e-004
gb|CW188144.1|CW188144 104_607_11172866_116_36724_001 Sorgh... 50 5e-004
gb|CW204386.1|CW204386 104_632_11186514_148_36919_073 Sorgh... 50 5e-004
gb|CW255741.1|CW255741 104_720_11226402_116_35131_071 Sorgh... 50 5e-004
gb|CW366040.1|CW366040 fsbb001f038n13k0 Sorghum methylation... 50 5e-004
gb|CW456886.1|CW456886 fsbb001f202h04k0 Sorghum methylation... 50 5e-004
gb|CL173566.1|CL173566 104_377_10890963_116_31793_099 Sorgh... 48 0.002
gb|CW183861.1|CW183861 104_599_11164841_116_36675_065 Sorgh... 48 0.002
gb|CW502335.1|CW502335 fsbb001f298j21f0 Sorghum methylation... 48 0.002
gb|CL161049.1|CL161049 104_352_10805442_114_31826_114 Sorgh... 46 0.008
gb|CW065681.1|CW065681 104_312_10523281_114_30128 Sorghum m... 46 0.008
gb|CW065682.1|CW065682 104_312_10523281_115_30130 Sorghum m... 46 0.008
gb|CW098262.1|CW098262 104_464_11002911_116_34360_052 Sorgh... 46 0.008
gb|CW134363.1|CW134363 104_518_11117266_148_34819_039 Sorgh... 46 0.008
gb|CW183096.1|CW183096 104_598_11164429_148_36664_049 Sorgh... 46 0.008
gb|CW206175.1|CW206175 104_634_11187455_116_36955_084 Sorgh... 46 0.008
gb|CW206176.1|CW206176 104_634_11187455_148_36956_084 Sorgh... 46 0.008
gb|CW266538.1|CW266538 104_736_11232481_148_35285_009 Sorgh... 46 0.008
gb|CW299315.1|CW299315 104_782_11463048_116_36235_092 Sorgh... 46 0.008
gb|CW427351.1|CW427351 fsbb001f139e20f0 Sorghum methylation... 46 0.008
gb|CW455196.1|CW455196 fsbb001f199p13k0 Sorghum methylation... 46 0.008
gb|CW494629.1|CW494629 fsbb001f286a06k0 Sorghum methylation... 46 0.008
gb|AW678617.1|AW678617 WS1_1_A12.b1_A002 Water-stressed 1 (... 46 0.008
gb|AW678763.1|AW678763 WS1_1_A12.b2_A002 Water-stressed 1 (... 46 0.008
gb|BE360812.1|BE360812 DG1_67_G03.b2_A002 Dark Grown 1 (DG1... 46 0.008
gb|BE362094.1|BE362094 DG1_84_C11.b1_A002 Dark Grown 1 (DG1... 46 0.008
gb|BE599908.1|BE599908 PI1_77_C02.b1_A002 Pathogen induced ... 46 0.008
gb|CB927150.1|CB927150 ABA1_13_F08.g1_A012 Abscisic acid-tr... 46 0.008
gb|CD228754.1|CD228754 CCC1_9_E11.g1_A007 Callus culture/ce... 46 0.008
gb|CD231600.1|CD231600 SS1_22_F09.g1_A012 Salt-stressed see... 46 0.008
gb|CN129279.1|CN129279 RHOH1_34_B10.g1_A002 Acid- and alkal... 46 0.008
gb|CN137521.1|CN137521 OX1_57_G07.g1_A002 Oxidatively-stres... 46 0.008
gb|CN137640.1|CN137640 OX1_58_D03.g1_A002 Oxidatively-stres... 46 0.008
gb|CN138545.1|CN138545 OX1_64_A03.g1_A002 Oxidatively-stres... 46 0.008
gb|CX608316.1|CX608316 ANR1_37_H09.g1_A002 Anaerobic roots ... 46 0.008
gb|CX608598.1|CX608598 ANR1_39_C06.g1_A002 Anaerobic roots ... 46 0.008
gb|CX610621.1|CX610621 ANR1_19_G06.g1_A002 Anaerobic roots ... 46 0.008
gb|BZ336368.1|BZ336368 hz33f08.g1 WGS-SbicolorF (JM107 adap... 42 0.12
gb|CW021210.1|CW021210 104_109_10409416_114_30492 Sorghum m... 42 0.12
gb|CW217706.1|CW217706 104_651_11195794_116_37071_047 Sorgh... 42 0.12
gb|BM323476.1|BM323476 PIC1_19_G04.b1_A002 Pathogen-infecte... 42 0.12
gb|CD225805.1|CD225805 CCC1_41_H04.g1_A007 Callus culture/c... 42 0.12
gb|CF480908.1|CF480908 POL1_68_F11.g1_A002 Pollen Sorghum b... 42 0.12
gb|CN152656.1|CN152656 WOUND1_83_A06.g1_A002 Wounded leaves... 42 0.12
gb|CW162184.1|CW162184 104_569_11150811_148_36439_010 Sorgh... 40 0.46
gb|CW205330.1|CW205330 104_633_11187011_148_36930_038 Sorgh... 40 0.46
gb|CW216905.1|CW216905 104_649_11195370_116_37128_065 Sorgh... 40 0.46
gb|CW220375.1|CW220375 104_655_11197315_148_37154_080 Sorgh... 40 0.46
gb|CW273767.1|CW273767 104_746_11404076_148_35369_074 Sorgh... 40 0.46
gb|CW295946.1|CW295946 104_777_11461224_148_35625_088 Sorgh... 40 0.46
gb|CW353195.1|CW353195 fsbb001f015n13k0 Sorghum methylation... 40 0.46
gb|CW444993.1|CW444993 fsbb001f166n22f0 Sorghum methylation... 40 0.46
gb|CL704353.2|CL704353 SP__Bb0014L19.r SP__Bb Sorghum propi... 40 0.46
gb|BG048617.1|BG048617 OV1_14_H08.b1_A002 Ovary 1 (OV1) Sor... 40 0.46
gb|CB925645.1|CB925645 ABA1_22_G02.g1_A012 Abscisic acid-tr... 40 0.46
gb|CB925802.1|CB925802 ABA1_23_F05.g1_A012 Abscisic acid-tr... 40 0.46
gb|CB926819.1|CB926819 ABA1_10_G05.g1_A012 Abscisic acid-tr... 40 0.46
gb|CD228254.1|CD228254 CCC1_6_B12.g1_A007 Callus culture/ce... 40 0.46
gb|CF428334.1|CF428334 PH1_14_C04.g1_A002 Phosphorous-defic... 40 0.46
gb|CF428425.1|CF428425 PH1_15_D07.b1_A002 Phosphorous-defic... 40 0.46
gb|CN145669.1|CN145669 WOUND1_34_B03.g1_A002 Wounded leaves... 40 0.46
gb|CN147237.1|CN147237 WOUND1_48_B05.g1_A002 Wounded leaves... 40 0.46
gb|CX619593.1|CX619593 GABR1_46_B10.g1_A002 GA- or brassino... 40 0.46
>gb|BE359158.1|BE359158 DG1_39_C02.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 548
Score = 232 bits (117), Expect = 6e-059
Identities = 333/405 (82%)
Strand = Plus / Minus
Query: 638 tctgaccagcagttctcatctttgatcttgtctttgggccagtctttcgggttgatctca 697
|||||||||||| |||||||| |||||| ||| ||||| ||||| ||| ||||||||
Sbjct: 544 tctgaccagcagctctcatctcggatcttaccttcaggccaatctttggggctgatctca 485
Query: 698 acggcaaccatggatgaaacgacgaccactcgacgagcatttgcagcagacgcagccttg 757
||||||||||||||||| || || |||||||| | |||| || ||||| |||||||||
Sbjct: 484 acggcaaccatggatgacacaaccaccactcgctggacattcgcggcagaggcagccttg 425
Query: 758 agtgcgtttatggtgccggtaacagcaggacccagcatctctcgctctggatcggtgatc 817
|| | || | || || || ||||||||||||| ||| | | ||||||| || || |
Sbjct: 424 agcacattagttgtaccagtgacagcaggacccaacatttgtagctctgggtcagtcagg 365
Query: 818 ttccctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcaccc 877
||| ||||||| || |||||||| ||||| | |||||||||||||| |||| ||| |
Sbjct: 364 ttctctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagct 305
Query: 878 gccatagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattc 937
||||| ||||||||||| || | |||||||||||||| | |||||||| ||| |||||||
Sbjct: 304 gccatggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattc 245
Query: 938 tctaaccgcttcagatgagcggttttattgtcactgaggtcgcggacggtgccgtggacg 997
|| | ||||||||||| || || | ||||||||||||||||||||||||||| |||
Sbjct: 244 tccaggcgcttcagatggttcgtcttctcgtcactgaggtcgcggacggtgccgtgcacg 185
Query: 998 gtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
|||||||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gtgtagccgcgggagagcaggagcttcacgagccacgaggcgatg 140
>gb|CD206423.1|CD206423 HS1_22_G03.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_22_G03_A012 5', mRNA sequence
Length = 511
Score = 212 bits (107), Expect = 6e-053
Identities = 299/363 (82%)
Strand = Plus / Minus
Query: 680 tctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcgacgagcattt 739
||||| ||| ||||||||||||||||||||||||| || || |||||||| | ||||
Sbjct: 509 tctttggggctgatctcaacggcaaccatggatgacacaaccaccactcgctggacattc 450
Query: 740 gcagcagacgcagccttgagtgcgtttatggtgccggtaacagcaggacccagcatctct 799
|| ||||| ||||||||||| | || | || || || ||||||||||||| ||| | |
Sbjct: 449 gcggcagaggcagccttgagcacattagttgtaccagtgacagcaggacccaacatttgt 390
Query: 800 cgctctggatcggtgatcttccctgaaggaacaggagtggcgacatgaaagactccctgg 859
||||||| || || | ||| ||||||| || |||||||| ||||| | |||||||||
Sbjct: 389 agctctgggtcagtcaggttctctgaaggcactggagtggccacatggagaactccctgg 330
Query: 860 caccctgcgactgcacccgccatagcgtcgtagtcaaggacatcagccttgaaaagcttg 919
||||| |||| ||| | ||||| ||||||||||| || | |||||||||||||| | ||
Sbjct: 329 cacccgacgaccgcagctgccatggcgtcgtagtccagcagatcagccttgaaaatcctg 270
Query: 920 aggttttcggaagcattctctaaccgcttcagatgagcggttttattgtcactgaggtcg 979
|||||| ||| ||||||||| | ||||||||||| || || | |||||||||||||
Sbjct: 269 aggtttccggcagcattctccaggcgcttcagatggttcgtcttctcgtcactgaggtcg 210
Query: 980 cggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacgaggcg 1039
|||||||||||||| ||||||||||| |||||||| |||||||| |||||||||||||||
Sbjct: 209 cggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacgagccacgaggcg 150
Query: 1040 atg 1042
|||
Sbjct: 149 atg 147
>gb|BE363053.1|BE363053 DG1_9_D02.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 509
Score = 182 bits (92), Expect = 5e-044
Identities = 221/264 (83%)
Strand = Plus / Minus
Query: 779 acagcaggacccagcatctctcgctctggatcggtgatcttccctgaaggaacaggagtg 838
||||||||||||| ||| | | ||||||| || || | ||| ||||||| || ||||||
Sbjct: 444 acagcaggacccaacatttgtagctctgggtcagtcaggttctctgaaggcactggagtg 385
Query: 839 gcgacatgaaagactccctggcaccctgcgactgcacccgccatagcgtcgtagtcaagg 898
|| ||||| | |||||||||||||| |||| ||| | ||||| ||||||||||| ||
Sbjct: 384 gccacatggagaactccctggcacccgacgaccgcagctgccatggcgtcgtagtccagc 325
Query: 899 acatcagccttgaaaagcttgaggttttcggaagcattctctaaccgcttcagatgagcg 958
| |||||||||||||| | |||||||| ||| ||||||||| | |||||||||||
Sbjct: 324 agatcagccttgaaaatcctgaggtttccggcagcattctccaggcgcttcagatggttc 265
Query: 959 gttttattgtcactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggagg 1018
|| || | ||||||||||||||||||||||||||| ||||||||||| |||||||| |||
Sbjct: 264 gtcttctcgtcactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcagg 205
Query: 1019 agcttgacgagccacgaggcgatg 1042
||||| ||||||||||||||||||
Sbjct: 204 agcttcacgagccacgaggcgatg 181
>gb|CD213428.1|CD213428 HS1_40_A07.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_40_A07_A012 5', mRNA sequence
Length = 595
Score = 182 bits (92), Expect = 5e-044
Identities = 221/264 (83%)
Strand = Plus / Minus
Query: 779 acagcaggacccagcatctctcgctctggatcggtgatcttccctgaaggaacaggagtg 838
||||||||||||| ||| | | ||||||| || || | ||| ||||||| || ||||||
Sbjct: 397 acagcaggacccaacatttgtagctctgggtcagtcaggttctctgaaggcactggagtg 338
Query: 839 gcgacatgaaagactccctggcaccctgcgactgcacccgccatagcgtcgtagtcaagg 898
|| ||||| | |||||||||||||| |||| ||| | ||||| ||||||||||| ||
Sbjct: 337 gccacatggagaactccctggcacccgacgaccgcagctgccatggcgtcgtagtccagc 278
Query: 899 acatcagccttgaaaagcttgaggttttcggaagcattctctaaccgcttcagatgagcg 958
| |||||||||||||| | |||||||| ||| ||||||||| | |||||||||||
Sbjct: 277 agatcagccttgaaaatcctgaggtttccggcagcattctccaggcgcttcagatggttc 218
Query: 959 gttttattgtcactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggagg 1018
|| || | ||||||||||||||||||||||||||| ||||||||||| |||||||| |||
Sbjct: 217 gtcttctcgtcactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcagg 158
Query: 1019 agcttgacgagccacgaggcgatg 1042
||||| ||||||||||||||||||
Sbjct: 157 agcttcacgagccacgaggcgatg 134
Score = 89.7 bits (45), Expect = 6e-016
Identities = 93/109 (85%)
Strand = Plus / Minus
Query: 621 tcctgcagaactctttatctgaccagcagttctcatctttgatcttgtctttgggccagt 680
|||||||||| ||||| |||||||||||| |||||||| || ||| ||| ||||| |
Sbjct: 510 tcctgcagaattctttgtctgaccagcagctctcatctcggaccttaccttcaggccaat 451
Query: 681 ctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcg 729
|||| ||| ||||||||||||||||||||||||| || || ||||||||
Sbjct: 450 ctttggggctgatctcaacggcaaccatggatgacacaaccaccactcg 402
>gb|CB925013.1|CB925013 ABA1_29_B06.g1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_29_B06_A012 5', mRNA sequence
Length = 642
Score = 176 bits (89), Expect = 3e-042
Identities = 188/221 (85%)
Strand = Plus / Minus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 628 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 569
Query: 882 tagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattctcta 941
| ||||||||||| || | |||||||||||||| | |||||||| ||| ||||||||| |
Sbjct: 568 tggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattctcca 509
Query: 942 accgcttcagatgagcggttttattgtcactgaggtcgcggacggtgccgtggacggtgt 1001
||||||||||| || || | ||||||||||||||||||||||||||| |||||||
Sbjct: 508 ggcgcttcagatggttcgtcttctcgtcactgaggtcgcggacggtgccgtgcacggtgt 449
Query: 1002 agccacgggagaggaggagcttgacgagccacgaggcgatg 1042
|||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 448 agccgcgggagagcaggagcttcacgagccacgaggcgatg 408
>gb|CF428507.1|CF428507 PH1_15_D07.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_15_D07_A002 5', mRNA sequence
Length = 623
Score = 176 bits (89), Expect = 3e-042
Identities = 188/221 (85%)
Strand = Plus / Minus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 623 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 564
Query: 882 tagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattctcta 941
| ||||||||||| || | |||||||||||||| | |||||||| ||| ||||||||| |
Sbjct: 563 tggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattctcca 504
Query: 942 accgcttcagatgagcggttttattgtcactgaggtcgcggacggtgccgtggacggtgt 1001
||||||||||| || || | ||||||||||||||||||||||||||| |||||||
Sbjct: 503 ggcgcttcagatggttcgtcttctcgtcactgaggtcgcggacggtgccgtgcacggtgt 444
Query: 1002 agccacgggagaggaggagcttgacgagccacgaggcgatg 1042
|||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 443 agccgcgggagagcaggagcttcacgagccacgaggcgatg 403
>gb|CD206390.1|CD206390 HS1_22_H01.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_22_H01_A012 5', mRNA sequence
Length = 592
Score = 167 bits (84), Expect = 3e-039
Identities = 165/192 (85%)
Strand = Plus / Minus
Query: 851 actccctggcaccctgcgactgcacccgccatagcgtcgtagtcaaggacatcagccttg 910
|||||||||||||| |||| ||| | ||||| ||||||||||| || | ||||||||||
Sbjct: 585 actccctggcacccgacgaccgcagctgccatggcgtcgtagtccagcagatcagccttg 526
Query: 911 aaaagcttgaggttttcggaagcattctctaaccgcttcagatgagcggttttattgtca 970
|||| | |||||||| ||| ||||||||| | ||||||||||| || || | ||||
Sbjct: 525 aaaatcctgaggtttccggcagcattctccaggcgcttcagatggttcgtcttctcgtca 466
Query: 971 ctgaggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagc 1030
||||||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||||
Sbjct: 465 ctgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacgagc 406
Query: 1031 cacgaggcgatg 1042
||||||||||||
Sbjct: 405 cacgaggcgatg 394
>gb|CW139361.1|CW139361 104_529_11135198_116_34905_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135198, DNA
sequence
Length = 617
Score = 115 bits (58), Expect = 1e-023
Identities = 70/74 (94%)
Strand = Plus / Minus
Query: 969 cactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacga 1028
||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 436 cactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacga 377
Query: 1029 gccacgaggcgatg 1042
||||||||||||||
Sbjct: 376 gccacgaggcgatg 363
Score = 65.9 bits (33), Expect = 8e-009
Identities = 66/77 (85%)
Strand = Plus / Minus
Query: 878 gccatagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattc 937
||||| ||||||||||| || | |||||||||||||| | |||||||| ||| |||||||
Sbjct: 607 gccatggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattc 548
Query: 938 tctaaccgcttcagatg 954
|| | |||||||||||
Sbjct: 547 tccaggcgcttcagatg 531
>gb|CW168295.1|CW168295 104_577_11154068_116_36494_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11154068, DNA
sequence
Length = 649
Score = 115 bits (58), Expect = 1e-023
Identities = 70/74 (94%)
Strand = Plus / Minus
Query: 969 cactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacga 1028
||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 533 cactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacga 474
Query: 1029 gccacgaggcgatg 1042
||||||||||||||
Sbjct: 473 gccacgaggcgatg 460
>gb|CW192938.1|CW192938 104_615_11179297_116_36769_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179297, DNA
sequence
Length = 712
Score = 115 bits (58), Expect = 1e-023
Identities = 70/74 (94%)
Strand = Plus / Plus
Query: 969 cactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacga 1028
||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 310 cactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacga 369
Query: 1029 gccacgaggcgatg 1042
||||||||||||||
Sbjct: 370 gccacgaggcgatg 383
Score = 89.7 bits (45), Expect = 6e-016
Identities = 111/133 (83%)
Strand = Plus / Plus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 83 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 142
Query: 882 tagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattctcta 941
| ||||||||||| || | |||||||||||||| | |||||||| ||| ||||||||| |
Sbjct: 143 tggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattctcca 202
Query: 942 accgcttcagatg 954
|||||||||||
Sbjct: 203 ggcgcttcagatg 215
>gb|CW403430.1|CW403430 fsbb001f095c10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f095c10, DNA
sequence
Length = 661
Score = 115 bits (58), Expect = 1e-023
Identities = 70/74 (94%)
Strand = Plus / Minus
Query: 969 cactgaggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacga 1028
||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 323 cactgaggtcgcggacggtgccgtgcacggtgtagccgcgggagagcaggagcttcacga 264
Query: 1029 gccacgaggcgatg 1042
||||||||||||||
Sbjct: 263 gccacgaggcgatg 250
Score = 89.7 bits (45), Expect = 6e-016
Identities = 111/133 (83%)
Strand = Plus / Minus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 550 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 491
Query: 882 tagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattctcta 941
| ||||||||||| || | |||||||||||||| | |||||||| ||| ||||||||| |
Sbjct: 490 tggcgtcgtagtccagcagatcagccttgaaaatcctgaggtttccggcagcattctcca 431
Query: 942 accgcttcagatg 954
|||||||||||
Sbjct: 430 ggcgcttcagatg 418
>gb|CW185512.1|CW185512 104_603_11166099_148_36698_012 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11166099, DNA
sequence
Length = 751
Score = 113 bits (57), Expect = 4e-023
Identities = 66/69 (95%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||
Sbjct: 127 ggtcgcggacggtggcgtgcacggtgtagccgcgggagaggaggagcttgacgagccacg 186
Query: 1035 aggcgatgt 1043
|||||||||
Sbjct: 187 aggcgatgt 195
>gb|AW923197.1|AW923197 DG1_50_E07.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 392
Score = 113 bits (57), Expect = 4e-023
Identities = 66/69 (95%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||
Sbjct: 303 ggtcgcggacggtggcgtgcacggtgtagccgcgggagaggaggagcttgacgagccacg 244
Query: 1035 aggcgatgt 1043
|||||||||
Sbjct: 243 aggcgatgt 235
>gb|BE357273.1|BE357273 DG1_148_D02.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 548
Score = 113 bits (57), Expect = 4e-023
Identities = 66/69 (95%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||
Sbjct: 299 ggtcgcggacggtggcgtgcacggtgtagccgcgggagaggaggagcttgacgagccacg 240
Query: 1035 aggcgatgt 1043
|||||||||
Sbjct: 239 aggcgatgt 231
>gb|BZ349735.1|BZ349735 hr45b01.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hr45b01 5', DNA sequence
Length = 583
Score = 101 bits (51), Expect = 1e-019
Identities = 117/139 (84%)
Strand = Plus / Minus
Query: 621 tcctgcagaactctttatctgaccagcagttctcatctttgatcttgtctttgggccagt 680
|||||||||| ||||| |||||||||||| |||||||| |||||| ||| ||||| |
Sbjct: 233 tcctgcagaattctttgtctgaccagcagctctcatctcggatcttaccttcaggccaat 174
Query: 681 ctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcgacgagcatttg 740
|||| ||| ||||||||||||||||||||||||| || || |||||||| | |||| |
Sbjct: 173 ctttggggctgatctcaacggcaaccatggatgacacaaccaccactcgctggacattcg 114
Query: 741 cagcagacgcagccttgag 759
| ||||| |||||||||||
Sbjct: 113 cggcagaggcagccttgag 95
Score = 48.1 bits (24), Expect = 0.002
Identities = 120/152 (78%)
Strand = Plus / Minus
Query: 449 cctttcaggaagtagacgaggaactgacagctcgtgttgagcgtcggctgcagaagaggg 508
||||| |||||||||| ||||||||| ||| | ||| | |||||||||||| || |||
Sbjct: 529 cctttgaggaagtagatgaggaactggatgcttgcgttcaccgtcggctgcagcaggggg 470
Query: 509 ccaaagaccacagctggattgaccgtcacaacatccagcccggtctgcttcgcgtattca 568
|| || |||| ||||||||| ||||| || || |||||||| ||| | ||||| |
Sbjct: 469 ccgaacaccaaccctggattgatagtcaccacgtcaagcccggtttgccgcccgtatgcg 410
Query: 569 agtgcggcctcttctgacgagatcttggcgac 600
|| || ||||||||||| ||||||||||||
Sbjct: 409 agcgccgcctcttctgagatgatcttggcgac 378
>gb|CW139362.1|CW139362 104_529_11135198_148_34909_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135198, DNA
sequence
Length = 640
Score = 101 bits (51), Expect = 1e-019
Identities = 117/139 (84%)
Strand = Plus / Plus
Query: 621 tcctgcagaactctttatctgaccagcagttctcatctttgatcttgtctttgggccagt 680
|||||||||| ||||| |||||||||||| |||||||| |||||| ||| ||||| |
Sbjct: 148 tcctgcagaattctttgtctgaccagcagctctcatctcggatcttaccttcaggccaat 207
Query: 681 ctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcgacgagcatttg 740
|||| ||| ||||||||||||||||||||||||| || || |||||||| | |||| |
Sbjct: 208 ctttggggctgatctcaacggcaaccatggatgacacaaccaccactcgctggacattcg 267
Query: 741 cagcagacgcagccttgag 759
| ||||| |||||||||||
Sbjct: 268 cggcagaggcagccttgag 286
Score = 67.9 bits (34), Expect = 2e-009
Identities = 98/118 (83%), Gaps = 1/118 (0%)
Strand = Plus / Plus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 462 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 521
Query: 882 tagcgtcgtagtcaaggacatcagccttgaaaagcttgaggttttcggaagcattctc 939
| ||||||||||| || | |||||||||| ||| | |||||||| ||| |||||||||
Sbjct: 522 tggcgtcgtagtccagcagatcagccttg-aaatcctgaggtttccggcagcattctc 578
>gb|CW168296.1|CW168296 104_577_11154068_148_36493_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11154068, DNA
sequence
Length = 667
Score = 101 bits (51), Expect = 1e-019
Identities = 117/139 (84%)
Strand = Plus / Plus
Query: 621 tcctgcagaactctttatctgaccagcagttctcatctttgatcttgtctttgggccagt 680
|||||||||| ||||| |||||||||||| |||||||| |||||| ||| ||||| |
Sbjct: 428 tcctgcagaattctttgtctgaccagcagctctcatctcggatcttaccttcaggccaat 487
Query: 681 ctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcgacgagcatttg 740
|||| ||| ||||||||||||||||||||||||| || || |||||||| | |||| |
Sbjct: 488 ctttggggctgatctcaacggcaaccatggatgacacaaccaccactcgctggacattcg 547
Query: 741 cagcagacgcagccttgag 759
| ||||| |||||||||||
Sbjct: 548 cggcagaggcagccttgag 566
Score = 48.1 bits (24), Expect = 0.002
Identities = 120/152 (78%)
Strand = Plus / Plus
Query: 449 cctttcaggaagtagacgaggaactgacagctcgtgttgagcgtcggctgcagaagaggg 508
||||| |||||||||| ||||||||| ||| | ||| | |||||||||||| || |||
Sbjct: 132 cctttgaggaagtagatgaggaactggatgcttgcgttcaccgtcggctgcagcaggggg 191
Query: 509 ccaaagaccacagctggattgaccgtcacaacatccagcccggtctgcttcgcgtattca 568
|| || |||| ||||||||| ||||| || || |||||||| ||| | ||||| |
Sbjct: 192 ccgaacaccaaccctggattgatagtcaccacgtcaagcccggtttgccgcccgtatgcg 251
Query: 569 agtgcggcctcttctgacgagatcttggcgac 600
|| || ||||||||||| ||||||||||||
Sbjct: 252 agcgccgcctcttctgagatgatcttggcgac 283
>gb|CW403429.1|CW403429 fsbb001f095c10f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f095c10, DNA
sequence
Length = 663
Score = 101 bits (51), Expect = 1e-019
Identities = 117/139 (84%)
Strand = Plus / Plus
Query: 621 tcctgcagaactctttatctgaccagcagttctcatctttgatcttgtctttgggccagt 680
|||||||||| ||||| |||||||||||| |||||||| |||||| ||| ||||| |
Sbjct: 268 tcctgcagaattctttgtctgaccagcagctctcatctcggatcttaccttcaggccaat 327
Query: 681 ctttcgggttgatctcaacggcaaccatggatgaaacgacgaccactcgacgagcatttg 740
|||| ||| ||||||||||||||||||||||||| || || |||||||| | |||| |
Sbjct: 328 ctttggggctgatctcaacggcaaccatggatgacacaaccaccactcgctggacattcg 387
Query: 741 cagcagacgcagccttgag 759
| ||||| |||||||||||
Sbjct: 388 cggcagaggcagccttgag 406
Score = 44.1 bits (22), Expect = 0.030
Identities = 58/70 (82%)
Strand = Plus / Plus
Query: 822 ctgaaggaacaggagtggcgacatgaaagactccctggcaccctgcgactgcacccgcca 881
||||||| || |||||||| ||||| | |||||||||||||| |||| ||| | ||||
Sbjct: 582 ctgaaggcactggagtggccacatggagaactccctggcacccgacgaccgcagctgcca 641
Query: 882 tagcgtcgta 891
| ||||||||
Sbjct: 642 tggcgtcgta 651
>gb|CW194134.1|CW194134 104_617_11179939_116_36785_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179939, DNA
sequence
Length = 730
Score = 97.6 bits (49), Expect = 2e-018
Identities = 73/81 (90%)
Strand = Plus / Minus
Query: 176 agcggcctgaccttccatcccagtttcttgagcttgtcggacgtcattggagctgggtgc 235
|||||||||||||||||||| |||||||| ||||| |||||| | ||||||||| |||||
Sbjct: 375 agcggcctgaccttccatcctagtttcttcagcttatcggacataattggagctaggtgc 316
Query: 236 tccatgtcgtagatgctctcc 256
|||||| | ||||||||||||
Sbjct: 315 tccatgccatagatgctctcc 295
Score = 89.7 bits (45), Expect = 6e-016
Identities = 69/77 (89%)
Strand = Plus / Minus
Query: 256 cttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagcaggtcacg 315
|||| |||||||||||||||||||||||||||| |||||||||| ||||||||| ||||
Sbjct: 207 cttggtaatgaaagggtaatcatcagggtacatggtcttcagcaagtccagcaggccacg 148
Query: 316 cgcgctgatgaaatgag 332
||| ||| ||||||||
Sbjct: 147 ggcgttgacgaaatgag 131
Score = 65.9 bits (33), Expect = 8e-009
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 383 agagcatcggcagtgtccctgacgtcgacgatgtgccaaagcttgtccctcattcgatca 442
|||||||| |||||||||| ||||| |||||||||||||| |||||| ||| | |||||
Sbjct: 96 agagcatcagcagtgtcccgaacgtcaacgatgtgccaaagtttgtccatcacttgatca 37
Query: 443 ggtcc 447
|||||
Sbjct: 36 ggtcc 32
>gb|CW194135.1|CW194135 104_617_11179939_148_36789_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179939, DNA
sequence
Length = 730
Score = 97.6 bits (49), Expect = 2e-018
Identities = 73/81 (90%)
Strand = Plus / Plus
Query: 176 agcggcctgaccttccatcccagtttcttgagcttgtcggacgtcattggagctgggtgc 235
|||||||||||||||||||| |||||||| ||||| |||||| | ||||||||| |||||
Sbjct: 495 agcggcctgaccttccatcctagtttcttcagcttatcggacataattggagctaggtgc 554
Query: 236 tccatgtcgtagatgctctcc 256
|||||| | ||||||||||||
Sbjct: 555 tccatgccatagatgctctcc 575
Score = 79.8 bits (40), Expect = 5e-013
Identities = 55/60 (91%)
Strand = Plus / Plus
Query: 256 cttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagcaggtcacg 315
|||| |||||||||||||||||||||||||||| |||||||||| ||||||||| ||||
Sbjct: 663 cttggtaatgaaagggtaatcatcagggtacatggtcttcagcaagtccagcaggccacg 722
Score = 60.0 bits (30), Expect = 5e-007
Identities = 89/109 (81%), Gaps = 6/109 (5%)
Strand = Plus / Plus
Query: 72 taaactagattatgttgtacaggggaggaaaacggaa------tccctccacgtcctcga 125
||||||||||||||||||||| || |||||||||| | ||||||||||||| |
Sbjct: 20 taaactagattatgttgtacaaggtaggaaaacggtagggagccccctccacgtccttta 79
Query: 126 aaaacccagcatgctggcagaactcaacggtttccgcaatgggttcctt 174
||| ||||| |||||||||||||| ||||| ||| |||| | ||||||
Sbjct: 80 gaaagccagcctgctggcagaactcgacggtctccacaattgtttcctt 128
>gb|CW062665.1|CW062665 104_308_10521466_1_30092 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone 10521466, DNA sequence
Length = 619
Score = 83.8 bits (42), Expect = 3e-014
Identities = 60/66 (90%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||| ||| |||| |||| |||||| |||||||||||||||||||||||||| |
Sbjct: 606 ggtcgcggacagtggcgtgcacggcgtagccgcgggagaggaggagcttgacgagccatg 547
Query: 1035 aggcga 1040
||||||
Sbjct: 546 aggcga 541
>gb|CN132335.1|CN132335 OX1_5_C03.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_5_C03_A002 5', mRNA sequence
Length = 626
Score = 83.8 bits (42), Expect = 3e-014
Identities = 60/66 (90%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||| ||| |||| |||| |||||| |||||||||||||||||||||||||| |
Sbjct: 154 ggtcgcggacagtggcgtgcacggcgtagccgcgggagaggaggagcttgacgagccatg 95
Query: 1035 aggcga 1040
||||||
Sbjct: 94 aggcga 89
Score = 54.0 bits (27), Expect = 3e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 605 taccagttctcttcgttcctgcagaactctttatctgaccagcagttctcatctttgat 663
||||||||||| | ||| ||||||| | ||| |||||||||||| |||||||||||||
Sbjct: 520 taccagttctcattcttcatgcagaagtttttgtctgaccagcagctctcatctttgat 462
>gb|CW340854.1|CW340854 104_842_11486016_116_36172_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11486016, DNA
sequence
Length = 617
Score = 79.8 bits (40), Expect = 5e-013
Identities = 58/64 (90%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
||||||| | |||| ||||||||| |||||| |||||||||||||||||||||||||| |
Sbjct: 515 ggtcgcgaagggtggcgtggacggcgtagccgcgggagaggaggagcttgacgagccagg 574
Query: 1035 aggc 1038
||||
Sbjct: 575 aggc 578
>gb|CW340855.1|CW340855 104_842_11486016_148_36171_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11486016, DNA
sequence
Length = 643
Score = 79.8 bits (40), Expect = 5e-013
Identities = 58/64 (90%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
||||||| | |||| ||||||||| |||||| |||||||||||||||||||||||||| |
Sbjct: 104 ggtcgcgaagggtggcgtggacggcgtagccgcgggagaggaggagcttgacgagccagg 45
Query: 1035 aggc 1038
||||
Sbjct: 44 aggc 41
>gb|CW491338.1|CW491338 fsbb001f281c16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f281c16, DNA
sequence
Length = 726
Score = 79.8 bits (40), Expect = 5e-013
Identities = 58/64 (90%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
||||||| | |||| ||||||||| |||||| |||||||||||||||||||||||||| |
Sbjct: 203 ggtcgcgaagggtggcgtggacggcgtagccgcgggagaggaggagcttgacgagccagg 262
Query: 1035 aggc 1038
||||
Sbjct: 263 aggc 266
>gb|CW304703.1|CW304703 104_789_11465922_116_35702_067 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11465922, DNA
sequence
Length = 681
Score = 77.8 bits (39), Expect = 2e-012
Identities = 59/66 (89%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagccacg 1034
|||||||||| ||| |||| |||| ||| || |||||||||||||||||||||||||| |
Sbjct: 456 ggtcgcggacagtggcgtgcacggcgtanccgcgggagaggaggagcttgacgagccatg 515
Query: 1035 aggcga 1040
||||||
Sbjct: 516 aggcga 521
>gb|BZ366510.1|BZ366510 ic97e06.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic97e06 5', DNA sequence
Length = 710
Score = 73.8 bits (37), Expect = 3e-011
Identities = 63/71 (88%), Gaps = 3/71 (4%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgta---gccacgggagaggaggagcttgacgagcc 1031
||||||| ||||||||| |||| ||||| ||||||||||||||||||||| |||||||
Sbjct: 363 ggtcgcgcacggtgccgcggaccgtgtattggccacgggagaggaggagcttcacgagcc 422
Query: 1032 acgaggcgatg 1042
|||| ||||||
Sbjct: 423 acgacgcgatg 433
>gb|CW093956.1|CW093956 104_457_11000061_148_37478_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11000061, DNA
sequence
Length = 728
Score = 73.8 bits (37), Expect = 3e-011
Identities = 46/49 (93%)
Strand = Plus / Minus
Query: 990 cgtggacggtgtagccacgggagaggaggagcttgacgagccacgaggc 1038
||||||||| |||||| |||||||||||||||||||||||||| |||||
Sbjct: 724 cgtggacggcgtagccgcgggagaggaggagcttgacgagccaggaggc 676
>gb|CW101233.1|CW101233 104_469_11004532_116_34405_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11004532, DNA
sequence
Length = 672
Score = 73.8 bits (37), Expect = 3e-011
Identities = 63/71 (88%), Gaps = 3/71 (4%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgta---gccacgggagaggaggagcttgacgagcc 1031
||||||| ||||||||| |||| ||||| ||||||||||||||||||||| |||||||
Sbjct: 670 ggtcgcgcacggtgccgcggaccgtgtattggccacgggagaggaggagcttcacgagcc 611
Query: 1032 acgaggcgatg 1042
|||| ||||||
Sbjct: 610 acgacgcgatg 600
>gb|CN124236.1|CN124236 RHOH1_3_B09.g1_A002 Acid- and alkaline-treated roots Sorghum bicolor
cDNA clone RHOH1_3_B09_A002 5', mRNA sequence
Length = 566
Score = 73.8 bits (37), Expect = 3e-011
Identities = 63/71 (88%), Gaps = 3/71 (4%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgta---gccacgggagaggaggagcttgacgagcc 1031
||||||| ||||||||| |||| ||||| ||||||||||||||||||||| |||||||
Sbjct: 217 ggtcgcgcacggtgccgcggaccgtgtattggccacgggagaggaggagcttcacgagcc 158
Query: 1032 acgaggcgatg 1042
|||| ||||||
Sbjct: 157 acgacgcgatg 147
>gb|CN128033.1|CN128033 RHOH1_26_C10.g1_A002 Acid- and alkaline-treated roots Sorghum bicolor
cDNA clone RHOH1_26_C10_A002 5', mRNA sequence
Length = 297
Score = 73.8 bits (37), Expect = 3e-011
Identities = 63/71 (88%), Gaps = 3/71 (4%)
Strand = Plus / Minus
Query: 975 ggtcgcggacggtgccgtggacggtgta---gccacgggagaggaggagcttgacgagcc 1031
||||||| ||||||||| |||| ||||| ||||||||||||||||||||| |||||||
Sbjct: 114 ggtcgcgcacggtgccgcggaccgtgtattggccacgggagaggaggagcttcacgagcc 55
Query: 1032 acgaggcgatg 1042
|||| ||||||
Sbjct: 54 acgacgcgatg 44
>gb|CL162494.1|CL162494 104_354_10806443_114_31830_347 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10806443, DNA
sequence
Length = 570
Score = 67.9 bits (34), Expect = 2e-009
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagcca 1032
|||||||||| ||| ||| |||| |||||| ||||||||||||||||||||||||||
Sbjct: 63 ggtcgcggacagtggtgtgcacggcgtagccgcgggagaggaggagcttgacgagcca 120
>gb|BE363139.1|BE363139 DG1_9_D02.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 453
Score = 65.9 bits (33), Expect = 8e-009
Identities = 179/227 (78%), Gaps = 3/227 (1%)
Strand = Plus / Minus
Query: 248 atgctctccttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagc 307
|||||||||||| |||||||||| | ||||||||||| ||||||||| ||||||
Sbjct: 297 atgctctccttggcaatgaaaggg---ttgtcagggtacatgctcttcagcaagtccagc 241
Query: 308 aggtcacgcgcgctgatgaaatgaggagcgcaaatgtgcctgccggaggcttgtggtgtc 367
||||| || || ||||| | |||||| ||||| ||||||||||||| |||| || |
Sbjct: 240 aggtcgcgggcactgataacatgaggcgcgcagatgtgcctgccggctgcttcaggcacc 181
Query: 368 tcgtacacaagcaggagagcatcggcagtgtccctgacgtcgacgatgtgccaaagcttg 427
||||| | ||||| || || ||||| ||| | ||| ||||||| |||||| ||||||
Sbjct: 180 tcgtagagcagcagcagcgcgtcggcgaggtcacggacatcgacgacgtgccagagcttg 121
Query: 428 tccctcattcgatcaggtcctcctttcaggaagtagacgaggaactg 474
| ||||| | || || |||||||| |||||||||| |||||||||
Sbjct: 120 ttcctcaccaggtcggggcctcctttgaggaagtagatgaggaactg 74
Score = 65.9 bits (33), Expect = 8e-009
Identities = 183/233 (78%)
Strand = Plus / Minus
Query: 278 tcagggtacatcgtcttcagcagctccagcaggtcacgcgcgctgatgaaatgaggagcg 337
||||||||||| ||||||||| ||||||||||| || || ||||| | |||||| |||
Sbjct: 270 tcagggtacatgctcttcagcaagtccagcaggtcgcgggcactgataacatgaggcgcg 211
Query: 338 caaatgtgcctgccggaggcttgtggtgtctcgtacacaagcaggagagcatcggcagtg 397
|| ||||||||||||| |||| || |||||| | ||||| || || ||||| |
Sbjct: 210 cagatgtgcctgccggctgcttcaggcacctcgtagagcagcagcagcgcgtcggcgagg 151
Query: 398 tccctgacgtcgacgatgtgccaaagcttgtccctcattcgatcaggtcctcctttcagg 457
|| | ||| ||||||| |||||| ||||||| ||||| | || || |||||||| |||
Sbjct: 150 tcacggacatcgacgacgtgccagagcttgttcctcaccaggtcggggcctcctttgagg 91
Query: 458 aagtagacgaggaactgacagctcgtgttgagcgtcggctgcagaagagggcc 510
||||||| ||||||||| ||| | ||| | |||||||||||| || |||||
Sbjct: 90 aagtagatgaggaactggatgcttgcgttcaccgtcggctgcagcagggggcc 38
>gb|CW261808.1|CW261808 104_729_11229713_148_35203_077 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229713, DNA
sequence
Length = 677
Score = 63.9 bits (32), Expect = 3e-008
Identities = 65/76 (85%)
Strand = Plus / Minus
Query: 278 tcagggtacatcgtcttcagcagctccagcaggtcacgcgcgctgatgaaatgaggagcg 337
||||||||||| ||||||||| ||||||||||| || || ||||| | |||||| |||
Sbjct: 477 tcagggtacatgctcttcagcaagtccagcaggtcgcgggcactgataacatgaggcgcg 418
Query: 338 caaatgtgcctgccgg 353
|| |||||||||||||
Sbjct: 417 cagatgtgcctgccgg 402
Score = 48.1 bits (24), Expect = 0.002
Identities = 120/152 (78%)
Strand = Plus / Minus
Query: 449 cctttcaggaagtagacgaggaactgacagctcgtgttgagcgtcggctgcagaagaggg 508
||||| |||||||||| ||||||||| ||| | ||| | |||||||||||| || |||
Sbjct: 219 cctttgaggaagtagatgaggaactggatgcttgcgttcaccgtcggctgcagcaggggg 160
Query: 509 ccaaagaccacagctggattgaccgtcacaacatccagcccggtctgcttcgcgtattca 568
|| || |||| ||||||||| ||||| || || |||||||| ||| | ||||| |
Sbjct: 159 ccgaacaccaaccctggattgatagtcaccacgtcaagcccggtttgccgcccgtatgcg 100
Query: 569 agtgcggcctcttctgacgagatcttggcgac 600
|| || ||||||||||| ||||||||||||
Sbjct: 99 agcgccgcctcttctgagatgatcttggcgac 68
>gb|BE359210.1|BE359210 DG1_39_C02.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 603
Score = 63.9 bits (32), Expect = 3e-008
Identities = 88/106 (83%), Gaps = 3/106 (2%)
Strand = Plus / Minus
Query: 248 atgctctccttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagc 307
|||||||||||| |||||||||| | ||||||||||| ||||||||| ||||||
Sbjct: 118 atgctctccttggcaatgaaaggg---ttgtcagggtacatgctcttcagcaagtccagc 62
Query: 308 aggtcacgcgcgctgatgaaatgaggagcgcaaatgtgcctgccgg 353
||||| || || ||||| | |||||| ||||| |||||||||||||
Sbjct: 61 aggtcgcgggcactgataacatgaggcgcgcagatgtgcctgccgg 16
>gb|CB924988.1|CB924988 ABA1_29_B06.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_29_B06_A012 3', mRNA sequence
Length = 617
Score = 63.9 bits (32), Expect = 3e-008
Identities = 88/106 (83%), Gaps = 3/106 (2%)
Strand = Plus / Minus
Query: 248 atgctctccttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagc 307
|||||||||||| |||||||||| | ||||||||||| ||||||||| ||||||
Sbjct: 142 atgctctccttggcaatgaaaggg---ttgtcagggtacatgctcttcagcaagtccagc 86
Query: 308 aggtcacgcgcgctgatgaaatgaggagcgcaaatgtgcctgccgg 353
||||| || || ||||| | |||||| ||||| |||||||||||||
Sbjct: 85 aggtcgcgggcactgataacatgaggcgcgcagatgtgcctgccgg 40
>gb|CD213339.1|CD213339 HS1_40_A07.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_40_A07_A012 3', mRNA sequence
Length = 610
Score = 63.9 bits (32), Expect = 3e-008
Identities = 88/106 (83%), Gaps = 3/106 (2%)
Strand = Plus / Minus
Query: 248 atgctctccttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagc 307
|||||||||||| |||||||||| | ||||||||||| ||||||||| ||||||
Sbjct: 142 atgctctccttggcaatgaaaggg---ttgtcagggtacatgctcttcagcaagtccagc 86
Query: 308 aggtcacgcgcgctgatgaaatgaggagcgcaaatgtgcctgccgg 353
||||| || || ||||| | |||||| ||||| |||||||||||||
Sbjct: 85 aggtcgcgggcactgataacatgaggcgcgcagatgtgcctgccgg 40
>gb|BZ345693.1|BZ345693 ht56a04.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ht56a04 5', DNA sequence
Length = 542
Score = 61.9 bits (31), Expect = 1e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 975 ggtcgcggacggtgccgtggacggtgtagccacgggagaggaggagcttgacgagcca 1032
|||||||||| ||| ||| |||| ||| || ||||||||||||||||||||||||||
Sbjct: 200 ggtcgcggacagtggtgtgcacggcgtanccgcgggagaggaggagcttgacgagcca 257
>gb|CW098263.1|CW098263 104_464_11002911_148_34364_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11002911, DNA
sequence
Length = 683
Score = 61.9 bits (31), Expect = 1e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 992 tggacggtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 101 tggacggcatagccacgggagaggagcagcttcacgagccaggaggcgatg 51
>gb|CW202059.1|CW202059 104_628_11184893_116_37086_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11184893, DNA
sequence
Length = 680
Score = 61.9 bits (31), Expect = 1e-007
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 992 tggacggtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 101 tggacggcatagccacgggagaggagcagcttcacgagccaggaggcgatg 151
>gb|CW217859.1|CW217859 104_651_11195875_148_37457_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195875, DNA
sequence
Length = 698
Score = 61.9 bits (31), Expect = 1e-007
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 992 tggacggtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 578 tggacggcatagccacgggagaggagcagcttcacgagccaggaggcgatg 628
>gb|CW266537.1|CW266537 104_736_11232481_116_35281_009 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232481, DNA
sequence
Length = 589
Score = 61.9 bits (31), Expect = 1e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 992 tggacggtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 333 tggacggcatagccacgggagaggagcagcttcacgagccaggaggcgatg 283
>gb|AW671852.1|AW671852 LG1_352_C05.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 570
Score = 61.9 bits (31), Expect = 1e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 992 tggacggtgtagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 304 tggacggcatagccacgggagaggagcagcttcacgagccaggaggcgatg 254
>gb|CL180568.1|CL180568 104_390_10896117_116_31930_261 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10896117, DNA
sequence
Length = 303
Score = 60.0 bits (30), Expect = 5e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 995 acggtgtagccacgggagaggaggagcttgacgagcca 1032
|||| |||||| ||||||||||||||||||||||||||
Sbjct: 2 acggcgtagccgcgggagaggaggagcttgacgagcca 39
>gb|CW202060.1|CW202060 104_628_11184893_148_37085_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11184893, DNA
sequence
Length = 711
Score = 60.0 bits (30), Expect = 5e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 1001 tagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 711 tagccacgggagaggagcagcttcacgagccaggaggcgatg 670
>gb|CD461540.1|CD461540 SA1_32_D01.g2_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_32_D01_A002 5', mRNA sequence
Length = 346
Score = 60.0 bits (30), Expect = 5e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 1001 tagccacgggagaggaggagcttgacgagccacgaggcgatg 1042
||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 345 tagccacgggagaggagcagcttcacgagccaggaggcgatg 304
>gb|CW093955.1|CW093955 104_457_11000061_116_37477_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11000061, DNA
sequence
Length = 589
Score = 58.0 bits (29), Expect = 2e-006
Identities = 32/33 (96%)
Strand = Plus / Plus
Query: 1000 gtagccacgggagaggaggagcttgacgagcca 1032
||||||||||||||||||||||||||| |||||
Sbjct: 538 gtagccacgggagaggaggagcttgactagcca 570
>gb|CD205252.1|CD205252 HS1_13_D05.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_13_D05_A012 3', mRNA sequence
Length = 527
Score = 56.0 bits (28), Expect = 8e-006
Identities = 87/106 (82%), Gaps = 3/106 (2%)
Strand = Plus / Minus
Query: 248 atgctctccttgctaatgaaagggtaatcatcagggtacatcgtcttcagcagctccagc 307
|||||||||||| |||||||||| | ||||||||||| ||||||||| ||||||
Sbjct: 112 atgctctccttggcaatgaaaggg---ttgtcagggtacatgctcttcagcaagtccagc 56
Query: 308 aggtcacgcgcgctgatgaaatgaggagcgcaaatgtgcctgccgg 353
||| | || || ||||| | |||||| ||||| |||||||||||||
Sbjct: 55 agggcgcgggcactgataacatgaggcgcgcagatgtgcctgccgg 10
>gb|CN135147.1|CN135147 OX1_30_G11.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_30_G11_A002 5', mRNA sequence
Length = 773
Score = 56.0 bits (28), Expect = 8e-006
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 591 tcttggcgacagaataccagttctcttcgttcctgcagaactctttatctgaccagcagt 650
||||||| ||||||||||||| ||| | | | ||||||||||| | |||||||||||
Sbjct: 586 tcttggcaacagaataccagtcctccttctccttgcagaactctgtgtctgaccagcaac 527
Query: 651 tctcatctttga 662
||||||||||||
Sbjct: 526 tctcatctttga 515
>gb|CN132257.1|CN132257 OX1_5_C03.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_5_C03_A002 3', mRNA sequence
Length = 673
Score = 54.0 bits (27), Expect = 3e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 605 taccagttctcttcgttcctgcagaactctttatctgaccagcagttctcatctttgat 663
||||||||||| | ||| ||||||| | ||| |||||||||||| |||||||||||||
Sbjct: 90 taccagttctcattcttcatgcagaagtttttgtctgaccagcagctctcatctttgat 32
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 298,147
Number of Sequences: 832831
Number of extensions: 298147
Number of successful extensions: 83812
Number of sequences better than 0.5: 114
Number of HSP's better than 0.5 without gapping: 114
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83600
Number of HSP's gapped (non-prelim): 210
length of query: 1201
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1181
effective length of database: 474,703,049
effective search space: 560624300869
effective search space used: 560624300869
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)